CN114350840A - SNP (single nucleotide polymorphism) and specific CAPS (CAPS) primers closely related to purple stripes of Chinese olive of capsicum and application of primers - Google Patents
SNP (single nucleotide polymorphism) and specific CAPS (CAPS) primers closely related to purple stripes of Chinese olive of capsicum and application of primers Download PDFInfo
- Publication number
- CN114350840A CN114350840A CN202210028836.7A CN202210028836A CN114350840A CN 114350840 A CN114350840 A CN 114350840A CN 202210028836 A CN202210028836 A CN 202210028836A CN 114350840 A CN114350840 A CN 114350840A
- Authority
- CN
- China
- Prior art keywords
- purple
- pepper
- caps
- olive
- primers
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of pepper molecular breeding, and discloses SNP (single nucleotide polymorphism) and specific CAPS (cleaved amplified polymorphic sequence) primers closely related to purple stripes of pepper olives and application thereof. The position of the SNP locus is 184,011,859 th site of pepper P10 chromosome, when the basic group is T, the pepper olive has purple stripe, and when the basic group is G, the pepper olive does not have purple stripe characteristic. The invention also provides a specific CAPS primer CAPS690-01 for detecting purple stripes of Chinese olive peppers, which can accurately detect whether the Chinese olive peppers have purple stripe characteristics in the seedling stage, has high accuracy, obviously improves the breeding efficiency and reduces the breeding cost.
Description
Technical Field
The invention relates to the technical field of pepper molecular breeding, in particular to SNP (single nucleotide polymorphism) and specific CAPS (cleaved amplified polymorphic sequence) primers closely related to purple stripes of pepper olives and application thereof.
Background
The color is one of the most important quality traits of the pepper fruits, and irreplaceably contributes to the sensory quality and the nutritional quality of the pepper fruits. The color of the pepper fruits varies from the green mature stage to the old mature stage, wherein the purple pepper fruits contain abundant anthocyanin which is beneficial to the health of human bodies. In addition, anthocyanin is an important antioxidant substance, and has important effects on the disease resistance, stress resistance, fruit storage resistance and the like of hot peppers.
Two genes that regulate purple accumulation of immature pepper fruits have been identified in pepper, CaAn2 and Ca3gt, respectively. The CaAn2 gene encodes an R2R3-MYB transcription factor, the coding region of the gene is not different between purple peppers and green peppers, and the purple peppers can accumulate anthocyanin because 4.3kb of non-long terminal repeat retrotransposon is inserted into the promoter region of the CaAn2 gene to activate the expression of the CaAn2 gene, so that the peppers can accumulate anthocyanin. According to the difference of promoter regions of the CaAn2 gene, a gene marker A _ SCAR (F: 5 'CACT CCGACTTGTCTTTACGG 3', P1R: 5 'TAACTTGAGCCGGGGGTCT 3', P2R: 5 'CACG GAAGGAGGCTAGTCAA 3') completely cosegregated with the CaAn2 gene is obtained, and CaAn2 genotype purple pepper germplasm can be accurately identified. The Ca3gt gene encodes a gene for anthocyanin transport, which is located at the downstream of CaAn2 gene of pepper Chr10 chromosome, and a closely linked marker CAPS-78-708 (F: 5 'CATGCCACAAGAAGTTGTAGCACAT 3', R:5 'ACTTTCATCAGAATTAACATCTGAAATAA 3') is obtained, and the phenotype of the genotype pepper is characterized in that anthocyanin is accumulated only on immature fruits and presents purple.
The purple stripe character of the Chinese olive of the hot pepper related by the invention shows the uneven distribution of purple longitudinal stripes from the fruits of the young fruit period of the hot pepper, which is similar to the 'bamboo filament eggplant' in the eggplant, and the purple stripe is not obviously colored by light. In solanaceous vegetables, it is not uncommon for the fruit to appear purple streaks in tomatoes and peppers, except for the fruit peel of "solarium nigrum". Therefore, the pepper material with the purple stripe character has important significance in developing pepper quality breeding, and meanwhile, a new case is provided for enriching the theory of synthesis and regulation mechanism of pepper anthocyanin and researching purple character of pepper.
Disclosure of Invention
The invention aims to provide application of a reagent for detecting SNP sites closely related to purple stripes of paprika olive in purple stripe breeding of paprika olive.
In order to achieve the purpose, the invention adopts the following technical measures:
the invention relates to a green fruit purple stripe material ' bamboo filament pepper Chen12 ' (purchased from Hubei vegetable and grain agriculture science and technology Co., Ltd.) and green fruit non-purple stripe pepper ' 16ZX101-M-1Linear pepper' (Li Ning, quality of uterus, Higholihua, Yi Yangxu, Yuchuying, Wangfei, old wealth, Wujun, Jiaochun sea, Yaominghua. Pepper germplasm resistance gene molecular marker detection [ J]Chinese vegetables 2020(08):19-32) construction of F2Separating the population, finely positioning and identifying candidate genes for regulating purple stripes of olive fruits of the peppers by using a BSA-seq combined population mapping method, and positioning a candidate segment of the purple stripe character related genes of the olive fruits at a physical position 184,002,197-184,365,711 of a pepper chromosome P10 (pepper CM334 reference genome, V1.55, ftp:// ftp. solgenomics. net/genes/Capsicum _ annuum/C.annuum _ cvCM334/) according to the difference of the candidate genes between parents of the purple stripes and non-purple stripes; and determining candidate genes for controlling the purple stripe characteristics of the hot pepper in the positioning interval according to the gene annotation information of the reference genome CM 334. Finally, screening out SNP sites related to the purple stripe character of the pepper, wherein the SNP sites are located at the 184,011,859 th site of a pepper P10 chromosome (a pepper CM334 reference genome, V1.55, ftp:// ftp. solgenomics. net/genes/Capsicum _ annuum/C.annuum _ cvCM334/), and when the basic group is T, the pepper olive has purple stripes, and when the basic group is G, the pepper olive does not have the purple stripe characteristic.
The protection content of the invention comprises: the application of a reagent for detecting SNP sites closely related to purple stripes of the olive of capsicum in the breeding of the purple stripes of the olive of capsicum; the SNP locus is at the 184,011,859 th site of the pepper P10 chromosome, the pepper CM334 reference genome, V1.55, ftp:// ftp.
In the above application, preferably, the reagent is a primer;
in the above-mentioned applications, preferably, the applicant designed primers for CAPS690-01, F: 5'-TGGATTCGTCGAACTCACTCAA-3'; 5'-ACGCAGTGAAGGGTATGGTC-3' is added. PCR amplification is carried out by using the primer, then enzyme digestion is carried out on the PCR product by using TaqI, and the enzyme digestion product is detected by 1% agarose gel electrophoresis:
if the enzyme digestion product is about 200bp fragments, the Chinese olive of the pepper material to be detected has purple stripes;
if the enzyme digestion product is about 200bp and 392bp fragments, the Chinese olive of the pepper material to be detected has purple stripes;
if the enzyme digestion product only contains 392bp fragments, the Chinese olive of the pepper material to be detected does not have purple stripes.
Compared with the prior art, the invention has the beneficial effects that:
the molecular marker developed by the invention can provide an effective technical means for auxiliary selective breeding of the color quality of the pepper fruits, the marker can be developed to select the purple stripe character of the pepper fruits at the seedling stage, the accuracy is high and is 100%, the breeding efficiency is obviously improved, and the breeding cost is reduced.
Drawings
FIG. 1 example 1 parent phenotypic characteristics;
wherein: a is plant of purple stripe parent ' bamboo filament pepper Chen12 ', b is flower and fruit of purple stripe parent ' bamboo filament pepper Chen12 ', c is non-purple stripe parent ' 16ZX101-M-1Plant of Zanthoxylum piperitum D is non-purple streak parent strain' 16ZX101-M-1Flowers and fruits of cayenne pepper');
FIG. 2 Primary mapping of the CaPS gene using BSA-seq.
Fig. 3 fine positioning of candidate intervals.
FIG. 4 is a restriction enzyme detection of the gene marker CAPS690-01 between the two parents.
FIG. 5 Gene marker SCAR690-01 vs. F2And (4) detecting the genotype of individual plants in a population part.
Detailed Description
The invention is described below by means of specific embodiments. Unless otherwise specified, the technical means used in the present invention are well known to those skilled in the art. In addition, the embodiments are to be construed as illustrative and not limiting the scope of the invention.
The experimental methods used in the following examples are all conventional methods unless otherwise specified; the instruments, materials, reagents, etc. used are commercially available unless otherwise specified.
Example 1:
the method for obtaining CAPS molecular markers related to purple stripe traits of Chinese olive of capsicum comprises the following steps:
1. obtaining of parent material for constructing pepper purple stripe character segregation population
In this example, the purple stripe material of Chinese olive, namely ' bamboo filament pepper Chen12 ', is used as the female parent (specifically, as shown in a and 1b in FIG. 1, purchased from Hubei vegetable and grain agriculture science and technology Co., Ltd.), and the non-purple stripe material of Chinese olive, namely ' 16ZX101-M-1Zanthoxylum schinifolium (specifically shown as c and d in figure 1, Lining, Gongli, Higholihua, Yiyanxu, Yuchuying, Wangfei, Chencai, Wujun, Jiaochun, Yaominghua. molecular marker detection of resistance gene of capsicum germplasm [ J]Chinese vegetables 2020 (08: 19-32) are hybridized to obtain F1Generation, F1Selfing to obtain F2And the generation is used for genetic analysis and gene mapping population of purple stripe characters.
2. Genetic analysis of purple stripe trait
F1Obvious purple stripes can be observed on the surfaces of the Chinese olive fruits of 20 single plants in the generation, and the purple stripes are consistent with the phenotypes observed on the parent 'bamboo filament pepper Chen 12', which indicates that the purple stripe characters are dominant characters. F2The lines of 161 individuals showed distinct segregation, purple streaks were observed in 128 individuals, purple streaks were not observed in 33 individuals, the segregation ratio of the purple streaks was 3.88:1, and the chi-square test was carried out at a p-0.05 level2=0.377<χ20.05-3.841, which matches the genetic segregation ratio of dominant monogene, indicating that the purple streaked character of olive in pepper is dominant monogene inheritance.
3. Mixed pool construction and preliminary positioning
According to 156F2Phenotypic characterization of Individual plants, from F2Selecting 30 single plants with obvious purple stripe characteristics and 30 single plants of green fruits from the population, respectively extracting genome DNA, and respectively constructing a purple stripe mixing pool (P pool) and a green mixing pool (G pool) after equivalently mixing; and simultaneously extracting double-parent DNA, and performing double-parent heavy sequencing. By taking pepper CM334 as a reference genome and utilizing a BSA-seq mixed pool sequencing method, a target gene candidate interval related to purple stripe characters is detected by analyzing allele frequency difference among mixed pools in delta (SNP-index). The resulting candidate interval is located on pepper P10 chromosome, and the specific information is shown in fig. 2. Based on the parental heavy sequencing data, 20 pairs of CAPS markers capable of uniformly covering the P10 chromosome were designed on the P10 chromosome, and these markers were analyzed at 156F2Initially positioning the genotypes of the individual plants of the population, and screening the exchange individual plants by combining with phenotypic data observed in the field, so as to initially position the candidate segment of the purple stripe character related gene of the Chinese olive between CAPS markers M15 and M16 and between the physical positions 174,751,143 and 188,371,382.
4. Development of molecular markers closely linked with fine positioning and purple stripe characteristics
Continuing to design CAPS markers between markers M15 and M16 based on the parental repeat data, broadening F2Segregating population individual population numbers (914 individuals) were further genotyped and analyzed in conjunction with phenotypic data. The result initially mapped the candidate segment of the purple stripe trait associated gene of olive within the interval of physical positions 184,002,197 to 184,365,711.
5. Development of specific CAPS markers
A plurality of CAPS markers are developed in a candidate region, and finally a CAPS690-01 marker (Table 1) is screened, wherein the specific marker is that a fragment amplified in a purple stripe parent 'bamboo filament pepper Chen 12' has a base T at the 201 th position and can be recognized and cut by TaqI enzyme; in the non-purple streak parent ` 16ZX101-M-1 `The 200 th base of the linear pepper' is G and can not be cut by TaqI enzyme. The PCR product is cut by TaqI enzyme, 192bp and 221bp fragments are obtained from purple stripe parent ' bamboo filament pepper Chen12 ', and non-purple stripe parent ' 16ZX101-M-1The linear pepper' cannot be cut by endonuclease. And the position of the SNP locus is at the 184,011,859 th position of a pepper P10 chromosome (pepper CM334 reference genome, V1.55, ftp:// ftp. solgenomics. net/genes/Capsicum _ annuum/C.annuum _ cvCM334/) and the reference genome, wherein when the base is T, the pepper olive has purple stripes, and when the base is G, the pepper olive does not have purple stripes.
TABLE 1
6. Detection of
The PCR amplification system is as follows: total 25. mu.L, 50 ng/. mu.L DNA 1.0. mu.L, 2 XTaq Master Mix 13.0. mu.L, 10. mu. mol mixed primer (i.e., forward primer + reverse primer) 1.0. mu.L, ddH2And the balance of O.
The PCR amplification procedure was: pre-denaturation at 94 deg.C for 1min30s, denaturation at 94 deg.C for 20s, annealing at 56 deg.C for 20s, extension at 72 deg.C for 30s, and 35 cycles, extension at 72 deg.C for 5min, and storage at 16 deg.C for 10 min.
The CAPS enzyme cutting system is as follows: total 10. mu.L, PCR reaction product 5.0. mu.L, 2 XTaqIbuffer 1.0. mu.L, TaqI0.2. mu.L, ddH2The balance of O; enzyme digestion is carried out for 1.5h at 65 ℃, and the product is preserved for 10min at 16 ℃.
The PCR amplification product was electrophoresed on a 1% agarose gel. Because the resolution of the agarose gel is limited, 192bp and 221bp can not be completedCompletely separated, the purple stripe parent ' bamboo filament pepper Chen12 ' can be observed to detect a band with the size of about 200bp, while the non-purple stripe parent ' 16ZX101-M-1If the pepper was not cut by the endonuclease, a 392bp band was detected, as shown in FIG. 4. CAPS marker CAPS690-01 enables identification of purple striped parents.
Example 2:
CAPS690-01 marker identified purple streak phenotype at seedling stage, the specific process is as follows:
PCR amplification of F from example 1 with CAPS690-01 primer2Obtaining PCR amplification products from purple stripe single plants and non-purple stripe single plants in the population; the PCR amplification system is as follows: total 25. mu.L, 50 ng/. mu.L DNA 1.0. mu.L, 2 XTaq Maste r Mix 13.0. mu.L, 10. mu. mol mixed primer (i.e., forward primer + reverse primer) 1.0. mu.L, ddH2The balance of O; the PCR amplification procedure was: pre-denaturation at 94 deg.C for 1min30s, denaturation at 94 deg.C for 20s, annealing at 56 deg.C for 20s, extension at 72 deg.C for 30s, and 35 cycles, extension at 72 deg.C for 5min, and storage at 16 deg.C for 10 min.
The CAPS enzyme cutting system is as follows: total 10. mu.L, PCR reaction product 5.0. mu.L, 2 XTaqIbuffer 1.0. mu.L, TaqI0.2. mu.L, ddH2The balance of O; the enzyme was cleaved at 37 ℃ for 1.5h and stored at 16 ℃ for 10 min.
The PCR amplification products were subjected to gel electrophoresis, and the results of detection of a part of the material are shown in FIG. 5 in view of space: in the figure, F is formed from left to right2Group individual plant, Marker, F2Population Individual, blank lane, F1Purple striped parent ' bamboo filament pepper Chen12 ' and non-purple striped parent ' 16ZX101-M-1And (4) a linear pepper. As can be seen from the figure, CAPS690-01 can effectively distinguish purple stripe material from non-purple stripe material, specifically: the purple stripe material can detect a band with the size of about 200bp or two bands with the sizes of 200bp and 392 bp; while the band of the non-purple striped material was 392 bp.
It should be noted that the above-mentioned embodiments are merely illustrative and not restrictive, and any modifications, equivalents, improvements and the like which come within the spirit and principle of the present invention are intended to be included within the scope of the present invention.
Sequence listing
<110> institute of economic crops of academy of agricultural sciences of Hubei province
<120> SNP closely related to purple stripes of Chinese olive of capsicum, specific CAPS primer and application
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
tggattcgtc gaactcactc aa 22
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
acgcagtgaa gggtatggtc 20
Claims (2)
1. The application of a reagent for detecting SNP sites closely related to purple stripes of the olive of capsicum in the breeding of the purple stripes of the olive of capsicum; the SNP locus is at the 184,011,859 th site of the pepper P10 chromosome, the pepper CM334 reference genome, V1.55, ftp:// ftp.
2. The use of claim 1, wherein the reagent is a primer: 5'-TGGATTCGTCGAACTCACTCAA-3' is used as a reference material; 5'-ACGCAGTGAAGGGTATGGTC-3' is added.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202210028836.7A CN114350840A (en) | 2022-01-11 | 2022-01-11 | SNP (single nucleotide polymorphism) and specific CAPS (CAPS) primers closely related to purple stripes of Chinese olive of capsicum and application of primers |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202210028836.7A CN114350840A (en) | 2022-01-11 | 2022-01-11 | SNP (single nucleotide polymorphism) and specific CAPS (CAPS) primers closely related to purple stripes of Chinese olive of capsicum and application of primers |
Publications (1)
Publication Number | Publication Date |
---|---|
CN114350840A true CN114350840A (en) | 2022-04-15 |
Family
ID=81109589
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202210028836.7A Pending CN114350840A (en) | 2022-01-11 | 2022-01-11 | SNP (single nucleotide polymorphism) and specific CAPS (CAPS) primers closely related to purple stripes of Chinese olive of capsicum and application of primers |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN114350840A (en) |
-
2022
- 2022-01-11 CN CN202210028836.7A patent/CN114350840A/en active Pending
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN108411028B (en) | Specific SNP codominant molecular marker primer in rice salt-tolerant gene SKC1 gene and application | |
EP3789506B1 (en) | Prunus mume pendulous trait snp molecular markers and use thereof | |
CN110117673B (en) | Molecular marker of brassica napus dwarf trait locus and application thereof | |
CN108486276B (en) | Pepper maturity SNP molecular marker and application thereof | |
CN108165653A (en) | For identifying the InDel molecular labelings of capsicum maturity and its application | |
CN111893209A (en) | Detection marker for insertion deletion site related to thousand grain weight of wheat and application of detection marker | |
CN110205396B (en) | SNP marker closely linked with irregular stripe character of cucumber fruit and application thereof | |
US10036029B2 (en) | Molecular markers for low palmitic acid content in sunflower (Helianthus annus), and methods of using the same | |
CN110684858A (en) | Molecular marker of rice long and thin grain type gene and application thereof | |
KR101822995B1 (en) | DNA marker for selecting Jubilee-type stripe pattern of watermelon | |
CN106086007B (en) | Molecular labeling and its application with tomato atropurpureus fruit Gene A TV close linkage | |
CN115786567B (en) | Semi-dominant corn dwarf related molecular marker and application thereof | |
CN110607391A (en) | Molecular marker closely linked with character control of Indian pumpkin red fruit peel, primer and application | |
CN116179755A (en) | Soybean grain weight major QTLqSW20-1 and Indel molecular marker developed by same and application thereof | |
CN112921112B (en) | CAPS molecular marker, detection primer and detection kit for identifying marigold petal type | |
CN114350840A (en) | SNP (single nucleotide polymorphism) and specific CAPS (CAPS) primers closely related to purple stripes of Chinese olive of capsicum and application of primers | |
CN109652582B (en) | SNP molecular marker for identifying Huyunuo No.3 waxy corn and application thereof | |
CN113278723A (en) | Composition for analyzing genetic diversity of Chinese cabbage genome segment or genetic diversity introduced in synthetic mustard and application | |
CN113005221A (en) | Molecular marker SNP-392 tightly linked with muskmelon pedicle-resistance gene CmAL3 and application thereof | |
CN111088383A (en) | Molecular marker for identifying purple genes of capsicum olivum and development method and application thereof | |
CN112980993B (en) | SNP molecular marker linked with major QTL site qPSIIB10 for resisting aspergillus flavus infection of peanuts and application thereof | |
CN112080580B (en) | SNP marker for identifying broccoli variety Zhe Qing 60 | |
CN114369674B (en) | SNP marker linked with Indian pumpkin short vine gene CmDw-1, primer, kit and application thereof | |
CN114622033B (en) | SNP (Single nucleotide polymorphism) marker linked with color traits of ripe cucumber peel and application thereof | |
CN116497148B (en) | Molecular marker associated with color of bitter gourd peel and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination |