CN103361419B - Probe, primer and detection kit used for RET gene fusion detection - Google Patents

Abstract

The invention discloses a probe, a primer and a detection kit used for RET gene fusion detection. The probe, the primer and the detection kit mainly include the following sequences: SEQ, ID, NO1 to SEQ NO27. The probe and the primer provided by the invention can peculiarly detect the RET gene fusion. According to the invention, a real-time fluorescence PCR (Polymerase Chain Reaction) system for detecting RET gene fusion is set up and can simultaneously detect nine fusion types of the RET gene fusion. The method provided by the invention is characterized in that (1) the sensitivity is high as the method can detect 10 copied gene fusion positive plasmid; (2) the operation is simple, the cost is low, and the clinical application is wide; (3) the sample detection range is wide and the sample can be fresh pathological tissue, paraffin-embedded tissue (section), or frozen pathological section; (4) the detection speed is fast because the detection process can be finished within merely 180 minutes.

Description

A kind of probe, primer and detection kit detected for RET gene fusion

Technical field

The present invention relates to biological technical field, relate to probe, primer and test kit that a kind of RET gene fusion detects particularly.

Background technology

RET (ret proto-oncogene) i.e. ret proto-oncogene, it is made up of 6615 VITAMIN B4,8233 cytosine(Cyt)s, 8744 guanines, 6815 thymus pyrimidines.RET proto-oncogene is positioned at No. 10 euchromosomes long-armed (10q11.2), and total length 60kb, comprises 21 exons, 1100 amino acid whose tyrosine kinase receptor superfamily RET albumen of encoding.RET albumen comprises extracellular region, the cross-film district of being rich in halfcystine and includes the intracellular region part of Tyrosylprotein kinase (tyrosine kinase, TK).Cell outskirt comprises the repeated fragment of 4 class adhesins, and 1 calcium land and 1 are rich in the structural area of halfcystine.Wherein the repeated fragment region of class adhesin and intercellular signal transmit closely related; Be rich in the dimerization that halfcystine structure district then mainly participates in acceptor.Intracellular region is a structural area containing TK, and after binding of receptor and ligand, the TK phosphorylation of intracellular region, activates downstream signal transduction path, inducing cell hyperplasia.Nearest research confirms that the cell outskirt being rich in halfcystine at transmembrane segment exists the part of RET, i.e. GDNF (glial cell-line derivedneurotrophic factor, GDNF).Neurturin (NTN), artemin and persephin is also proved to be the part of RET.In addition, cytolemma also existing the co-receptor of RET, is that a kind of glycophosphatidyl inositol connects albumen.The expression in the tissue of isoacceptor and part is not different, and function is also different.RET gene often engages with another gene with fracture itself again, reassembles into a new gene, thus escapes the control of zygote (Ligand), possesses self-phosphorylation and the function of automatic conducted signal.The fusion of KIF5B, CCDC6, NCOA4 and RET gene is RET gene fusion type comparatively common in nonsmall-cell lung cancer.

Studies have reported that (Yokota K, Sasaki H, Okuda K, et al.Oncol Rep, 2012,28 (4) recently; TakeuchiK, Soda M, Togashi Y, et al.Nat Med, 2012,18 (3); Kohno T, Ichikawa H, Totoki Y, et al.NatMed, 2012,18 (3)) in adenocarcinoma of lung, there is KIF5B-RET gene fusion, KIF5B gene is positioned at No. 10 euchromosome galianconism (10p11.22), encoded K IF5B albumen, this albumen belongs to Kinesin kinesin family member.Research shows that KIF5B-RET gene fusion exists only in adenocarcinoma of lung, and its fusion gene can cause RET receptor tyrosine kinase abnormal activation, and finally causes gland cancer; But in lung squamous cancer and small cell carcinoma, can't detect the fusion of KIF5B-RET.From Capelletti (Capelletti) report (the Lipson D of U.S. Da Na-Fa Bai ICR (DFCI), Capelletti M, Yelensky R, et al.NatMed, 2012,18 (3)), adopt the two generations sequencing technologies analysis that 2574 exons and 14 common fusion genes for 145 cancer related genes carry out, from 24 routine patients with lung cancer, find that 1 routine non-smoker exists KIF5B-RET and merges variation.Capelletti continues to have found that 4 kinds of RET merge varient to the analysis of other 634 routine samples.Takeuchi etc. have carried out the examination of fusion gene by integration molecule and histopathology system of screening to 1529 routine patients with lung adenocarcinomas, find to merge with kinesin family member 5B (KIF5B)-RET and CCDC6-RET in 14 routine gland cancer; The people such as doctor Wang Rui of Fudan University in Shanghai Cancer center and doctor Chen Haiquan detect the RET fusion gene situation of 936 examples by the NSCLC patient of surgical resection therapy altogether, find in 936 routine NSCLC patients, 13 routine patients (have 11 examples in 633 routine adenocarcinoma patients, have 2 examples in 24 routine adenosquamous carcinoma patients) are had to detect that RET fusion gene exists completely.In this 13 routine patient, have 9 routine patients to be KIF5B-RET, 3 routine patients are CCDC6-RET, and 1 routine patient is newfound NCOA4-RET fusion gene.

Current discovery Vandetanib, Sorafenib and Sunitinib tri-kinds of targeted drugs can suppress RET gene in the activity of interior multiple receptor tyrosine kinase, kill and wound the cell carrying RET fusion gene.Therefore, can consider further RET fusion gene to be used for clinical application, and targeted therapy research is carried out to it.

The method of current detection RET fusion gene mainly contains RT-polymerase chain reaction (RT-PCR), Immunohistochemical Method and fluorescence in situ hybridization (FISH) method etc.But immunohistochemical methods (IHC) detection sensitivity is poor, only about 10%; FISH method detection specificity is poor, and sensitivity is lower, and result interpretation difference is large, and detection time is long, and cannot detect the multiple fusion varient of RET fusion gene generation simultaneously and need expensive specialized instrument and equipment, reagent cost is higher, complicated operation; Conventional RT-PCR method is sensitive relative to FISH and IHC, objective, but still cannot meet the actual demand of clinical detection, and its sensitivity and specificity need to be improved further, and the detection of muting sensitivity can cause undetected and false-negative generation.Therefore, clinical in developing a kind of highly sensitive detection method that can detect RET gene fusion simultaneously, to realize adopting detection method fast to detect RET gene fusion simultaneously, thus provide science reference frame for clinical lung cancer individualized treatment.

For the problems referred to above, the present invention develops a kind of RET fusion gene detection kit quick, easy and simple to handle and detection method., this detection method once can detect RET9 kind gene fusion simultaneously, and detection sensitivity is high, only need detection time within 180 minutes, can complete, possess highly sensitive, specificity is good simultaneously, fast inexpensive, simple operation and other advantages, can meet the actual demand of clinical rapid detection.

Summary of the invention

The object of the invention is to provide a kind of primer for the detection of RET fusion gene and probe, and its special primer and probe comprise following sequence:

Table 1RET fused type specificity decoding for DTMF and probe nucleotide sequence

K15-R12

F:CATCTTTACTAAAAGACCTTGCAGAAATAGG SEQ ID NO：01

P:CTCCATGATGTAAAGGAGGATCCAAAGTGGGGATC SEQ ID NO：02

R:CCAAATTCGCCTTCTCCTAGAGTT SEQ ID NO：03

K16-R12

F:AGGAGTTAGCAGCATGTCAGC SEQ ID NO：04

P:TGAGCGTATCTCTCAAGAGGATCCAACTCT SEQ ID NO：05

R:CCAAATTCGCCTTCTCCTAGAGTT SEQ ID NO：06

K22-R12

F:ACTCTTTGTTCAGGACCTGGCTAC SEQ ID NO：07

P:CCTTAGTTAAAAAGGAGGATCCAAAGTGGTCCT SEQ ID NO：08

R:CCAAATTCGCCTTCTCCTAGAGTT SEQ ID NO：09

K23-R12

F:AATCTTGAACAGCTCACTAAAGTGC SEQ ID NO：10

P:CCTCCAAACAGGAGGATCCAAAGTGGGAT SEQ ID NO：11

R:CCAAATTCGCCTTCTCCTAGAGTT SEQ ID NO：12

K24-R8

F:AGATCGCATAAAGGAAGCAGTCAGGT SEQ ID NO：13

P:CTGT ATTCTGCACAGATTGATGTGGCAAT SEQ ID NO：14

R:TCTTGCTGACTGCACAGGAC SEQ ID NO：15

K15-R11

F:CATCTTTACTAAAAGACCTTGCAGAAATAGG SEQ ID NO：16

P:ACTT ATGATGTAAAGTTTGCCCACAAGCAA SEQ ID NO：17

R:GGCCTCCGGAAGGTCATCT SEQ ID NO：18

K24-R11

F:AGATCGCATAAAGGAAGCAGTCAGGT SEQ ID NO：19

P:AATC TGCACAGATTGATCCACTGTGATC SEQ ID NO：20

R::ACGATGAAGGAGAAGAGGACAG SEQ ID NO：21

CCDC6-RET(1+12)

F:GGAGACCTACAAACTGAAGTGCAAG SEQ ID NO：22

P:TCGA GTTACCATCGAGGATCCAAAGATCC SEQ ID NO：23

R:CCAAATTCGCCTTCTCCTAGAGTT SEQ ID NO：24

NCOA4(EXON9)-RET(EXON12)

F:TATTGGGCCCTTCCTGGAGAA SEQ ID NO：25

P:CCTGCCAGAGCAGGAGGATCCAAATCCT SEQ ID NO：26

R:CCAAATTCGCCTTCTCCTAGAGTT SEQ ID NO：27

The present invention provides a kind of for detecting RET fusion gene detection kit on the other hand, and it is as follows that its PCR reacts amplification system:

1 × PCR damping fluid

The present invention provides a kind of method for mRNA reverse transcription cDNA on the other hand, and method comprises reverse transcription system composition and following operation steps:

MRNA reverse transcription cDNA system comprises following composition:

A () gets RET gene fusion reverse transcription reaction liquid 18.5 μ L, RET gene fusion reversed transcriptive enzyme 0.5 μ L, adds in centrifuge tube, mixing.

B () adds testing sample RNA6 μ L.(RNA total amount within the scope of 0.3 ~ 4.8 μ g, available dilute without RNase water)

(c) 42 DEG C insulation 1 hour.

D () 95 DEG C insulation cooling after 5 minutes, the cDNA solution obtained is for pcr amplification.

The present invention provides a kind of method for detecting RET fusion gene on the other hand, and its method comprises the following steps:

(1) mankind RET announced according to COSMIC data is wildtype gene sequence, for various RET fusion gene, and design Auele Specific Primer and probe.

(2) extract geneome RNA in detection sample, detection sample comprises the RNA in fresh pathological tissues, paraffin embedding pathological tissue or the tissue such as section, frozen pathologic section.

(3) real-time fluorescent PCR amplification reaction system is prepared.

(4) judge detected result according to the Ct value of fluorescent PCR amplification instrument display: the FAM fluorescence intensity of detection reaction system, cycle index Ct value required when reaching the threshold value of setting using FAM is as yin and yang attribute criterion:

If a) Ct value >=30, then this sample is that RET gene fusion is negative;

If b) Ct value <30, then this sample is that RET gene fusion is positive;

The invention has the beneficial effects as follows: present invention employs Auele Specific Primer and probe technique, can specific detection RET gene fusion.This method: (1) establishes the rapid detection that PCR in real time system realizes merging 9 kinds of RET gene kinds; (2) highly sensitive, the gene fusion positive plasmid of 10 copies all can detect; (3) simple to operate, detect cheap, clinical application range is wide; (4) sample detection range is wide, and sample can be fresh pathological tissue, paraffin-embedded tissue or frozen pathologic section; (5) detection speed is fast, and testing process only needs to complete for 180 minutes.

Accompanying drawing explanation

Fig. 1 is that the present invention detects plasmid PCR figure.

Fig. 2 is that sensitivity analysis test-results PCR schemes.

Fig. 3 merges negative, positive PCR figure for detecting clinical sample.

Embodiment

The present invention for RNA template, sets up RET real-time fluorescence PCR detecting reaction system with wild-type cell system genome, and for position of fusion design special primer and probe, the method detecting RET gene fusion comprises the following steps:

(1) for position of fusion design and synthesis Auele Specific Primer and probe

Be wild-type sequence according to the RET gene order of COSMIC warehouse publication, for RET fusion gene site design special primer and probe.By Auele Specific Primer and probe optimization, realize highly sensitive and rapid detection.Application Premier6.0 primer-design software designing probe and special primer nucleotide sequence, primer and probe sequence as shown in table 1.

(2) extraction of sample process and RNA is detected

Detect sample and comprise fresh pathological tissue, frozen pathologic section, paraffin-embedded tissue or section.Fresh pathological tissue, gets about 1 gram, uses the RNA of TIANGEN to extract test kit and extracts its RNA.Paraffin-embedded tissue, uses the RNA extraction test kit of organizing of Qiagen to extract its RNA.Above-mentioned concrete operation step presses the operation of test kit specification sheets.

(3) pcr amplification reaction system is set up

By put on and state RNA and be dissolved in 0.1%DEPC water, extract quality through UV spectrophotometer measuring, determine that its concentration OD260/OD280 is 1.9-2.1, and read its content.The template that the RNA getting 0.1 ~ 5 μ g synthesizes as its cDNA, cDNA synthetic system is as follows:

Apply above-mentioned reverse transcription system and carry out reverse transcription as follows:

A () gets RET gene fusion reverse transcription reaction liquid 18.5 μ L, RET gene fusion reversed transcriptive enzyme 0.5 μ L, adds in centrifuge tube, mixing.

B () adds testing sample RNA6 μ L.(RNA total amount within the scope of 0.3 ~ 4.8 μ g, available dilute without RNase water)

(c) 42 DEG C insulation 1 hour.

D () 95 DEG C insulation cooling after 5 minutes, the cDNA solution obtained is for pcr amplification.

By above-mentioned gained cDNA template, as the template of real-time fluorescent PCR amplification, carry out pcr amplification according to following amplification system:

1 × PCR damping fluid

Real-time PCR reactions condition is 95 DEG C of denaturations 5 minutes, 1 circulation; 95 DEG C of sex change 25 seconds, 64 DEG C of annealing 20 seconds, 72 DEG C extend 20 seconds, 15 circulations; 93 DEG C of sex change 25 seconds, 60 DEG C of annealing 35 seconds, 72 DEG C extend 20 seconds, 31 circulations.FAM and HEX(VIC is detected during annealing) fluorescent signal.

(4) detected result is judged according to the Ct value of fluorescent PCR amplification instrument display:

The FAM fluorescence intensity of detection reaction system, cycle index Ct value required when reaching the threshold value of setting using FAM is as yin and yang attribute criterion:

If a) Ct value >=30, then this sample is that RET gene fusion is negative;

If b) Ct value <30, then this sample is that RET gene fusion is positive;

Below in conjunction with specific embodiment, the present invention is set forth further.Should be understood that these embodiments are only not used in for the present invention to limit the scope of the invention.Unless otherwise defined or described herein, the scientific terminology described in this patent and those of ordinary skill in the art understand there is identical implication.

Embodiment 1

Use system of the present invention to detect plasmid, experiment plasmid template (containing RET variant1 fusion gene), utilize the method for above-mentioned fluorescent PCR detection RET gene fusion as follows:

(1) plasmid process and extraction:

The extraction of plasmid adopts TIANGEN(HighPure Plasmid Kit, DP116) plasmid extraction kit extract, concrete operation steps of extracting press test kit specification sheets and is operated.The DNA that carries is dissolved in (10mmol/L, PH8.0) in Tris-HCl, extracts quality through UV spectrophotometer measuring, determine its concentration, then use Tris-HCl(10mmol/L, PH8.0) solution adjustment DNA respective concentration to as pcr template, get 5 μ L and carry out PCR reaction and increase.

(2) PCR reaction system is set up

By above-mentioned gained cDNA template, as the template of real-time fluorescent PCR amplification, carry out pcr amplification according to following amplification system:

1 × PCR damping fluid

Real-time PCR reactions condition is 95 DEG C of denaturations 5 minutes, 1 circulation; 95 DEG C of sex change 25 seconds, 64 DEG C of annealing 20 seconds, 72 DEG C extend 20 seconds, 15 circulations; 93 DEG C of sex change 25 seconds, 60 DEG C of annealing 35 seconds, 72 DEG C extend 20 seconds, 31 circulations.FAM and HEX or VIC fluorescent signal is detected when annealing.

(3) detected result is judged according to the Ct value of fluorescent PCR amplification instrument display

Standard according to Ct value judges as a result: the Ct value according to the display of fluorescent PCR amplification instrument judges detected result: cycle index Ct value required when reaching the threshold value of setting using FAM is as yin and yang attribute criterion:

If a) Ct value >=30, then this sample is that RET gene fusion is negative;

If b) Ct value <30, then this sample is that RET gene fusion is positive;

Sensitivity analysis: getting concentration is quantitatively the sample DNA of 1000 copies, carries out 10 times of gradient dilutions, do 2 dilution gradients altogether, every secondary response adds 5 μ L and carries out amplified reaction.Result shows, sensitivity of the present invention can detect 10 copies/μ L, and result is as Fig. 2.

Detected result shows, detection system of the present invention accurately can detect each fusion gene plasmid gene, and the sensitivity of detection can reach 10 copies/μ L.

Embodiment 2

Use the present invention to detect clinical sample, get my company clinical lung cancer paraffin-embedded tissue sample totally 1000 examples, utilize special primer of the present invention and fluorescence probe PCR system to detect 1000 routine clinical sample RET gene fusion steps as follows:

(1) extraction of sample process and RNA:

A () gets above-mentioned each lung cancer sample, add 1ml dimethylbenzene respectively, mixing, the centrifugal 2min of 14000RPM under room temperature, abandon supernatant liquor, add 1ml dehydrated alcohol in precipitation, concussion mixing (removal dimethylbenzene), under room temperature, the centrifugal 2min of 14000RPM abandons supernatant liquor, opens centrifuge tube lid, and 37 DEG C are dried;

B () adds 150 μ l Buffer PKD and 10 μ l Proteinase Ks in centrifuge tube, concussion mixing, hatch 15min for 56 DEG C, hatch 15min for 80 DEG C, after dropping to room temperature, add 16ul DNase Booster Buffer and 10ul Dnase I stoste, incubated at room 15min, after add 320 μ l Buffer RBC, mixing;

C () adds 720 μ l dehydrated alcohols toward supernatant liquor, mixing, getting 700 μ l samples comprises in the RNA MinElute centrifugal column that the precipitation generated transfers to 2ml collection tube above, be greater than 10, the centrifugal 15s of 000rpm, abandon waste liquid, repeat previous step until sample is transferred in RNA MinElute centrifugal column.

D () uncap adds 500 μ l Buffer RPE, cover tightly lid, be greater than the centrifugal 2min of 10000rpm, by posts transfer in collection tube, drips 14-30 μ lRnase-free water, collect RNA after centrifugal 1min to adsorption film middle part.

(2) pcr amplification reaction system is set up:

By put on and state RNA and be dissolved in 0.1%DEPC water, extract quality through UV spectrophotometer measuring, determine that its concentration OD260/OD280 is 1.9-2.1, and read its content.The template that the RNA getting 0.1 ~ 5 μ g synthesizes as its cDNA, cDNA synthetic system is as follows:

Apply above-mentioned reverse transcription system and carry out reverse transcription as follows:

A () gets RET gene fusion reverse transcription reaction liquid 18.5 μ L, RET gene fusion reversed transcriptive enzyme 0.5 μ L, adds in centrifuge tube, mixing.

B () adds testing sample RNA6 μ L.(RNA total amount within the scope of 0.3 ~ 4.8 μ g, available dilute without Rnase water)

(c) 42 DEG C insulation 1 hour.

D () 95 DEG C insulation cooling after 5 minutes, the cDNA solution obtained is for pcr amplification.

By above-mentioned gained cDNA template, as the template of real-time fluorescent PCR amplification, carry out pcr amplification according to following amplification system:

1 × PCR damping fluid

Real-time PCR reactions condition is 95 DEG C of denaturations 5 minutes, 1 circulation; 95 DEG C of sex change 25 seconds, 64 DEG C of annealing 20 seconds, 72 DEG C extend 20 seconds, 15 circulations; 93 DEG C of sex change 25 seconds, 60 DEG C of annealing 35 seconds, 72 DEG C extend 20 seconds, 31 circulations.FAM and HEX or VIC fluorescent signal is detected when annealing.

(3) detected result is judged according to the Ct value of fluorescent PCR amplification instrument display

Standard according to Ct value judges as a result: the Ct value according to the display of fluorescent PCR amplification instrument judges detected result: cycle index Ct value required when reaching the threshold value of setting using FAM is as yin and yang attribute criterion:

If a) Ct value >=30, then this sample is that RET gene fusion is negative;

If b) Ct value <30, then this sample is that RET gene fusion is positive;

In the clinical sample of 1000 detected examples, RET fusion gene positive rate is 1.8%.Adopt direct sequencing to carry out comparison and detection, result shows that the coincidence rate of system of the present invention and direct sequencing reaches 100%, further demonstrates the accuracy that system of the present invention detects, the results are shown in Table 2 simultaneously.Fluorescence PCR system of the present invention can detect RET gene fusion, and fast easy to detect, accuracy is high, can meet RET gene fusion rapid detection.The coincidence rate of this fluorescence PCR method and traditional sequencing methods result is 100%, and fluorescent PCR sensitivity and selective enumeration method ability are higher than traditional sequencing methods.

Table 2 fluorescence PCR method compares with traditional sequencing methods

Table 3RET9 kind gene fusion type

Table 4RET gene fusion test kit moiety

Claims (6)

1. for detecting primer and the probe of RET gene fusion, it is characterized in that, comprising following sequence: SEQ IDNO1-SEQ ID NO27.

2. for detecting the test kit of RET gene fusion, it is characterized in that, comprising following sequence: SEQ ID NO1-SEQ ID NO27.

3. the detection kit detecting RET gene fusion as claimed in claim 2, is characterized in that: the reaction system comprising following fluorescent PCR:

1 × PCR damping fluid

。

4. the detection kit detecting RET fusion gene as claimed in claim 3, its using method comprises the following steps:

(1) extract the RNA detected in sample, detection sample comprises the RNA in fresh pathological tissue, paraffin-embedded tissue (section) or frozen pathologic section;

(2) RNA reverse transcription cDNA, preparation real-time fluorescent PCR amplification reaction system;

(3) judge detected result according to the Ct value of fluorescent PCR amplification instrument display: FAM and HEX(VIC of detection reaction system) fluorescence intensity, cycle index Ct value required when reaching the threshold value of setting using FAM is as yin and yang attribute criterion:

If a) Ct value >=30, then this sample is that RET gene fusion is negative;

If b) Ct value <30, then this sample is that RET gene fusion is positive.

5. the detection kit detecting RET fusion gene as claimed in claim 4, it is characterized in that, the reaction system of mRNA reverse transcription cDNA is:

。

6. the detection kit detecting RET fusion gene as claimed in claim 4, it is characterized in that, RNA reverse transcription cDNA comprises following operation steps:

A () gets RET gene fusion reverse transcription reaction liquid 18.5 μ L, RET gene fusion reversed transcriptive enzyme 0.5 μ L, adds in centrifuge tube, mixing;

B () adds testing sample RNA6 μ L;

(c) 42 DEG C insulation 1 hour;

D () 95 DEG C insulation cooling after 5 minutes, the cDNA solution obtained is for pcr amplification.