WO2016125933A1

WO2016125933A1 - Method for determining fruit color of fruit vegetables

Info

Publication number: WO2016125933A1
Application number: PCT/KR2015/001187
Authority: WO
Inventors: 노일섭; 황인덕; 김영욱; 박종인; 양기웅; 정희정; 우딘아메드 나잘
Original assignee: 순천대학교 산학협력단
Priority date: 2015-02-05
Filing date: 2015-02-05
Publication date: 2016-08-11

Abstract

The present invention relates to a method for determining the fruit color of fruit vegetables, characterized by determining whether the fruit color of fruit vegetables is green, brown, yellow, or red, by checking whether the functions of the phytoene synthase 1 (PSY1) gene are normal or not and whether the nucleotide sequence of the stay green 1 (SGR1) gene varies or not.

Description

How to determine the color of fruit

The present invention relates to a method for determining the fruit color of fruit and vegetables, and more specifically, to determine whether the normal function of PSY1 (phytoene synthase 1) gene from the fruit vegetable sample, and to determine whether the mutation of SGR1 (stay green 1) gene sequence A method for judging overcolor of a fruit vegetable, characterized in that the fruit color of the fruit vegetable includes determining green, brown, yellow or red color.

Carotenoids are organic molecules containing C40 isoprenoid compounds, which range from yellow to red and red, mainly synthesized in photosynthetic organisms, and in plants in chloroplasts and chromoplasts. It is biosynthesized and gives color to the photosynthetic tissues of reproductive organs, such as flowers and roots (Ha, SH, et al. , 2007, J. Exp. Bot., 58: 3135-3144). Types of carotenoids include β-carotene (orange pigments such as carrots, ginseng, seaweed, shellfish, etc.), lycopene (red pigments such as lycopene, tomatoes, watermelons), and fucoxanthin (yellowish brown or brown pigments of seaweeds). , Lutein (green pigment, such as exhaustion, spinach, eggs). Of these, β-carotene acts as a precursor of vitamin A in the human body, and it is effective in preventing circulatory disease, cancer and adult diseases due to its strong anti-oxidant effect, harmful oxygen scavenging effect, cancer cell proliferation and carcinogenesis. It is known to have Accordingly, the consumption of fruit vegetables containing carotenoids is continuously increasing, and accordingly, the development of new varieties of various forms, colors, and ingredients of fruits is also continuously increasing.

However, despite the development of new varieties of fruits and vegetables, the genetic similarity of the breeding materials is so high that the phenotypes of the varieties do not show a big difference. Especially, in the case of fruiting, the color of the fruit is fully matured until the fruit ripens. Therefore, it is necessary to establish a breeding technique using molecular markers for overcoloring.

In recent decades, genetic engineering of plants, such as tomatoes, Arabidopsis , and paprika, has led to the study of enzyme genes related to carotenoid biosynthesis. More specifically, yellow tomato fruit is produced by mutating the 3 chromosome r position (locus, r ²⁹⁹⁷ ) of the PSY1 (phytoene synthase 1) gene to inhibit the synthesis of phytoene, and the orange tomato fruit is CRTISO 10 chromosome tangerine position (locus, t ³⁰⁰² ) mutation of the (cis-trans isomerase) gene results in 7,9,7 ', 9'-tetra-cis-lycopene (7,9,7', 9'- tetra-cis-lycopene, prolycopene) is produced by accumulation. In addition, the orange tomato fruit is produced by mutation at the 12 chromosome Delta position of the lycopene β-cylase ( LCY-B ) gene to increase the synthesis of delta-carotene, or at the maturation stage of CYC-B ( By expression of chromoplast specific lycopene β-cylase gene, 5-10 times more beta-carotene is synthesized than wild-type tomato fruit, and brown tomato fruit is composed of 8 chromosomes of stay green ( SGR ) gene. Chromosome) Mutations in the gf (green-flesh) position are produced by inhibiting the degradation of chlorophyll during maturation (David E., et al. , 2012, PANS, 109 (40): 19021-19026; Ilan Paran and Esther van der Knaap, 2007, Journal of Experimental Botany, 23: 1-12 .; Ronen, G., et al. , 2000, Proceedings of the National Academy of Sciences, 97: 11102-11107 .; Barry et al. , 2008, Plant physiology, 147: 179-187. In recent years, the expression of SGR1 (stay green 1) gene in tomato fruit maturation has been reported to be associated with PSY1 (phytoene synthase 1) gene (Zhidan Luo., Et al. , 2013, New Phytologist, 198: 442). -452.)

In this connection, the Republic of Korea Patent No. 10-0331183 discloses that about selective breeding involved in the pepper using PSY (phytoene synthase) which is involved in the determination of the red pepper modification gene and this gwasaek, supra is the PSY gene It is disclosed that the defect causes carotenoid deficiency in the fruit, and thus orange orange color rather than normal red color. Korean Patent No. 10-0990330 discloses a sweet potato-derived IbOrange protein related to carotenoid accumulation and a gene encoding the same. In addition, Korean Patent Publication No. 2008-0087849 discloses mitochondrial complex I, II, III and / or IV, more preferably mitochondrial complex I in plants, plant cells, callus, tissues, fruits, roots or other parts of the plant. A method of increasing the content of carotenoids and other isoprenoids, in particular lycopene and / or β-carotene, and / or increasing the height of the plant by damaging them, is disclosed in Korean Patent No. 10-0647767. When the plant ages, it is involved in the chlorophyll breakdown metabolism of the leaves, causing mutations in the new SGR (stay-green) gene that causes leaf yellowing, or inhibiting the expression of proteins encoded by the SGR gene. Disclosed are a new green sustainable gene and a method for preparing a green persistent mutant plant to maintain leaf green. However, as disclosed in the above paper or prior patents, the phenotype of hypercoloration by mutations on the PSY1 (phytoene synthase 1) gene is yellow or orange, and SGR1 (stay green 1) Since the phenotype of overcoloring by mutations on the gene is brown, it is difficult to clearly identify the overcoloring of the fruits and vegetables by mutations of only one type of gene, such as the PSY1 gene or the SGR1 gene.

On the other hand, SNP (single nucleotide polymorphism) provides important clues in genetic information, such as the appearance characteristics, genetic diseases, and custom-made prescriptions that vary from person to person, so much research has been conducted since the early days of genetic information studies. In particular, more than 200,000 single nucleotide polymorphisms (SNPs) have been found in the human genome so far, and the amount is rapidly accumulating (Wang, DG, et al., 1998, Science, 280: 1077-1082.) . This sequence change is highest in the non-coding region, and it is known that the intron region has a higher degree of sequence change than the exon region in the coding region (Ching, A., et. al. , 2002, BMC Genet., 3:19 .; Van Deynze, AE, et al. , 2007b, In Plant and Animal Genome XV. San Diego, CA. Scherago International.). That is, since intron sequences are often conserved in the same form among different species, a method of making SNPs from introns or non-coding regions is used to find SNPs (Fourmann, MP, et al. , 2002, Theor. Appl. Genet., 105: 1196-1206.). Using these differences in nucleotide sequences, we can develop molecular markers that can be distinguished between very close varieties. In the case of tomatoes, however, it is not yet known which gene influences the green and green phenotype.

The present inventors Green in the fruit and vegetable seeds, expression trait SGR1, PSY1 polymorphisms on the brown or yellow gwasaek, i.e. SGR1, reveals whether by mutations in which a base of PSY1 gene, to determine the gwasaek of fruits and vegetables according to the features or absence of PSY1 gene and SGR1 gene As a result of trying to develop a method that can achieve the present invention was completed.

An object of the present invention is to confirm the normal function of the PSY1 (phytoene synthase 1) gene from the fruit vegetable sample, and to check whether the mutation of the SGR1 (stay green 1) gene sequence indicates that the fruit is green, brown, yellow or red. It is to provide a method for determining.

The present invention relates to a method for confirming the normal functioning of the PSY1 (phytoene synthase 1) gene from a sample of fruit vegetables, and determining the hypercoloration of the fruit vegetable by checking whether the SGR1 (stay green 1) gene sequence is mutated.

More specifically, the color determination of the fruit vegetable of the present invention comprises: a) loss of the function of the PSY1 (phytoene synthase 1) gene, and the sequence of the 371, 1,647 or 1,679 base sequences of the normal SGR1 gene consisting of SEQ ID NO: 1. If one or more of which is a base variation is determined that the green, and b) PSY1 gene is a normal function, and the wild type nucleotide sequence 371 th, 1,647 th or 1679th base sequence of one or more bases of one of SGR1 gene consisting of SEQ ID NO: 1 If the mutation is determined to be brown, c) PSY1 (phytoene synthase 1) gene function is lost, if the base sequence of the normal SGR1 gene consisting of SEQ ID NO: 1 is yellow, or d) PSY1 gene is normal function When the base sequence of the normal SGR1 gene consisting of SEQ ID NO: 1 is determined by red.

In the present invention, the normal function or loss of function of the PSY1 (phytoene syntase 1) gene increases or decreases the amount of phytoene at the stage of fruit fruit ripening (carotenoids (eg, lycopene, β-) By controlling the accumulation of carotene, etc.).

In one specific embodiment, carotenoids, especially the very red lycopene or β-carotene, are synthesized when the PSY1 gene functions normally at the stage of fruit ripening. Purple, brown, or pink, preferably red or brown, but inhibits the synthesis of lycopene or β-carotene if the PSY1 gene is defective and the function of the PSY1 gene is lost It can be inferred to exhibit a yellow, green or white color, preferably yellow or green. In this case, the defect may be a portion of the base of the PSY1 gene is deleted, or a single or a plurality of bases are substituted or inserted.

The base sequence of the PSY1 gene can be identified as Solyc03g031860 in Sol genomics network (http://solgenomics.net).

In one specific embodiment, PCR was carried out using a primer set prepared according to the present invention to amplify the PSY1 gene as a template from genomic DNA isolated from the flesh of fruit vegetables having different colors, resulting in yellow and green coloring. the genomic DNA of the Fruits and Vegetables having had PSY1 gene is not amplified, which has one or more bases in the first exon (exon) of the gene inserted PSY1 is inferred that lost the function of PSY1 gene (see example 2).

In the present invention, the nucleotide sequence variation of the SGR1 (stay green 1) gene is deleted, substituted or inserted into the base of a specific region of the nucleotide sequence to inhibit the degradation of chlorophyll (chlorophyll) by inactivation or degradation of the SGR1 protein This means that the color of the fruits and vegetables changes.

In the present invention, the mutation is not necessarily limited if the SGR1 protein is inactivated, but preferably the 371th , 1,647 or 1,679 bases of the normal SGR1 gene sequence consisting of SEQ ID NO: 1 is substituted with another base. Characterized in that it is made.

In the present invention, the fruit color determination method of the fruit vegetable can select and specify the fruit vegetable having a green, brown, yellow or red fruit color simply and accurately before the fruit of the fruit vegetable fully matures.

In one specific embodiment, when the function of the PSY1 gene is lost, and the 371th , 1,647, or 1,679th bases of the normal SGR1 gene sequence consisting of SEQ ID NO: 1 are mutated, it may be determined that the fruit is green.

As another specific embodiment, when the PSY1 gene functions normally and the 371th , 1,647, or 1,679th bases of the normal SGR1 gene sequence consisting of SEQ ID NO: 1 are mutated, it can be determined that the fruit is brown.

Here, the mutation is the 371 base cytosine (C) of the normal SGR1 gene sequence consisting of SEQ ID NO: 1 is replaced with thymine (T), 1,647 base adenine (A) is substituted with thymine (T), or 1,679 The first base thymine (T) may be made by replacing with cytosine (C). In this case, the 371th base, 1,647th base, or 1,679th base of the normal SGR1 gene base sequence is a single nucleotide polymorphism (SNP) of the SGR1 gene whose fruit color is brown or green.

More specifically, the substitution of the 371th base in the normal SGR1 gene sequence is translated into a stop codon (TAA), not glutamine (Gln, Q; C AA), which is the 91th amino acid in the process of translating the SGR1 gene into an amino acid, Substitution of the 1,647 th base yields serine (Ser, S; AG T ) rather than 143 th amino acid Arginine (Arg, R; AG A ) in the process of translating the SGR1 gene into amino acids. Variable splicing occurs at the third exon of the SGR1 gene, and the AGRTTCA TAA TAAATTGCCACCATATCTATG sequence is inserted into the mRNA, resulting in inactivation of the SGR1 protein by the termination codon (TAA). It can be inferred that hypercoloring represents a brown or green phenotype.

As another specific embodiment, when the function of the PSY1 gene is lost and it has the normal type SGR1 gene sequence consisting of SEQ ID NO: 1, it may be determined that the fruit is yellow. In addition, when the PSY1 gene has a normal function and has a normal SGR1 gene sequence consisting of SEQ ID NO: 1, it may be determined that the fruit color of the vegetable is red.

In the present invention, confirmation of the normal function of the PSY1 gene is polymerase chain reaction (PCR), real-time polymerase chain reaction (real-time PCR, quantitative real time polymerase chain) reaction, qPCR), western blot, DNA microarray and the like can be identified using a variety of DNA analysis known in the art, but is not necessarily limited thereto.

In one specific embodiment, confirmation of the normal function of the PSY1 gene of the present invention is based on genomic DNA isolated from the fruit of the fruit, and a primer set prepared according to the present invention for amplifying the normal PSY1 gene (SEQ ID NO: 2). To the forward primer selected from the group consisting of 4 to 4 and the reverse primer selected from the group consisting of SEQ ID NO: 5 to 7) can be confirmed by performing electrophoresis on the agarose gel after PCR. As one example, after performing the experiment by the above method, if the band is confirmed in the electrophoresis result, it is determined that the PSY1 gene functions normally, and if the band is not confirmed, it may be determined that the function of the PSY1 gene is lost.

In the present invention, the sequencing of the SGR1 gene is determined by direct sequencing, DNA microarray, temperature gradient gel electroresis (TGG), single strand conformation polymorphism (SSCP), and denaturing high DHPLC. It can be explored using a variety of DNA assays known in the art, such as performance liqueid chromatography (HRM), high-resolution melting (HRM) analysis, and preferably direct sequencing and high-resolution melting (HRM) assays. , More preferably using high-resolution melting (HRM).

As another specific embodiment, the mutation of the SGR1 gene sequence is extracted by using genomic DNA (genomic DNA) from the fruit of the fruit vegetables, and used as a template, and the unlabeled oligonucleotide probe (Luna probe) and produced in accordance with the present invention Real-time polymerase reaction (PCR) can be performed by adding primer sets or probes, and then performing melting curve analysis. As one example, as a result of the experiment by the above method, the melting temperature of the probe including the 371 base of the SGR1 gene sequence consisting of SEQ ID NO: 1 is 63 ℃ to 63.5 ℃, preferably at 63.2 ℃ melting curve ( melting curve) or the melting temperature of the probe including the 1,647th base of the SGR1 gene sequence consisting of SEQ ID NO: 1 is a melting curve (melting curve) at 61.5 ℃ to 62.5 ℃, preferably 62 ℃, Melting temperature of the probe including the 1,679th base of the SGR1 gene base sequence consisting of SEQ ID NO: 1 can be determined that the base sequence of the SGR1 gene is mutated when it is confirmed at 59.5 ℃ to 60.5 ℃, preferably 60 ℃.

In the present invention, the fruit vegetable is not limited to this if it is a fruit vegetable containing a carotenoid, for example, may be one selected from the group consisting of tomatoes, paprika, pepper, grapefruit, watermelon, carrot and melon, preferably To make is tomato.

As described above, the fruit color determination method of the fruit vegetable of the present invention can select and specify the fruit vegetable having a green, brown, yellow or red fruit color simply and accurately before the fruit of the fruit vegetable fully matures. Or in the cultivation of fruits and vegetables with red fruit color has the effect of saving time and labor. In addition, since it is not necessary to decode the nucleotide sequence of the amplification product DNA, it can save a great deal of time and money.

On the other hand, based on the single nucleotide polymorphism (SNP) nucleotide sequence of the green or brown fruit vegetable SGR1 gene determined by the present invention, a polynucleotide consisting of 18 or more consecutive nucleotides comprising the single nucleotide polymorphism site or its Primer sets or probes for discriminating fruit or vegetable varieties having a green or brown fruit color comprising complementary polynucleotides can be designed and used to determine fruit or vegetable fruits of green or brown fruit color.

When determining the fruit or vegetable with green or brown fruit color using the primer set or probe, various reagents required for the experiment (for example, PCR) and confirming the result, such as PCR composition, restriction enzyme, agarose , Buffers necessary for hybridization and electrophoresis may be additionally used. The PCR composition may contain an appropriate amount of DNA polymerase (eg, Thermus aquatiucs (Taq), Thermus thermophilus (Tth), Thermus filiformis , Thermis ) in addition to the complementary DNA synthesized by reverse transcription and the primer set or probe provided in the present invention. heat stable DNA polymerase from flavus , Thermococcus literalis or Phyrococcus furiosis (Pfu), dNTP, PCR buffer and water (dH ₂ O). The PCR buffer is not limited thereto, but an appropriate amount of Triton X-100, dimethylsulfoxide (DMSO), Tween20, nonidet P40, PEG 6000, formamide and bovine serum albumin (BSA), etc. This may further include. In addition, the buffer solution required for the electrophoresis may include Tris-HCl (Tris-HCl), MgCl ₂ , KCl and the like.

The judging method of the present invention can select and specify fruit vegetables having a green, brown, yellow or red fruit color simply and accurately before the fruit of the fruit vegetable fully matures, so that fruit vegetables having an actual green, brown, yellow or red fruit color In growing cultivation has the effect of saving time and labor.

Fig. 1 is a visual observation of the hypercoloration of tomato strains having red (KNR3), yellow (TCY), brown (KNB1 and BUC38) and green (KNG2, BUC30) according to an embodiment of the present invention.

Fig. 2 is a diagram illustrating a position of a primer synthesized based on PSY1 gene information published in Sol genomics network (http://solgenomics.net) according to an embodiment of the present invention.

Fig. Figure 3 shows the results of electrophoresis on agarose gel after polymerase chain reaction using primers designed based on genomic DNA isolated from tomato flesh of different colors, based on PSY1 gene information. to be.

Fig. Figures 4a and 4b is a comparison of the nucleotide sequence of the SGR1 gene separated from the flesh of tomato strains having different colors.

Fig. Fig. 5 is a schematic representation of the position of SNPs of the single nucleotide polymorphism (SNP) of SGR1 gene isolated from the flesh of tomato strains of different colors.

Fig. Figure 6 shows the result of searching for single nucleotide polymorphism (SNP) through HRM analysis of the SGR1 gene isolated from the flesh of tomato with different colors.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in more detail, and the scope of the present invention is not limited by these examples in accordance with the gist of the present invention to those skilled in the art. Will be self-evident.

실시예 1 : 실험에 사용되는 토마토 재료 준비Example 1 Preparation of Tomato Ingredients for Experiments

Tomato KNR3 (Red), TCY (Yellow), KNB1 (Brown), BUC38 (Brown), BUC30 (Green), and KNG2 (Green) strains were divided into Kanaseed. Co. Ltd., Korea and Bunong Seedling Co. Ltd., Korea) and conducted the experiment. The seed of the strain was then placed in a petri dish containing filter paper (No. 1, Whatman, Germany), and the distilled water was poured so that the filter paper was completely wet. Seeds were then germinated in the dark at 30 ° C. Thereafter, the seeds were transferred to a plastic pot (7.5 cm in diameter) containing seedling soil, and then planted until four true leaves emerged. At this time, the cultivation was carried out at Suncheon University Green House, which maintains a temperature of 25 ℃ during the day, 18 ℃ at night, 70% humidity and natural light transmission.

실시예 2 : 각 계통의 Example 2 of each strain PSY1 PSY1 유전자 발현 유무 확인Confirmation of Gene Expression

Genomic DNA was extracted from the leaves of tomato plants from the lines prepared in Example 1, followed by polymerase chain reaction (PCR) using pfuTurbo DNA polymerase (Stratagene, Agilent technologies) and primers to amplify the PSY1 gene. The primers were synthesized based on PSY1 gene information published in Sol genomics network (http://solgenomics.net). 2 and Table 1 are shown. The polymerase chain reaction was denatured at 95 ° C. for 5 minutes, then denatured at 95 ° C. for 30 seconds, amplified at 60 ° C. for 30 seconds, and extended for 2 minutes at 72 ° C. for 40 cycles. After the post-extension, the post-extension was conducted at 72 ° C. for 7 minutes. Then, the amplified DNA and 100 bp DNA ladder (M, 3407A, Takara, Japan) were confirmed after electrophoresis on 1.2% agarose gel (agrose gel). The results are shown in Fig. 3 is shown.

Table 1

Primer Name	Primer base sequence (5 '→ 3')
Psy1F4	AACAAATTGCATTCTCCATTCTTGGA (SEQ ID NO: 2)
Psy1CDSF	ATGTCTGTTGCCTTGTTATGGGTTGTTTC (SEQ ID NO: 3)
Psy1F7	GTGGTGAAGTATGTGCAGAGTATGCA (SEQ ID NO: 4)
Psy1R5	TGCATACTCTGCACATACTTCACCAC (SEQ ID NO: 5)
Psy1F6	TGACAGAATTGAGCTCAGCTAGTAGAT (SEQ ID NO: 6)
Psy1RTR1	ACCGTACCAGCAACATAATAACAATA (SEQ ID NO: 7)

As a result, the product amplified using the Psy1F4 and Psy1R6 primer sets and the Psy1F7 and Psy1RTR1 primer sets showed bands in all lines, but the products amplified using the Psy1F4 and Psy1R5 primer sets or the Psy1CDSF and Psy1RTR1 primer sets were identified as KNR3 (Red). ), Bands were identified only in the KNB1 (Brown) and BUC38 (Brown) lines.

It is thought that the specific sequence is inserted into the first exon of the PSY1 gene, and the function of the PSY1 gene is lost. Tomatoes that do not express the PSY1 gene are inhibited from phytoene synthesis, thereby inhibiting carotenoids. It is inferred that yellow coloration occurs when only the function of the PSY1 gene is lost, and green coloration is observed when the function of the SGR1 gene is lost at the same time.

실시예 3 : 각 계통의 Example 3 of each line SGR1SGR1 유전자 클로닝 Gene cloning

Genomic DNA was extracted from the leaves of tomato plants from the lines prepared in Example 1, and then polymerase chain reaction (PCR) was performed using pfuTurbo DNA polymerase (Stratagene, Agilent technologies) and primers. At this time, the primers were synthesized based on SGR1 gene information published in Sol genomics network (http://solgenomics.net), and the base sequences thereof are shown in Table 2 below. The polymerase chain reaction was denatured at 95 ° C. for 5 minutes, followed by denaturation at 95 ° C. for 30 seconds, amplification at 60 ° C. for 30 seconds, and extension at 72 ° C. for 2 minutes for 30 cycles. After the post-extension, the post-extension was conducted at 72 ° C. for 7 minutes. Then, the amplified SGR1 gene was prepared by cloning in a blunt vector (TOPcloner ™ Blunt kit, EZ002S, Enzynomics, Korea) cut at both ends.

TABLE 2

gene	Forward primer (5 '→ 3')	Reverse primer (5 '→ 3')
SGR1	ATGGGAACTTTGACTACTTCTCTAG (SEQ ID NO: 8)	TCAACTTTGCTGCTCTTGCAAGCCT (SEQ ID NO: 9)

실시예 4 : 각 계통의 Example 4 of each strain SGR1 SGR1 유전자 염기서열 및 Gene sequence and SGR1SGR1 유전자를 암호화하는 아미노산 서열 분석 Amino Acid Sequence Analysis Encoding Genes

The vector containing the SGR1 gene for each strain prepared in Example 3 was transformed into Escherichia coli, ie, transformed cells, which had increased membrane permeability, and then using a plasmid DNA purification kit (plasmid mini kit, 12125, Qiagen, Germany). The vector containing the SGR1 gene was extracted. Then, the vector containing the extracted SGR1 gene was commissioned by macrogen (macrogen crop., Korea) using the M13 primer in the vector for sequencing. The results are shown in Fig. 4a, Fig. 4b and Fig. 5 is shown.

As a result of the experiment, the SGR1 gene for each strain showed a 2,204 bp sequence, and in the case of TCY (Yellow) strain, it was confirmed that the SGR1 gene matched the SGR1 gene sequence of the tomato standard genome, ie, the tomato genome (normal type), which shows red and orange colors. It was. The normal SGR1 gene nucleotide sequence is shown in SEQ ID NO: 1.

On the other hand, in the KNB1 (Brown) and BUC38 (Brown) strains, the base cytosine (C) located at 371th was replaced with thymine (T) compared to the normal SGR1 gene sequence (SEQ ID NO: 1), and the KNG2 (Green) strain. In the case of the 1,647 base adenine (A) was substituted with thymine (T), in the case of BUC30 (Green) line 1,679 base thymine (T) was confirmed that the substitution with cytosine (C).

Is considered the SGR1 gene substitution of the nucleotide sequence 371 th, 1,647 th or 1679th base in the SGR1 genes from the result of the lost this function, the tomatoes having a mutation in the nucleotide sequence of SGR1 gene therefrom of chlorophyll (chlorophyll) Degradation was suppressed and was judged to show green or brown hypercolor.

Therefore, based on the results of the Examples 2 to 4, PSY1 first due to the exon (exon) in the insertion of the base of PSY1 genetic function is lost, new wild type SGR1 gene sequence 371st bases of the cytokine gene ( Substituted with thymine (T) in C), adenine (A) with 1,647th base is substituted with thymine (T), or with thymine (T) with 1,679 base and cytosine (C). , The function of the PSY1 gene is normal, and the 371th base of the normal SGR1 gene sequence is replaced by thymine (T) in cytosine (C), or the adenine (A), which is the 1,647th base, by thymine (T), When thymine (T), which is the 1,679th base, was substituted with cytosine (C), it was judged to exhibit brown hypercolor. In addition, the first exon (exon) of PSY1 gene due to the insertion of the base of PSY1 gene function is lost and has the wild type SGR1 gene sequence indicates the yellow gwasaek, and PSY1 gene function is normal, wild type SGR1 the gene sequences Eggplant was judged to show red overcoloring.

실시예 5 : 각 계통의 Example 5 of each strain SGR1SGR1 유전자의 단일염기다형성(single nucleotide polymorphism, SNP) 탐색을 위한 HRM(high-resolution melting) 분석 High-resolution melting (HRM) analysis to detect single nucleotide polymorphism (SNP) of genes

The total volume of the reaction solution for HMR analysis was 20 μl. The genomic DNA isolated from the leaves of each tomato lineage prepared in Example 1 was used as a template, and the single nucleotide polymorphism site of the SGR1 gene was designed to be amplified. Put the primer set, 3 'end unlabeled oligonucleotide probe (luna probe) and 2x reaction solution (LightScanner Master mix), add distilled water to a final volume of 20 µL, and denature at 95 ° C for 5 minutes. 50 cycles of denaturation at 95 ° C. for 20 seconds, annealing at 60 ° C. for 20 seconds, extension at 72 ° C. for 20 seconds, and post-extension. 40 seconds at 72 ° C. That was then analyzed programmatic melting curve (melting curve) by measuring the fluorescence amount at the interval 0.2 ℃ per second to a temperature 40 ℃ 80 ℃ of ^{LightScanner (LightScanner ® Instrument System, Idaho} Technology, USA) the amplified sample. At this time, the oligonucleotide probe is designed based on the specific nucleotide sequence of the single nucleotide polymorphism site of the SGR1 gene, the sequence is shown in Table 3. The results are shown in Fig. 6 is shown.

TABLE 3

system		Forward primer (5 '→ 3')	Reverse primer (5 '→ 3')
KNB1 and BUC38	Primer set	AGCATCCAGGAAAGTTGCCAAGAACA (SEQ ID NO: 10; SGR1F1)	AGAGAGTTTCTGATAGACCTCGACTAT (SEQ ID NO: 11; SGR1R1)
KNB1 and BUC38	Probe	GGCTATCTCCTAAACCATCA (SEQ ID NO: 12; SGR1prob1P1)	-
KNG2	Primer set	AGAGATGAAGTTGTTGCAGAGTGGAAGA (SEQ ID NO: 13; SGR1F3)	TGGGAAGTTCGAACGACATACATACAT (SEQ ID NO: 14; SGR1R3)
KNG2	Probe	CTAGACTCAGTAACTACATCT (SEQ ID NO: 15; SGR1prob3P1)	-
BUC30	Primer set	TCCATTGCCACATTAGTGGAGGCCAT (SEQ ID NO: 16; SGR1F4)	CCTATGGTTGTGTGTTTGATCCTCCA (SEQ ID NO: 17; SGR1R4)
BUC30	Probe	ACTCCCTGTGGTAAGTTCATAA (SEQ ID NO: 18; SGR1prob4P1)

Experimental results brown grid probe including the 371 th base of the SGR1 gene sequence of KNB1 and BUC38 representing gwasaek was the melting curve (melting curve) found at 63.2 ℃, 1,647 of SGR1 gene of strains KNG2 representing green gwasaek sequence th Melting curve of the probe containing the base was confirmed at 62 ° C, and the melting curve of the probe containing the 1,679th base of the SGR1 gene sequence of the strain BUC30 of the green fruit color was confirmed at 60 ° C. .

Claims

PSY1 (phytoene synthase 1) gene is confirmed whether the normal function, and the SGR1 (stay green 1) gene sequencing to determine whether the color of the fruit vegetable, the color of the vegetable is a) PSY1 (phytoene synthase 1) When the gene is lost and one or more bases of the 371, 1,647 and 1,679 base sequences of the normal SGR1 gene sequence consisting of SEQ ID NO: 1 are mutated, it is determined to be green, and b) the PSY1 gene is It functions as normal and judges that it is brown when one or more bases of the 371th , 1,647, or 1,679th nucleotide sequences of the normal SGR1 gene consisting of SEQ ID NO: 1 are mutated, and c) of the PSY1 (phytoene synthase 1) gene. If functionality is lost, having the base sequence of the wild type gene SGR1 consisting of SEQ ID NO: 1, it is determined that the yellow, or d) the normal function of the gene PSY1 And SEQ ID NO: when having the base sequence of the wild type gene SGR1 consisting of a first method gwasaek determination of fruits and vegetables, characterized in that determining that the red.
The method according to claim 1, wherein the normal function of the PSY1 gene is a genomic DNA isolated from fruit vegetables as a template, and a forward primer selected from the group consisting of SEQ ID NOs: 6 to 8 and a forward primer selected from the group consisting of SEQ ID NOs: 3 to 5 A method of judging overcoloring of fruits and vegetables, characterized in that the polymerase chain reaction (PCR) is carried out using a set to confirm the presence or absence of a band.
The method of claim 1, wherein the variation of the SGR1 gene oligonucleotides to SGR1 gene DNA extracted from the pulp of fruits and vegetables the primer set and the 3 'end to amplify the single nucleotide polymorphism (SNP) of SGR1 gene unlabeled oligonucleotide probe (Luna probe) And adding a real-time polymerase reaction (PCR), and then confirming a melting curve through analysis, wherein the melting curve of the SGR1 gene sequence consisting of SEQ ID NO: 1 371 Melting temperature of the probe including the first base is confirmed at 63 ℃ to 63.5 ℃, or the melting temperature of the probe containing the 1,647 base of the SGR1 gene base sequence of the melting curve (melting curve) consisting of SEQ ID NO: 61.5 ℃ Melting temperature of the probe which is confirmed at 6 to 62.5 ℃, or comprises the 1,679 base of the SGR1 gene sequence consisting of SEQ ID NO: 1 at 59.5 ℃ to 60.5 ℃ When it is confirmed that the nucleotide sequence of the SGR1 gene is judged that the mutated fruit vegetables, characterized in that the mutation.
The method of claim 1, wherein the fruit and vegetable is one selected from the group consisting of tomato, paprika, pepper, grapefruit, watermelon, carrot, and melon.