CN102776286B - Primer, probe and assay kit for detecting v-ros avian UR2 sarcoma viral oncogene homolog 1 (ROS1) gene fusion mutation - Google Patents
Primer, probe and assay kit for detecting v-ros avian UR2 sarcoma viral oncogene homolog 1 (ROS1) gene fusion mutation Download PDFInfo
- Publication number
- CN102776286B CN102776286B CN201210249654.9A CN201210249654A CN102776286B CN 102776286 B CN102776286 B CN 102776286B CN 201210249654 A CN201210249654 A CN 201210249654A CN 102776286 B CN102776286 B CN 102776286B
- Authority
- CN
- China
- Prior art keywords
- detection
- ros1
- primer
- rna
- probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Abstract
The invention discloses a primer, a probe and an assay kit for detecting v-ros avian UR2 sarcoma viral oncogene homolog 1 (ROS1) gene fusion mutation, wherein the primer and the probe comprises the following sequences of SEQ ID NO 1 to SEQ ID NO 8. A specific primer and probe technique is adopted, and can specifically detect the human ROS1 gene fusion mutation. The method has the advantages that (1) a real-time fluorescent polymerase chain reaction (PCR) system is built to simultaneously detect four types of ROS1 gene fusion mutation; (2) the sensitivity is high, the mutation of 10-20kb can be detected; (3) the method is simple to operate and low in detection, and has a wide clinical application scope; (4) the sample detection scope is wide, and the sample can be fresh pathological tissues and paraffine-embedded tissues; and (5) the detection speed is fast, and the detection process can be completed within 90 minutes.
Description
Technical field
The present invention relates to biological technical field, relate to particularly a kind of primer, probe and detection kit for detection of the sudden change of ROS1 gene fusion.
Background technology
Lung cancer is modal malignant tumour in world wide, and M & M occupies first of each cancer.The annual whole world has the patient over 1,300,000 to die from lung cancer.At China's lung cancer mortality, be 30.83/10 ten thousand, lung cancer has become the primary malignant tumour of China's M & M.（Orras JM,Fernandez E,Gonzalez JR,et al.Lung cancer mortality in European regions(1955-1997).Ann Oncol,2003,14(1):159）。
5 years survival rates at developed country's patients with lung cancer can reach 20% left and right, and 5 years survival rates of China's patients with lung cancer are only 13%, its major cause is that most of lung cancer is owing to lacking high-sensitive detection in Gene Mutation and making a definite diagnosis technology, thereby make patient cannot accept in time the treatment plan of science, and then make patient miss the best moment for the treatment of.
Chemotherapy is still lung cancer primary treatment means at present, yet most chemotherapy can produce larger toxic side effect, and the chemotherapy effect between different patients also has larger difference.Along with the development of tumour molecular diagnostic techniques, the molecular targeted therapy of lung cancer because of its toxic side effect low, specificity is high, day by day becomes the first-selected therapeutic modality of clinician.The patients with lung cancer that is found to be of new fusion gene ROS1 provides new treatment target spot.ROS1 is a kind of receptor type tyrosine kinase (Receptor Tyrosine Kinase) of Insulin Receptor Family; first ROS 1 fusion is found in glioblastoma, and it merges sudden change and betides karyomit(e) q22 district (Birchmeier et al.Proc Natl Acad Sci.87 (12): 1990 No. 6; Charest et al.Genes Chromosomes Cancer.37:58,2003).ROS1 fusion comprises a complete Tyrosylprotein kinase region, and it merges sudden change can cause the activation of cell downstream signal path, thereby affects the growth of cell, propagation and differentiation.Up-to-date research shows that ROS1 is that a kind of new tumour drives mutator gene, and its fusion is decided to be a kind of new molecular isoform in nonsmall-cell lung cancer.
Clinical studies show small molecules targeted drug Crizotinib(Crizotinib, Pfizer) can in ROS1 gene fusion, suddenly change by specific action, by suppressing the activity in ROS1 Tyrosylprotein kinase region, block its downstream abnormal signal path, thus the growth of inhibition tumor cell.Therefore, detecting ROS1 fusion mutation status is the prerequisite that instructs targeted drug Crizotinib medication, before chemotherapy, by high-sensitive detection method, detect the sudden change of ROS1 fusion gene for the survival rate that improves patients with lung cancer, extend lifetime, avoid excessive chemotherapy, improve life quality important in inhibiting.
The detection method that at present, can detect clinically fusion gene sudden change is mainly real time fluorescent PCR method and direct sequencing.Yet the sensitivity of direct Sequencing is low, detection sensitivity only has 20-30%; Detect complicated operation, efficiency is low, conventionally wants 1-2 talent can go out detected result.Thereby direct sequencing cannot meet the demand of clinical detection reality, clinical in developing a kind of rapid fusion gene tester, to realize, adopt detection method fast to detect merging sudden change simultaneously.
At present, also there is no detection method and the detection kit of ROS1 fusion gene sudden change, the present invention develops a kind of ROS1 fusion gene mutation detection kit and detection method quick, easy and simple to handle first.This detection method can once detect 4 kinds of fusion sudden changes that ROS1 gene produces simultaneously, and detection sensitivity is high, only needs detection time within 90 minutes, can complete, possessed highly sensitive simultaneously, fast cheap, simple operation and other advantages, can meet the actual demand of clinical rapid detection.
Summary of the invention
The object of the present invention is to provide and a kind ofly for ROS1 gene fusion sudden change, detect primer and probe, or have identity nucleotide sequence with it, this detection kit comprises following primer and probe sequence:
Table 1.ROS1 merges mutant primer and probe nucleotide sequence
SL-RO-M1-F1 GGAGATTGATTTTACTTCTCGGATTTCTCTAC SEQ ID NO：1
SR-M1 SL-RO-M1-R1 CCCTTCTAGTAATTTGGGAATGCCTGG SEQ ID NO：2
SR-M2 SL-RO-M2-R1 CCAACTATAATAGTAAGTATGAAACTTGTTTCTGGTATCC SEQ ID NO：3
SL-RO-M1-P1 5-FAM-CTCCAACCAGCTGGAAGGCGCTAC-3-BHQ1 SEQ ID NO：4
CD-RO-M1-F2 GAAATGAGCAGGCACTCCTTGGAG SEQ ID NO：5
CR-M1CD-RO-M1-R1 CCCTTCTAGTAATTTGGGAATGCCTGG SEQ ID NO：6
CR-M2CD-RO-M2-R1 CCAACTATAATAGTAAGTATGAAACTTGTTTCTGGTATCC SEQ ID NO：7
CD-RO-M1-P1 5-FAM-CCCACTGACGCTCCACCGAAAG-3-BHQ1 SEQ ID NO：8
" identity nucleotide sequence " described herein is illustrated in the oligonucleotide of (under maximum stringency condition) and target hybridization under stringent condition, and have that suitable Nucleotide inserts or deletion condition under while contrasting, at the Nucleotide at least about 60% of Nucleotide, be same as above-mentioned nucleotide fragments.More preferably, for thering is the Nucleotide of 80% identity, best, for thering is the Nucleotide of 90% identity.
Hybridization conditions is divided according to the stringency degree of when hybridization condition used, stringency degree can nucleic acid in conjunction with mixture or probe melting temperature(Tm) (Tm) be foundation.For example, " maximum stringency " is Tm-5 ℃ (lower than 5 ℃ of probe Tm); " high stringency " occurs in the following about 5-10 ℃ of Tm; " medium stringency " occurs in the following about 10-20 ℃ of Tm; Low stringency occurs in the following about 20-25 ℃ of Tm.
In the present invention, " identity " refer to, when two kinds or above sequence or subsequence compare, identical or have identical Nucleotide or an amino-acid residue of particular percentile.For determining that the algorithm of sequence identity and sequence similarity percentage ratio is according to BLAST or BLAST2.0 algorithm, they are open in Publication about Document respectively: (1990) J.Mol.Biol.215:403-410. such as (1977) Nucl.Acid.res.25:3389-3402 such as Altschul and Altschul
It is a kind of for detection of ROS1 gene fusion mutation detection kit that the present invention provides on the other hand, and its PCR reaction amplification system is as follows:
The present invention provides a kind of method for mRNA reverse transcription cDNA on the other hand, and method comprises reverse transcription composing system and following operation steps: mRNA reverse transcription cDNA system comprises following composition:
(a) get reverse transcription reaction mixed solution 18 μ l, M-MLV reversed transcriptive enzyme 1 μ l, adds in aseptic centrifuge tube, mixes.
(b) add testing sample RNA 6 μ l, RNA total amount within the scope of 0.1 ~ 5 μ g, moisturizing to 25 μ l.
(c) 42 ℃ are incubated 1 hour.
(d) 95 ℃ insulation 5 minutes after cooled on ice, obtain cDNA template..
It is a kind of for detection of ROS1 gene fusion mutation method that further aspect of the present invention provides, and its method comprises the following steps:
(1) mankind ROS1 announcing according to COSMIC data is wild type gene sequence, for 4 kinds of ROS1 genes, merges sudden change, designs special primer and probe.
(2) extract the RNA that detects sample, detect sample and comprise fresh pathological tissue and paraffin-embedded tissue.
(3) preparation real-time fluorescence PCR amplification reaction system.
(4) the Ct value judgement detected result showing according to fluorescent PCR amplification instrument: the FAM of detection reaction system and HEX fluorescence intensity, when the FAM of usining reaches the threshold value of setting, needed cycle index Ct value is as yin and yang attribute criterion, and Ct value is more than or equal to 30: feminine gender; Ct value is less than 30: the positive.
The invention has the beneficial effects as follows: the present invention has adopted special primer and probe technique, can the sudden change of specific detection mankind ROS1 gene fusion.This method: (1) has set up real-time fluorescence PCR system, can detect 4 kinds of ROS1 genes simultaneously and merge sudden change; (2) highly sensitive, the sudden change of 10-20 copy can detect; (3) simple to operate, detect cheapness, clinical application range is wide; (4) pattern detection scope is wide, and sample can be fresh pathological tissue, paraffin-embedded tissue; (5) detection speed is fast, and testing process only needs to complete for 90 minutes.
Accompanying drawing explanation
Fig. 1 is that the present invention detects plasmid PCR figure.
Fig. 2 is sensitivity analysis test-results PCR figure.
Fig. 3 is positive PCR figure for detection clinical sample suddenlys change.
Fig. 4 is for detecting clinical sample wild-type PCR figure.
Embodiment
It is template that the mutant plasmid that genetically engineered builds is take in the present invention, build ROS1 real-time fluorescence PCR amplification reaction system, take FAM as jump signal sense channel, for ROS1, merge 4 sites design specific probes of sudden change and primer, the optimization by primer and detection system realizes highly sensitive specific detection.The method that detects the sudden change of R0S1 gene fusion comprises the following steps:
(1) for mutational site design synthetic primer and probe:
The mankind ROS1 gene order of announcing according to COSMIC database is wild-type sequence, merges sudden change design Auele Specific Primer and probe for 4 kinds of ROS1 genes.By Auele Specific Primer and probe system optimization, realize highly sensitive and specific detection, 4 of R0S1 genes merge mutational site in Table 2.
For 4 selected fusion mutational sites, application Premier 6.0 primer-design softwares design multipair special primer and many probes, and primer and probe sequence are as shown in table 1.
Table 2.ROS1 gene fusion detection site
(2) extraction of sample process and RNA:
The extraction of sample preparation and RNA: the sample scope of application comprises fresh tumor tissues and paraffin-embedded tissue.Fresh pathological tissue, gets 1 gram of left and right, uses the RNA extraction test kit of TIANGEN to extract its RNA.Paraffin-embedded tissue, is used the RNA extraction test kit of organizing of Qiagen to extract its RNA.Above-mentioned concrete operation step is pressed the operation of test kit specification sheets.
(3) set up pcr amplification reaction system:
By put on and state RNA and be dissolved in 0.1%DEPC water, through UV spectrophotometer measuring, extract quality, determine that its concentration OD260/OD280 is 1.9-2.1, and read its content.Get the RNA of 0.1 ~ 5 μ g as the synthetic template of its cDNA, adopt the synthetic cDNA of test kit of Xiamen Amoydx Bio-Pharmaceutical Technology Co., Ltd., synthetic cDNA system is as follows:
Apply above-mentioned reverse transcription system and carry out as follows reverse transcription:
(a) get reverse transcription reaction mixed solution 18 μ l, M-MLV reversed transcriptive enzyme 1 μ l, adds in aseptic centrifuge tube, mixes.
(b) add testing sample RNA 6 μ l, RNA total amount within the scope of 0.1 ~ 5 μ g, moisturizing to 25 μ l.
(c) 42 ℃ are incubated 1 hour.
(d) 95 ℃ insulation 5 minutes after cooled on ice, obtain cDNA template..
By above-mentioned gained cDNA template, as the template of real-time fluorescence PCR amplification, according to following amplification system, carry out pcr amplification:
Real-time PCR reactions condition is 95 ℃ of denaturations 5 minutes, 1 circulation; 95 ℃ of sex change 25 seconds, 64 ℃ of annealing 20 seconds, 72 ℃ are extended 20 seconds, 15 circulations; 93 ℃ of sex change 25 seconds, 60 ℃ of annealing 35 seconds, 72 ℃ are extended 20 seconds, 31 circulations.Latter 31 circulate in when annealing and detect FAM and HEX or ROX fluorescent signal.
(4) detect fluorescent signal, the standard as a result of judging according to Ct value:
Detect FAM fluorescent signal Ct value, the Ct value judged result showing according to fluorescent PCR amplification instrument: the FAM fluorescence intensity of detection reaction system, when the FAM of usining reaches the threshold value of setting, needed cycle index Ct value is as yin and yang attribute criterion, and Ct value is more than or equal to 30: feminine gender; Ct value is less than 30: the positive.
Below in conjunction with specific embodiment, the present invention is further set forth.Should be understood that these embodiment are only not used in and limit the scope of the invention for the present invention.Unless otherwise defined or described herein, the scientific and technical term described in this patent is understood and is had identical implication with those of ordinary skills.
Embodiment 1
Use system detection plasmid of the present invention, plasmid template for experiment (merging containing ROS1), utilizes the method for above-mentioned fluorescent PCR detection R0S1 gene fusion sudden change as follows:
(1) plasmid is processed and is extracted:
The extraction of plasmid adopts TIANGEN(HighPure Plasmid Kit, DP116) plasmid extraction kit extract, specifically extract operation steps and operate by test kit specification sheets.The DNA that carries is dissolved in (10mmol/L, PH8.0) in Tris-HCl, through UV spectrophotometer measuring, extracts quality, determine its concentration, then use Tris-HCl(10mmol/L, PH 8.0) solution adjust DNA concentration to 2ng/ μ L as pcr template, get 5 μ L and carry out PCR reaction amplification.
(2) set up pcr amplification reaction system:
By above-mentioned gained cDNA template, as the template of real-time fluorescence PCR amplification, according to following amplification system, carry out pcr amplification
Real-time PCR reactions condition is 95 ℃ of denaturations 5 minutes, 1 circulation; 95 ℃ of sex change 25 seconds, 64 ℃ of annealing 20 seconds, 72 ℃ are extended 20 seconds, 15 circulations; 93 ℃ of sex change 25 seconds, 60 ℃ of annealing 35 seconds, 72 ℃ are extended 20 seconds, 31 circulations.Latter 31 circulate in when annealing and detect FAM and HEX or ROX fluorescent signal.
(4) detect fluorescent signal, the standard as a result of judging according to Ct value:
Adopt MX3000P real-time fluorescence PCR instrument to increase, detect the fluorescent signal of FAM and HEX in rear 31 cycle annealing stages, when the FAM of usining reaches the threshold value of setting, needed cycle index Ct value is as yin and yang attribute criterion, and Ct value is more than or equal to 30: feminine gender; Ct value is less than 30: the positive
Sensitivity analysis: after learning from else's experience quantitatively, concentration is the sample DNA of 1000 copies, carries out 10 times of dilutions, then respectively 3 concentration is detected, and every secondary response adds 5 μ L DNA.Result shows the highly sensitive of fluorescence PCR method of the present invention, and 10 copy DNA genomes can detect, and result is as Fig. 2.
Replica test: each reaction adds respectively mutant plasmid DNA1000 copy, 100 copies, repeats to carry out fluorescent PCR amplification 10 times, and 10 times Ct value differs less than 0.5 circulation.
Detected result shows, detection system of the present invention can accurately detect plasmid and detect R0S1 and merge sudden change, and the sensitivity of detection can reach 5-10 copy.
Use the present invention to detect clinical lung cancer paraffin-embedded tissue sample, the direct sequencing of learning from else's experience detects definite ROS1 and merges positive 4 example and 11 routine ROS1 wild-type samples, and the R0S1 fusion gene that utilizes special primer of the present invention and fluorescence probe PCR system the to detect 15 routine clinical samples step of suddenling change is as follows:
(1) extraction of sample process and RNA:
(a) get above-mentioned each lung cancer sample, add respectively 1ml dimethylbenzene, mix, the centrifugal 2min of 14000RPM under room temperature, abandon supernatant liquor, add 1ml dehydrated alcohol in precipitation, concussion mixes (removal dimethylbenzene), under room temperature, the centrifugal 2min of 14000RPM abandons supernatant liquor, opens centrifuge tube lid, and 37 ℃ are dried;
(b) in centrifuge tube, add 150 μ l Buffer PKD and 10 μ l Proteinase Ks, concussion mixes, hatch 15min for 56 ℃, hatch 15min for 80 ℃, after dropping to room temperature, add 16ul DNase Booster Buffer and 10ul DNaseI stoste, incubated at room 15min, after add 320 μ l Buffer RBC, mix;
(c) toward supernatant liquor, add 720 μ l dehydrated alcohols, mix, get 700 μ l samples and comprise that the precipitation generating transfers in the RNA MinElute centrifugal column with 2ml collection tube above, be greater than 10, the centrifugal 15s of 000rpm, abandon waste liquid, repeat previous step until sample is transferred in RNA MinElute centrifugal column.
(d) uncap adds 500 μ l Buffer RPE, covers tightly lid, is greater than the centrifugal 2min of 10000rpm, and posts transfer, in collection tube, is dripped to 14-30 μ l RNase-free water to adsorption film middle part, after centrifugal 1min, collects RNA.
(2) set up pcr amplification reaction system:
By put on and state RNA and be dissolved in 0.1%DEPC water, through UV spectrophotometer measuring, extract quality, determine that its concentration OD260/OD280 is 1.9-2.1, and read its content.Get the RNA of 0.1 ~ 5 μ g as the synthetic template of its cDNA, adopt the synthetic cDNA of test kit of Xiamen Amoydx Bio-Pharmaceutical Technology Co., Ltd., cDNA synthetic system is as follows:
Apply above-mentioned reverse transcription system and carry out as follows reverse transcription:
(a) get reverse transcription reaction mixed solution 18 μ l, M-MLV reversed transcriptive enzyme 1 μ l, adds in aseptic centrifuge tube, mixes.
(b) add testing sample RNA 6 μ l, RNA total amount within the scope of 0.1 ~ 5 μ g, moisturizing to 25 μ l.
(c) 42 ℃ are incubated 1 hour.
(d) 95 ℃ insulation 5 minutes after cooled on ice, obtain cDNA template..
By above-mentioned gained cDNA template, as the template of real-time fluorescence PCR amplification, according to following amplification system, carry out pcr amplification:
Real-time PCR reactions condition is 95 ℃ of denaturations 5 minutes, 1 circulation; 95 ℃ of sex change 25 seconds, 64 ℃ of annealing 20 seconds, 72 ℃ are extended 20 seconds, 15 circulations; 93 ℃ of sex change 25 seconds, 60 ℃ of annealing 35 seconds, 72 ℃ are extended 20 seconds, 31 circulations.Latter 31 circulate in when annealing and detect FAM and HEX or ROX fluorescent signal.
(4) detect fluorescent signal, the standard as a result of judging according to Ct value:
Detect FAM fluorescent signal Ct value, the Ct value judged result showing according to fluorescent PCR amplification instrument: the FAM fluorescence intensity of detection reaction system, when the FAM of usining reaches the threshold value of setting, needed cycle index Ct value is as yin and yang attribute criterion, and Ct value is more than or equal to 30: feminine gender; Ct value is less than 30: merge positive
Detected result show detect and in 15 routine lung cancer samples, have 4 examples have ROS1 to merge sudden change, the concordance rate of the sensitivity of this fluorescence PCR method and sequencing detection method is 100%, has further proved and the accuracy of system detection of the present invention the results are shown in Table 3.
Table 3. detected result of the present invention and direct sequencing comparison
Claims (6)
1. for detection of primer, the probe of the sudden change of ROS1 fusion gene, it is characterized in that, comprise following sequence: SEQ ID NO1-SEQ ID NO8.
2. for detection of the test kit of ROS1 fusion gene sudden change, it is characterized in that, comprise following sequence: SEQ ID NO1-SEQ ID NO8.
3. the detection kit that detection ROS1 fusion gene as claimed in claim 2 suddenlys change, is characterized in that: comprise the reaction system of following fluorescent PCR,
4. the detection kit that detection ROS1 fusion gene as claimed in claim 2 suddenlys change, its using method comprises the following steps:
(1) extract the RNA detecting in sample, detect sample and comprise the RNA in fresh pathological tissue, paraffin-embedded tissue or pleural fluid tissue;
(2) RNA reverse transcription cDNA, preparation real-time fluorescence PCR amplification reaction system;
(3) the Ct value judgement detected result showing according to fluorescent PCR amplification instrument: the FAM of detection reaction system and HEX fluorescence intensity, when the FAM of usining reaches the threshold value of setting, needed cycle index Ct value is as yin and yang attribute criterion, and Ct value is more than or equal to 30: feminine gender; Ct value is less than 30: the positive.
5. the detection kit of detection as claimed in claim 4 ROS1 fusion gene sudden change, is characterized in that, the reaction system of mRNA reverse transcription cDNA is,
6. the detection kit of detection ROS1 fusion gene as claimed in claim 4 sudden change, is characterized in that, RNA reverse transcription cDNA comprises following operation steps:
(a) get reverse transcription reaction mixed solution 18 μ l, M-MLV reversed transcriptive enzyme 1 μ l, adds in aseptic centrifuge tube, mix,
(b) add testing sample RNA6 μ l, RNA total amount within the scope of 0.1～5 μ g, moisturizing to 25 μ l,
(c) 42 ℃ are incubated 1 hour;
(d) 95 ℃ insulation 5 minutes after cooled on ice, obtain cDNA template.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210249654.9A CN102776286B (en) | 2012-07-18 | 2012-07-18 | Primer, probe and assay kit for detecting v-ros avian UR2 sarcoma viral oncogene homolog 1 (ROS1) gene fusion mutation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210249654.9A CN102776286B (en) | 2012-07-18 | 2012-07-18 | Primer, probe and assay kit for detecting v-ros avian UR2 sarcoma viral oncogene homolog 1 (ROS1) gene fusion mutation |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102776286A CN102776286A (en) | 2012-11-14 |
| CN102776286B true CN102776286B (en) | 2014-04-16 |
Family
ID=47121388
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210249654.9A Active CN102776286B (en) | 2012-07-18 | 2012-07-18 | Primer, probe and assay kit for detecting v-ros avian UR2 sarcoma viral oncogene homolog 1 (ROS1) gene fusion mutation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102776286B (en) |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103352070B (en) * | 2012-11-30 | 2015-02-25 | 复旦大学附属肿瘤医院 | ROS1 fusion gene screening method |
| CN103409507A (en) * | 2013-06-26 | 2013-11-27 | 武汉康录生物技术有限公司 | FISH (fluorescence in situ hybridization) probe, a kit and a detection method for detecting ROS1 gene free from repetitive sequence |
| CN104830989A (en) * | 2015-05-25 | 2015-08-12 | 上海允英医疗科技有限公司 | Detection kit for fusion mutation of ROS1 and various genes |
| CN109666746B (en) * | 2019-02-19 | 2023-06-23 | 合肥欧创基因生物科技有限公司 | Primer, probe and kit for detecting human ROS1 gene fusion mutation and detection method thereof |
| CN110964830A (en) * | 2019-12-31 | 2020-04-07 | 中山大学达安基因股份有限公司 | Kit and method for multiple detection of ROS1 gene mutation |
| CN112553338A (en) * | 2020-12-29 | 2021-03-26 | 杭州求臻医学检验实验室有限公司 | Primer pair, probe and kit for rapidly detecting fusion mutation of ROS1 gene and using method thereof |
| CN115927564B (en) * | 2022-09-29 | 2023-09-12 | 杭州联川基因诊断技术有限公司 | Primer combination, kit and method for detecting gene fusion in biological sample |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20130288240A1 (en) * | 2010-05-21 | 2013-10-31 | Cell Signaling Technology, Inc. | Alk and ros kinase in cancer |
| JP5861244B2 (en) * | 2010-06-22 | 2016-02-16 | 公益財団法人がん研究会 | Detection method of novel ROS1 fusion |
-
2012
- 2012-07-18 CN CN201210249654.9A patent/CN102776286B/en active Active
Non-Patent Citations (7)
| Title |
|---|
| Global Survey of Phosphotyrosine Signaling Identifies Oncogenic Kinases in Lung Cancer;Klarisa Rikova,et al;《Cell》;20071214;第131卷;1190-1203 * |
| Klarisa Rikova,et al.Global Survey of Phosphotyrosine Signaling Identifies Oncogenic Kinases in Lung Cancer.《Cell》.2007,第131卷1190-1203. |
| Kristin Bergethon，et al.ROS1 Rearrangements Define a Unique Molecular Class of Lung Cancers.《JOURNAL OF CLINICAL ONCOLOGY》.2012,第30卷(第8期),863-870. * |
| Pasi A Janne,et al.ROS1 Rearrangements in Lung Cancer:A New Genomic Subset of Lung Adenocarcinoma.《Journal of Clinical Oncology》.2012,第30卷(第8期),878-879. |
| RET, ROS1 and ALK fusions in lung cancer.;Takeuchi K,et al;《Nat Med.》;20120212;第18卷(第3期);378-381 * |
| ROS1 Rearrangements in Lung Cancer:A New Genomic Subset of Lung Adenocarcinoma;Pasi A Janne,et al;《Journal of Clinical Oncology》;20120103;第30卷(第8期);878-879 * |
| Takeuchi K,et al.RET, ROS1 and ALK fusions in lung cancer..《Nat Med.》.2012,第18卷(第3期),378-381. |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102776286A (en) | 2012-11-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102719525B (en) | Primer, probe and detection kit for detection of EML4-ALK fusion gene mutation | |
| CN102776286B (en) | Primer, probe and assay kit for detecting v-ros avian UR2 sarcoma viral oncogene homolog 1 (ROS1) gene fusion mutation | |
| CN104946739B (en) | EGFR genetic mutation detection kit and its application | |
| CN104818320B (en) | Primer, probe, detection architecture and the kit of disposable detection lung cancer multiple gene | |
| CN108949990B (en) | Kit and method for detecting EGFR gene mutation | |
| CN105349654B (en) | A kind of probe for detecting EGFR genetic mutation, primer, detection architecture and kit | |
| CN106399555A (en) | Real-time fluorescent quantitative PCR (polymerase chain reaction) detection method as well as standard substance and detection kit for real-time fluorescent quantitative PCR detection | |
| CN103114133B (en) | Probe, primer and detection kit for detecting C-KIT gene mutation | |
| CN104745679A (en) | Method and kit for non-invasive detection of EGFR (epidermal growth factor receptor) gene mutation | |
| CN110283908B (en) | Colorectal cancer auxiliary diagnosis SNP marker and application thereof | |
| CN111235272B (en) | Composition for once detecting multiple gene mutation of lung cancer and application thereof | |
| CN101608240A (en) | Be used to detect primer, probe and the using method thereof of human EGFR gene sudden change | |
| CN101855348A (en) | Gene associated with liver cancer, and method for determination of the risk of acquiring liver cancer | |
| CN105002283A (en) | QPCR composition used for detecting c-kit gene mutation of people and reagent kit | |
| CN109457018A (en) | A kind of EGFR mutated gene detection method based on multiple fluorescence PCR | |
| CN105803088A (en) | Prime group, probe group and kit for detecting Kras gene mutation | |
| CN104830989A (en) | Detection kit for fusion mutation of ROS1 and various genes | |
| CN106811517A (en) | It is a kind of for detecting that c-MET gene extrons 14 are skipped the composition and kit of mutation | |
| CN102719530B (en) | Primer, probe and kit used for detecting PDGFR alpha gene mutations | |
| CN103361419B (en) | Probe, primer and detection kit used for RET gene fusion detection | |
| CN104531875A (en) | Fluorescent quantitative PCR detection kit and detection method for MyD88 gene mutation | |
| CN103290120B (en) | Probe, primer and kit for detecting ALK (anaplastic lymphoma kinase) gene expression | |
| CN107937524A (en) | Mankind's KRAS gene mutation detection kit and detection method | |
| CN108315324A (en) | The detection in BRAF gene mutation site in urine ctDNA | |
| CN113337608B (en) | Combined marker for early diagnosis of liver cancer and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C53 | Correction of patent for invention or patent application | ||
| CB03 | Change of inventor or designer information |
Inventor after: Huang Gemu Inventor after: Li Shuoqing Inventor after: Cao Ying Inventor after: Song Qingtao Inventor after: Ruan Li Inventor after: Zheng Limou Inventor before: Zhang Hailong Inventor before: Jiang Fengge Inventor before: Luo Jiemin Inventor before: Ruan Li Inventor before: Zheng Limou |
|
| COR | Change of bibliographic data |
Free format text: CORRECT: INVENTOR; FROM: ZHANG HAILONG JIANG FENGGE LUO JIEMIN RUAN LI ZHENG LIMOU TO: HUANG HAMU LI SHUOQING CAO YING SONG QINGTAO RUAN LI ZHENG LIMOU |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C56 | Change in the name or address of the patentee | ||
| CP03 | Change of name, title or address |
Address after: 361000, No. 39, Ding Shan Road, Haicang District, Fujian, Xiamen Patentee after: AMOY DIAGNOSTICS CO., LTD. Address before: Haicang District of Xiamen City, Fujian province 361000 Xinyang Street Weng Kok Road No. 289, No. 4 Building 5 layer Branch Center Patentee before: Amoy Diagnostics Co., Ltd. |