CN115927609A - Primer probe set and kit for detecting MGMT promoter methylation by using probe dissolution curve method and application of primer probe set and kit - Google Patents
Primer probe set and kit for detecting MGMT promoter methylation by using probe dissolution curve method and application of primer probe set and kit Download PDFInfo
- Publication number
- CN115927609A CN115927609A CN202210634634.7A CN202210634634A CN115927609A CN 115927609 A CN115927609 A CN 115927609A CN 202210634634 A CN202210634634 A CN 202210634634A CN 115927609 A CN115927609 A CN 115927609A
- Authority
- CN
- China
- Prior art keywords
- mgmt
- sites
- methylation
- kit
- methylated
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of biology, and particularly relates to a primer probe set for detecting MGMT promoter methylation by using a probe dissolution curve method, a kit and application thereof. The invention utilizes a probe melting curve method, takes nucleic acid treated by bisulfite as a template, designs probes by methylating CpG sites in the coverage range of the probes, and adds degenerate basic groups into the primers to total 2 primers and 3 probes. The screened sites and MGMT expression level have high correlation degree, and an MGMT promoter methylation detection system developed by using a probe melting curve method can detect whether 8CpG sites are methylated or not only through 1-tube qPCR reaction; 1 CpG site or a plurality of sites can be detected by methylation at the same time, thus solving the technical problem that the conventional qPCR method can not realize at present.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a primer probe set for detecting MGMT promoter methylation by using a probe dissolution curve method, a kit and application thereof.
Background
Brain Glioma (GBM) is the most common malignant tumor of the central nervous system, and the incidence rate of the tumor accounts for approximately
44% of intracranial tumors are one of the important tumor types leading to death. Temozolomide (TMZ) chemotherapy is currently the first line standard treatment for GBM. Research shows that the methylation state of the MGMT gene promoter is an important detection index for predicting whether TMZ is sensitive to patients. In addition, the survival time of the patients with MGMT gene promoter methylation is obviously longer than that of the patients without methylation, and the MGMT gene silencing caused by MGMT gene promoter methylation is one of the factors for good chemotherapy effect of glioblastoma.
MGMT is called O6-methylguanine-DNA methyltransferase (O6-methylguanine-DNA methyltransferase) and is the only protein capable of removing O6 guanine complex from DNA, and can protect chromosome from damage caused by mutagenic, carcinogenic and cytotoxic effects of alkylating agent. MGMT protects cells from alkylating agents primarily by irreversibly transferring the alkylating group from O6-mG to the cysteine residue at position 145 of the MGMT protein. In this process, MGMT acts as both a methyltransferase and a methyl acceptor protein, completing the transfer reaction separately. The intracellular repair capacity of the MGMT protein depends mainly on its intracellular content and synthesis rate.
The methylation state of the MGMT gene promoter is closely related to the expression of the MGMT protein, and the promoter methylation is the most common abnormality of the MGMT gene and mostly occurs in CpG islands (total 99 CpG islands) of the MGMT gene promoter, so that the transcription of the gene is stopped, and the protein expression is reduced. By studying tumor cell lines, it was found that none of the MGMT gene promoter regions of cell lines normally expressing MGMT were methylated, whereas the MGMT gene promoter regions of cell lines with down-regulated MGMT expression levels were hypermethylated. Through detecting 239 tumor tissue samples, the coincidence rate of MGMT gene promoter region methylation and MGMT protein expression level down-regulation is found to be up to 83%, and the MGMT gene promoter methylation is proved to be the main reason of MGMT protein deficiency in cells. 99 CpG sites of MGMT promoter, not all CpG site methylation and MGMT gene expression are related, everhard et al finally find that 6CpG sites (cpGs-228, -186,95,113,135, 137) and two CpG regions (-186 to-172 and 93to 153) are closely related to MGMT gene expression, shah et al determine that 7 sites (-181, 53,89,94,100,142, 172) are related to gene mRNA expression, and Malley et al analyze 2 differential methylation regions DMR1 (cpG 25-50) and DMR2 (CpG 73-90) which are closely related to MGMT gene promoter activity and are obviously related to progression-free survival.
The detection of methylation degree of CpG island in MGMT promoter region has been achieved by transforming sample DNA with bisulfite (bisulfate) and by various molecular biological technical means, and in the prior art, the detection method of methylation of MGMT gene promoter mainly comprises the following steps: (1) pyrosequencing method (2) methylation-specific PCR (3) fluorescent PCR method (4) high-throughput sequencing method. Among the above methods, the pyrosequencing method is a "gold standard" method; methylation specificity PCR detection sites are few, and a plurality of sites can be detected only by methylation at the same time; the fluorescence PCR method has a plurality of detection sites, and can detect the methylation of a plurality of points simultaneously; in high-throughput sequencing, the problems of complex operation, poor primer amplification efficiency, high cost and the like exist at present.
Disclosure of Invention
Aiming at the problems in the prior art, the invention provides a primer probe group for detecting MGMT promoter methylation by using a probe dissolution curve method.
The invention also aims to provide a kit containing the probe primer group.
The invention also provides a method for detecting MGMT promoter methylation by using the probe primer group.
The technical scheme adopted by the invention for realizing the purpose is as follows:
the invention provides a primer probe group for detecting MGMT promoter methylation by using a probe dissolution curve method, wherein the specific sequence of the primer probe group is as follows:
the MGMT upstream primer is shown as SEQ ID NO. 1: 5 'gygttttyggatatgggatag 3';
the MGMT downstream primer is shown as SEQ ID NO. 2: 5 'caaacccraaaaaaaacitaacaa 3';
MGMT-P1 is shown as SEQ ID NO. 3: FAM-5 'GTTTAACGTCGAAACGCAAAACGTTCTAAAC 3' -BHQ1;
MGMT-P2 is shown as SEQ ID NO. 4: VIC-5 'CACTCTCTCACCAAATCGCAAACGAACGCACC 3' -BHQ1;
MGMT-P3 is shown as SEQ ID NO. 5: ROX-5 'AAGATCCCgAAAAAAAACTCCgCACTCTCT 3' -BHQ2.
Further, the MGMT-P1 covers 75, 76 and 77CpG sites; the MGMT-P2 covers 82, 83 and 84CpG sites; the MGMT-P3 covers 88 and 89CpG sites.
The invention also provides a kit containing the primer probe set, which specifically contains the following components:
in the process of carrying out PCR amplification reaction by using the kit, the specific amplification procedure is as follows:
when the kit is used for detection, whether 8CpG sites of the MGMT promoter of a sample are methylated or not is judged through the Tm value range of a peak image, and the specific judgment standard is as follows:
further, in the kit, the DNA after sulfite transformation is prepared by the following method: extracting nucleic acid DNA of normal people, then treating with a bisulfite conversion kit, extracting plasmids after conversion and carrying out first-generation sequencing identification to obtain wild type plasmids of which the 1 st-99 th methylation sites do not generate methylation bisulfite conversion; 8 groups of (75-77, 82-84 and 88-89) of bisulfite converted nucleic acid fragments which are individually methylated and 75-77, 82-84 and 88-89CpG sites which are all methylated simultaneously are respectively obtained by utilizing the site-directed mutagenesis technology to respectively construct methylated plasmids; wild-type plasmids and methylated plasmids are used as raw materials to be mixed, and templates with 10% of single sites and 8 sites simultaneously methylated are prepared respectively.
The invention also provides an application of the primer probe set in MGMT promoter methylation detection.
The method utilizes a probe melting curve method, takes nucleic acid treated by bisulfite as a template, designs probes by methylating CpG sites in the coverage range of the probes, adds degenerate basic groups in the primers, and adds 2 primers and 3 probes in total to realize that 1-tube PCR reaction detects whether 8CpG sites in a MGMT gene promoter area are methylated (any one or more sites of 8 sites can be detected), and the lowest detection limit is 10% of methylation degree.
The invention has the beneficial effects that:
(1) The screened sites and MGMT expression level have high correlation, and an MGMT promoter methylation detection system developed by using a probe melting curve method can detect whether 8CpG sites are methylated or not by only 1 tube of qPCR reaction; 1 CpG site or a plurality of sites can be detected by methylation at the same time, thus solving the technical problem that the conventional qPCR method can not realize at present.
(2) The detection method of the MGMT promoter methylation detection system provided by the invention has higher sensitivity than methylation specificity PCR and fluorescence PCR methods, and the lowest detection limit of methylation of any one or more sites of 8 sites on a qPCR detection platform is 10% of methylation degree.
Drawings
FIG. 1 is a plasmid nucleic acid melting curve showing 10% methylation at 75CpG sites; wherein: a:10 -5 /. Mu.L concentration plasmid sample nucleic acid B10 -6 /. Mu.L concentration of plasmid sample nucleic acid.
FIG. 2 is a plasmid nucleic acid melting curve showing 10% methylation at 76CpG sites; wherein: a:10 -5 Concentration of plasmid sample nucleic acid B/. Mu.L 10 -6 /. Mu.L concentration of plasmid sample nucleic acid.
FIG. 3 is a plasmid nucleic acid melting curve of degree of 10% methylation at 77CpG sites; wherein: a:10 -5 /. Mu.L concentration plasmid sample nucleic acid B10 -6 Plasmid sample nucleic acid at a concentration of/. Mu.L.
FIG. 4 is a curve of plasmid nucleic acid melting at 10% methylation at all 75-77CpG sites; wherein: a:10 -5 /. Mu.L concentration plasmid sample nucleic acid B10 -6 /. Mu.L concentration of plasmid sample nucleic acid
FIG. 5 shows a plasmid nucleic acid melting curve for 10% methylation at 82CpG sites; wherein: a:10 -5 /. Mu.L concentration plasmid sample nucleic acid B10 -6 /. Mu.L concentration of plasmid sample nucleic acid
FIG. 6 shows the melting curve of plasmid nucleic acid at 83CpG sites with 10% methylation degree; wherein: a:10 -5 Concentration of plasmid sample nucleic acid B/. Mu.L 10 -6 /. Mu.L concentration of plasmid sample nucleic acid
FIG. 7 shows a plasmid nucleic acid melting curve for the degree of 10% methylation at 84CpG sites; wherein: a:10 -5 Concentration of plasmid sample nucleic acid B/. Mu.L 10 -6 /. Mu.L concentration of plasmid sample nucleic acid
FIG. 8 shows, 82-84CpG site 10 -6 A/μ L concentration of 10%Degree of methylation plasmid sample nucleic acid melting curves.
FIG. 9 shows plasmid nucleic acid melting curves for 10% methylation at 88CpG sites; wherein: a:10 -5 /. Mu.L concentration plasmid sample nucleic acid B10 -6 /. Mu.L concentration of plasmid sample nucleic acid
FIG. 10 shows a plasmid nucleic acid melting curve for 10% methylation at 89CpG sites; wherein: a:10 -5 Concentration of plasmid sample nucleic acid B/. Mu.L 10 -6 /. Mu.L concentration of plasmid sample nucleic acid
FIG. 11 shows the plasmid nucleic acid melting curves for 10% methylation at all 88-89CpG sites; wherein: a:10 -5 /. Mu.L concentration plasmid sample nucleic acid B10 -6 /. Mu.L concentration of plasmid sample nucleic acid
FIG. 12 is a melting curve of normal human samples after bisulfite conversion of nucleic acids.
FIG. 13 is a graph of bisulfite converted melting of nucleic acid from a methylated tumor sample.
Detailed Description
The invention is further described below by means of specific examples, which do not limit the scope of the patent protection of the invention in any way.
Example 1
1. Sequence analysis
(1) The gene sequence of MGMT promoter was downloaded from NCBI, and the sequences between chromosome 10 131264922-131265730 were selected, for a total of 99 CpG sites (markers), as follows:
(2) No methylation occurred after bisulfite treatment of 99 CpG sites (markers) in the gene sequence of MGMT promoter, the sequence is as follows
(3) The gene sequence of the MGMT promoter is methylated after bisulfite treatment at 99 CpG sites (markers), and the sequence is as follows:
2. design of primer probes
(1) Design of primer-probe: designing primers by using Primer Premier5 software, wherein the length of the primers is 17-30nt, the Tm value is 56-62 ℃, and the amplified length is not more than 350bp; designing detection probes by using Primer Premier5 software, wherein the CpG sites in a coverage area are completely methylated as templates, the total number of the probes is 3, the first probe P1 covers 75, 76 and 77CpG sites, the second probe P2 covers 82, 83 and 84CpG sites, the third probe P3 covers 88 and 89CpG sites, and the Tm value is 65-72 ℃;
the sequence is as follows:
MGMT upstream primer: 5 'GYGTTTYGGATATGTTGGGATAG 3'
MGMT downstream primer: 5 'CAAACCCRAAAAAAAAACTAAACAA 3'
MGMT-P1：FAM-5' GTTTAACGTCGAAACGCAAAACGTTCTAAAAAC 3'-BHQ1
MGMT-P2：VIC-5' CACTCTCACCAAATCGCAAACGATACGCACC 3'-BHQ1
MGMT-P3：ROX-5' AAGATCCCgAAAAAAAACTCCgCACTCTT 3'-BHQ2
3. Preparation of test samples
(1) Plasmid sample
Extracting nucleic acid DNA of normal population, then treating with bisulfite conversion kit (commercially available), then carrying out clone amplification by cloning primer, finally converting and extracting plasmid and carrying out first-generation sequencing identification to obtain wild type plasmid with methylation sites of 1 st to 99 th. 8 groups of bisulfite conversion nucleic acid fragments with single site methylation (75-77, 82-84 and 88-89) and nucleic acid fragments with simultaneous methylation of 75-77, 82-84 and 88-89CpG sites are respectively obtained by utilizing site-directed mutagenesis technology to respectively construct methylated plasmids. Wild type plasmids and methylated plasmids are used as raw materials, 10 ng/. Mu.L of plasmids are respectively mixed, and 10% of templates with single sites and 8 sites simultaneously methylated are respectively prepared.
(1) Tumor sample
Tumor samples with MGMT promoters methylated and 1 mu g of non-methylated normal human sample nucleic acid are selected to be subjected to bisulfite conversion treatment, and the treated nucleic acid is used as a detection template.
4. Detection system and program
(1) The specific detection system is shown in table 1.
TABLE 1
(2) Detection procedure-the instrument used was Roche LC480
Specifically, as shown in table 2.
TABLE 2
10 percent of template plasmid samples and clinical samples with single sites and 8 sites methylated simultaneously are respectively set in the experimental process, and 10 percent of plasmid samples are respectively taken -5 ng/μL、10 -6 ng/. Mu.L (plasmid stock solution 10 ng/. Mu.L) and nucleic acid 5. Mu.L each were tested, and 5 ng/. Mu.L of nucleic acid after sulfite conversion was selected for clinical testing.
And (4) result analysis: the results are shown in FIG. 1, the melting curve of methylation at 75CpG sites, which indicates that the ontology system is 10 -5 -10 -6 Double peaks can be normally detected in plasmid sample nucleic acid methylated at the concentration of 10 percent ng/microliter, wherein the Tm value of a wild type peak is 49.7 ℃, and the Tm value of a methylation peak is 54.1 ℃. FIG. 2 shows a melting curve for methylation at the 76CpG site, indicating that the ontology system is 10 -5 -10 -6 Double peaks were normally detected in the plasmid sample nucleic acid methylated to the extent of 10% ng/. Mu.L concentration, with a Tm of the wild type peak of 49.7 ℃ and a Tm of the methylation peak of 53.9 ℃. FIG. 3 shows a melting curve for methylation at 77CpG sites, indicating that the ontology is at 10 -5 -10 - 6 Double peaks can be normally detected in plasmid sample nucleic acid with the concentration of 10 percent ng/microliter methylated, and the Tm value of a wild type peak is 497 ℃ and a methylation peak Tm of 53.8 ℃. FIG. 4 shows the melting curve for homomethylation at 75-77CpG sites, indicating that the ontology is 10 -5 -10 -6 Double peaks were normally detected in the plasmid sample nucleic acid methylated at a concentration of 10% ng/. Mu.L, with a Tm of the wild type peak of 49.7 ℃ and a Tm of the methylation peak of 69.2 ℃. FIG. 5 shows a melting curve for methylation at 82CpG sites, indicating that the ontology is 10 -5 -10 -6 Double peaks were normally detected in the plasmid sample nucleic acid methylated at a concentration of 10% ng/. Mu.L, with a Tm of 49.8 ℃ for the wild type peak and 55.1 ℃ for the methylation peak. FIG. 6 shows a melting curve for methylation at 83CpG sites, indicating that the ontology is 10 -5 -10 - 6 Double peaks can be normally detected in plasmid sample nucleic acid methylated at the concentration of 10 percent ng/microliter, wherein the Tm value of a wild type peak is 49.8 ℃, and the Tm value of a methylation peak is 55.0 ℃. FIG. 7 shows a methylation melting curve at 84CpG sites, indicating that the ontology is 10 -5 -10 - 6 Double peaks can be normally detected in plasmid sample nucleic acid methylated at the concentration of 10 percent ng/microliter, wherein the Tm value of a wild type peak is 49.8 ℃, and the Tm value of a methylation peak is 55.8 ℃. FIG. 8 shows a melting curve for methylation at the 82-84CpG sites, indicating that the germline at 10 - 6 Double peaks were normally detected in the plasmid sample nucleic acid methylated at a concentration of 10% ng/. Mu.L, with a Tm of the wild type peak of 49.8 ℃ and a Tm of the methylation peak of 69.2 ℃. FIG. 9 shows the melting curve of 88CpG sites, indicating that the ontology system is 10 -5 -10 -6 Double peaks were normally detected in the plasmid sample nucleic acid methylated at a concentration of 10% ng/. Mu.L, with a Tm of the wild type peak of 56.4 ℃ and a Tm of the methylation peak of 60.3 ℃. FIG. 10 shows a melting curve at 89CpG sites, indicating that the germline at 10 -5 -10 -6 ng/. Mu.L of plasmid sample nucleic acid methylated to a degree of 10% at a concentration of 10% -5 The plasmid with the concentration of/. Mu.L can normally detect double peaks, wherein the Tm value of a wild type peak is 56.4 ℃, and the Tm value of a methylation peak is 60.7 ℃;10 -6 The methylation peak was not evident in the plasmid at/. Mu.L. FIG. 11 shows melting curves for methylation at 88-89CpG sites, indicating that the ontology system is 10 -5 -10 -6 Double peaks can be normally detected in plasmid sample nucleic acid with the concentration of 10 percent of ng/microliter methylated, the Tm value of a wild peak is 56.4 ℃, and methylation is carried out at the temperature ofThe peak Tm value was 63.5 ℃. FIG. 12 shows the melting curve of normal human sample nucleic acid after bisulfite conversion, which indicates that the ontology system normally detects a single peak in each probe channel at 5 ng/. Mu.L concentration of nucleic acid after bisulfite conversion, and the Tm values of the wild-type peaks of the FAM channel are 49.7 ℃, the Tm values of the wild-type peaks of the VIC channel are 49.5 ℃ and the Tm values of the wild-type peaks of the ROX channel are 56.4 ℃. FIG. 13 shows the melting curve after bisulfite conversion of nucleic acids from methylated tumor samples, indicating that the ontology detects two peaks in FAM and VIC channels and only wild-type peaks in ROX channels at 5 ng/. Mu.L concentration of nucleic acids after bisulfite conversion. The Tm value of a wild type peak of the FAM channel is 49.7 ℃, and the Tm value of a methylation peak of the FAM channel is 55.4 ℃; the Tm value of a wild type peak of the VIC channel is 49.5 ℃, and the Tm value of a methylation type peak of the VIC channel is 55.8 ℃; the wild type peak Tm of the ROX channel was 56.4 ℃ and no site was methylated.
And (4) conclusion: according to the method of the present invention, 25ng of genomic DNA after sulfite conversion can be detected, and whether or not the 8CpG sites of the MGMT promoter in the sample are methylated can be judged by the Tm value range of the peak map, and the interpretation thereof is as follows:
TABLE 3
Sequence listing
<110> Yinfeng Gene science and technology Co., ltd, yinfeng bioengineering group Co., ltd
<120> primer probe group and kit for detecting MGMT promoter methylation by using probe dissolution curve method and application thereof
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 23
<212> DNA
<213> Artificial sequence (artiartiartifical sequence)
<400> 1
GYGTT TYGGA TATGT TGGGA TAG 23
<210> 2
<211> 24
<212> DNA
<213> Artificial sequence (artiartiartifical sequence)
<400> 2
CAAAC CCRAA AAAAA ACTAA ACAA 24
<210> 3
<211> 33
<212> DNA
<213> Artificial sequence (artiartiartifical sequence)
<400> 3
GTTTA ACGTC GAAAC GCAAA ACGTT CTAAA AAC 33
<210> 4
<211> 31
<212> DNA
<213> Artificial sequence (artiartiartifical sequence)
<400> 4
CACTC TCACC AAATC GCAAA CGATA CGCAC C 31
<210> 5
<211> 29
<212> DNA
<213> Artificial sequence (artiartiartifical sequence)
<400> 5
AAGAT CCCgA AAAAA AACTC CgCAC TCTT 29
Claims (7)
1. A primer probe group for detecting MGMT promoter methylation by using a probe dissolution curve method is characterized by comprising the following specific sequences:
MGMT upstream primer: 5 'gygttttyggatatgggatag 3';
MGMT downstream primer: 5 'caaacccraaaaaaaacitaacaa 3';
MGMT-P1：FAM-5' GTTTAACGTCGAAACGCAAAACGTTCTAAAAAC 3'-BHQ1；
MGMT-P2：VIC-5' CACTCTCACCAAATCGCAAACGATACGCACC 3'-BHQ1；
MGMT-P3：ROX-5' AAGATCCCgAAAAAAAACTCCgCACTCTT 3'-BHQ2。
2. the primer probe set of claim 1, wherein the MGMT-P1 covers three CpG sites 75, 76, 77; the MGMT-P2 covers 82, 83 and 84CpG sites; the MGMT-P3 covers 88 and 89CpG sites.
3. A kit comprising the primer probe set of claim 1 or 2, wherein the kit specifically comprises the following components:
4. the kit according to claim 3, wherein during the PCR amplification reaction using the kit, the specific amplification procedure is as follows:
5. the kit according to claim 3 or 4, wherein when the kit is used for detection, whether the 8CpG sites of the MGMT promoter in the sample are methylated or not is judged according to the Tm value range of the peak map, and the specific judgment criteria are as follows:
6. the kit according to any one of claims 3to 5, wherein the DNA after sulfite conversion is prepared by: extracting nucleic acid DNA of normal people, then treating with a bisulfite conversion kit, extracting plasmids after conversion and carrying out first-generation sequencing identification to obtain wild type plasmids of which the 1 st-99 th methylation sites do not generate methylation bisulfite conversion; 8 groups of (75-77, 82-84 and 88-89) of bisulfite converted nucleic acid fragments which are individually methylated and 75-77, 82-84 and 88-89CpG sites which are all methylated simultaneously are respectively obtained by utilizing the site-directed mutagenesis technology to respectively construct methylated plasmids; wild-type plasmid and methylated plasmid are used as raw materials to be mixed, and templates with 10% of single site and 8 sites simultaneously methylated are prepared respectively.
7. Use of a primer probe set according to claim 1 or 2 for performing detection of methylation of an MGMT promoter.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210634634.7A CN115927609A (en) | 2022-06-07 | 2022-06-07 | Primer probe set and kit for detecting MGMT promoter methylation by using probe dissolution curve method and application of primer probe set and kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210634634.7A CN115927609A (en) | 2022-06-07 | 2022-06-07 | Primer probe set and kit for detecting MGMT promoter methylation by using probe dissolution curve method and application of primer probe set and kit |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115927609A true CN115927609A (en) | 2023-04-07 |
Family
ID=86556419
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210634634.7A Pending CN115927609A (en) | 2022-06-07 | 2022-06-07 | Primer probe set and kit for detecting MGMT promoter methylation by using probe dissolution curve method and application of primer probe set and kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115927609A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104726561A (en) * | 2015-02-12 | 2015-06-24 | 福州艾迪康医学检验所有限公司 | Reagent and method for detecting MGMT gene promoter methylation |
| CN111440852A (en) * | 2019-11-20 | 2020-07-24 | 北京爱普拜生物技术有限公司 | Kit and method for detecting methylation sites of DMR2 region of MGMT gene promoter through multiple probes |
| CN113278693A (en) * | 2020-07-29 | 2021-08-20 | 上海吉凯医学检验所有限公司 | DNA methylation marker for early colorectal cancer and adenoma, method for detecting same and application thereof |
-
2022
- 2022-06-07 CN CN202210634634.7A patent/CN115927609A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104726561A (en) * | 2015-02-12 | 2015-06-24 | 福州艾迪康医学检验所有限公司 | Reagent and method for detecting MGMT gene promoter methylation |
| CN111440852A (en) * | 2019-11-20 | 2020-07-24 | 北京爱普拜生物技术有限公司 | Kit and method for detecting methylation sites of DMR2 region of MGMT gene promoter through multiple probes |
| CN113278693A (en) * | 2020-07-29 | 2021-08-20 | 上海吉凯医学检验所有限公司 | DNA methylation marker for early colorectal cancer and adenoma, method for detecting same and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| ERIC SMITH等: "Quantitation of DNA methylation by melt curve analysis", 《BMC CANCER》, pages 1 - 12 * |
| 卫旭宇: "MS-HRM 方法建立及其在结直肠癌相关基因启动子甲基化研究中的初步应用", 中国优秀博硕士学位论文全文数据库(硕士) 医药卫生科技辑, pages 6 - 28 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108410980B (en) | Method and kit for screening target region for methylation PCR detection and application | |
| US11180812B2 (en) | Use of DNA in circulating exosomes as a diagnostic marker for metastatic disease | |
| CN105779587B (en) | Probe, primer and kit for detecting 7 mutations of human NRAS gene | |
| CN112538528A (en) | Primer group and kit for detecting ALDH2 gene polymorphism | |
| CN104328164A (en) | Kit for detecting human EGFR gene mutation by using fluorescence probe hybridization method | |
| CN102776286B (en) | Primer, probe and assay kit for detecting v-ros avian UR2 sarcoma viral oncogene homolog 1 (ROS1) gene fusion mutation | |
| CN111020031A (en) | Method for detecting tumor gene mutation by combining sequence specific blocker with specific PCR (polymerase chain reaction) program | |
| CN106947805A (en) | Fluorescence PCR method, kit and the system of septin9 gene methylations in human peripheral dissociative DNA are detected based on ARMS PCR methods | |
| CN112639124A (en) | Analytical method and kit | |
| CN109837341A (en) | A kind of detection method and its primer sets of mgmt gene promoter methylation | |
| CN108728538B (en) | ALK gene fusion detection primer, method and kit | |
| CN108531598B (en) | ROS1 gene fusion detection primer, method and kit | |
| TWI385252B (en) | Cancer screening method | |
| CN115927609A (en) | Primer probe set and kit for detecting MGMT promoter methylation by using probe dissolution curve method and application of primer probe set and kit | |
| CN112143815B (en) | Nucleic acid composition, kit and detection method for detecting fusion mutation of human FGFR2 gene | |
| CN113999901B (en) | Myocardial specific methylation markers | |
| CN109355362B (en) | High-sensitivity SNPs detection system and application | |
| CN112522407A (en) | Ultra-sensitive detection method for methylation detection of plasma free DNA (deoxyribonucleic acid) genes | |
| US20080118927A1 (en) | Method and kit for detection of microsatellite instability-positive cell | |
| CN113215228A (en) | Fragile X syndrome FMR1 gene detection primer, kit and application thereof | |
| CN107312833B (en) | LSP primer and kit for detecting human BRCA1 gene mutation | |
| CN110714097A (en) | Method for simultaneously detecting A, B, C three groups of rotaviruses | |
| WO2017118230A1 (en) | Mirna marker for diagnosing osteosarcoma | |
| CN108866160A (en) | A kind of method of HRM identification animal gene insertion and deletion loci gene type | |
| CN116555432B (en) | Rapid detection kit for bladder cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |