CN102719525A - Primer, probe and detection kit for detection of EML4-ALK fusion gene mutation - Google Patents

Abstract

The invention discloses a primer, a probe and a detection kit for detection of an EML4-ALK fusion gene mutation. The primer and probe provided by the invention are SEQ ID NO 1-SEQ ID NO 24. The primer and probe of the invention can carry out specific detection on EML4-ALK fusion gene mutation. The present invention has the following advantages: (1) an established real-time fluorescent PCR system capable of simultaneously detecting 9 kinds of fusion mutation of EML4-ALK gene; (2) high sensitivity capable of detecting mutation of 5-10 copies; (3) simple operation, cheap detection and wide clinical application range; (4) a wide range of samples from fresh pathological tissue to paraffin embedded tissue or pleural fluid; and (5) high speed detection with a detection procedure taking only 90 minutes.

Description

Be used to detect primer, probe and the detection kit of the sudden change of EML4-ALK fusion gene

Technical field

The present invention relates to biological technical field, relate to the detection kit of fusion gene sudden change particularly.

Background technology

Lung cancer is modal malignant tumour in the world wide, and M & M occupies first of each cancer.The annual whole world has the patient above 1,300,000 to die from lung cancer, and closely half occurs in developing country.According to the statistics of China Ministry of Health in 2010, lung cancer mortality is 30.83/10 ten thousand, and lung cancer has become the primary malignant tumour of M & M.(Orras JM, Fernandez E, Gonzalez JR, et al.Lung cancer mortality in European regions (1955-1997) .Ann Oncol, 2003,14 (1): 159-161; Ministry of Health of the People's Republic of China, " Chinese health statistics in 2010 " yearbook).

Lung cancer can be divided into small cell carcinoma (SCLC) and non-small cell carcinoma on the histopathology, and (non-small cell lung cancer, NSCLC) two big types, wherein non-small cell carcinoma accounts for 85% of the total case of lung cancer.Be merely 13% in the survival rate in 5 years of China's patients with lung cancer, its major cause is most of lung cancer owing to lack highly sensitive detection in Gene Mutation and make a definite diagnosis technology, and the regimen of the science that is complementary with it, thereby makes the patient miss the best moment of treatment.

Chemotherapy is still the main treatment means of lung cancer at present, yet most chemotherapy can produce bigger toxic side effect, and the chemotherapy effect between different patients has than big-difference.Along with the development of oncomolecularbiology, the molecular targeted treatment of lung cancer is high because of its specificity, and toxic side effect is low, becomes the first-selected therapeutic modality of clinician day by day.The NSCLC patient that is found to be of EML4-ALK (Echinoderm Microtubule-associated protein-Like 4-Anaplastic Lymphoma Kinase) gene fusion sudden change provides new treatment target spot.EML4 (echinoderms MAP 4) forms closely related with microtubule; ALK (Nucleophosmin-anaplastic lymphoma kinase) plays important regulatory role at the tumour cell signal transduction.EML4 mainly comprises coiled coil structure, hydrophobic EMAP protein structure domain, tryptophan-aspartic acid repeating structure; Two genes of EML4 and ALK lay respectively at human No. 2 chromosomal p21 and P23 band, about 12Mb of being separated by.The inversion of these two gene fragments merges, and promptly inv (2) (p21p23) can make the EML4-ALK fusion rotein that tissue expression is new.EML4 promotor after the fusion is positioned at the upper reaches of alk tyrosine kinase, thereby makes the fusion gene activation, expresses the EML4-ALK fusion rotein.The dimer that forms through EML4 born of the same parents' outer structure makes the ALK acceptor continue phosphorylation, and then activates cell signal path (Soda M, the et al.Nature 2007 that continues downstream; 448:561-6; Martelli MP, et al.Am.J.Pathol.174 (2): 661-70; Koh Y, et al.J Thorac Oncol 2011; 6:905-912.).

With Crizotinib (azoles base of a fruit Buddhist nun in the gram; Pfizer) be small molecules targeted drug for the medicine of representative to EML4-ALK gene fusion sudden change exploitation; Through suppressing the activity in alk tyrosine kinase zone, block its downstream abnormal signal path, thereby suppress the growth of tumour cell.Clinical study shows that Crizotinib merges sudden change the efficient of patient to EML4-ALK and reaches more than 61%, and the patient of wild-type almost is of no curative effect.Therefore; Detecting EML4-ALK fusion sudden change situation is to instruct the prerequisite and the basis of the medication of Crizotinib class medicine; Detect the sudden change of EML4-ALK fusion gene for the survival rate that improves patients with lung cancer through high-sensitive detection method before the chemotherapy, prolong lifetime, avoid excessive chemotherapy, the raising life quality has significance.

At present, the detection method that EML4-ALK merges sudden change is mainly fluorescence in situ hybridization (FISH) method, yet FISH method detection specificity is poor, and sensitivity is lower, and detection time is long, and can't detect the multiple fusion varient that EML4-ALK merges generation simultaneously.In addition, the FISH detection needs the expensive dedicated plant and instrument, and reagent cost is higher, and complicated operation is widely used clinical detection and is restricted.It is unsuitable oversize that FISH detects the time that requires the detection sample to preserve, and adopts long sample of shelf time to detect and can cause false-negative generation, influenced the accuracy of detection.Therefore; The FISH detection method can't satisfy the demand that the clinician detects practical application; The clinical a kind of highly sensitive detection method that can detect EML4-ALK fusion gene various mutations simultaneously of exploitation that presses for; Detect simultaneously to realize adopting fast detection method that many kinds of EML4-ALK are merged sudden change, thereby the science reference frame is provided for clinical lung cancer individualized treatment scheme.

To the problems referred to above, the present invention develops a kind of quick cheapness, EML4-ALK fusion gene easy and simple to handle sudden change detection kit and detection method.This detection method design a kind of novel special primer of utilization and probe.This detection method can once detect 9 kinds of fusion sudden changes of EML4 and ALK gene simultaneously, and detection sensitivity is high, and only needed to accomplish in 90 minutes detection time; Possessed highly sensitively simultaneously, specificity is good, and is fast cheap; Simple operation and other advantages can satisfy the actual demand of clinical rapid detection.

Summary of the invention

The object of the present invention is to provide a kind of EML4-ALK of being used for gene fusion sudden change to detect primer and probe, its special primer and probe comprise following sequence:

Table 1EML4-ALK merges two primers of sudden change specificity and probe nucleotide sequence

EML4-ALK-reverse transcription 1:TCAGGTCACTGATGGAGGAG SEQ ID NO:01

EML4-ALK-rt 2:CAGGAGGAGCAATGATCTTG SEQ ID NO:02

No. 1: M 1,2,3

EML4-ALK-M-F：GCCCACACCTGGGAAAGGACCT SEQ?ID?NO：03

EML4-ALK-M-F：CAGACAAGCATAAAGATGTCAT SEQ?ID?NO：04

EML4-ALK-M-F：ACACCTTGACTGGTCCCCAGAC SEQ?ID?NO：05

EML4-ALK-M-R：AGGTGCGGAGCTTGCTCAGCT SEQ?ID?NO：06

EML4-ALK-M-P：FAM-5-AGCTCACCAGGAGCTGCAAGCCATGCTTGC-3-BHQ1 SEQ?ID?NO：07

No. 2: M 4,5

EML4-ALK-M-F：GCAGAAGGAAAGGCAGATCAAT SEQ?ID?NO：08

EML4-ALK-M-F：TCTGTGGGATCATGATCTGAATC SEQ?ID?NO：09

EML4-ALK-M-R：TCAGGTCACTGATGGAGGAGGTC SEQ?ID?NO：10

EML4-ALK-M-P：FAM-5-TGTATGACCGACTACAACCCCAACTACTGGGT-3-BHQ1 SEQ?ID?NO：11

No. 3: M 6,7

EML4-ALK-M-F：CCAGAGATCTAGTTTCTATCCAC SEQ?ID?NO：12

EML4-ALK-M-F：ATCTCTGAAGATCATGTGGCCTC SEQ?ID?NO：13

EML4-ALK-M-R：AGGTGCGGAGCTTGCTCAGCT SEQ?ID?NO：14

EML4-ALK-M-P：FAM-5-AGCTCACCAGGAGCTGCAAGCCATGCTTGC-3-BHQ1 SEQ?ID?NO：15

No. 4: M 8

EML4-ALK-M-F：ATAGGAACGCACTCAGGCAGAG SEQ?ID?NO：16

EML4-ALK-M-R：AGGTGCGGAGCTTGCTCAGCT SEQ?ID?NO：17

EML4-ALK-M-P：FAM-5-AGCTCACCAGGAGCTGCAAGCCATGCTTGC-3-BHQ1 SEQ?ID?NO：18

No. 5: M 9

EML4-ALK-M-F：ATCTCTGAAGATCATGTGGCCTC SEQ?ID?NO：19

EML4-ALK-M-R：GCAGCCTGGCCCTTGAAGCACT SEQ?ID?NO：20

EML4-ALK-M-P：FAM-5-GATCCCTCCCTGGATCTCCATATCCTCCTGGA-3-BHQ1 SEQ?ID?NO：21

No. 6:

ACTB-F：CTGGCATTGCCGACAGGA SEQ?ID?NO：22

ACTB-R：AGGAGCAATGATCTTGATCTTC SEQ?ID?NO：23

ACTB-P：FAM-CAGTAAGGAGATCACTGCCCTGGCACCCAAGGG-BHQ SEQ?ID?NO：24

The present invention provides a kind of EML4-ALK gene fusion sudden change detection kit that is used to detect on the other hand, and its PCR reaction amplification system is following:

The present invention provides the method for a kind of mRNA of being used for reverse transcription cDNA on the other hand, and method comprises that the reverse transcription system is formed and following operation steps:

MRNA reverse transcription cDNA system comprises following composition:

(a) get reverse transcription reaction mixed solution 18 μ l, M-MLV reversed transcriptive enzyme 1 μ l adds in the aseptic centrifuge tube mixing.

(b) add testing sample RNA 6 μ l, the RNA total amount in 0.1～5 μ g scope, moisturizing to 25 μ l.

(c) 42 ℃ are incubated 1 hour.

(d) 95 ℃ the insulation 5 minutes after cooled on ice, obtain the cDNA template..

Further aspect of the present invention provides a kind of EML4-ALK gene fusion mutation method that is used to detect, and its method may further comprise the steps:

(1) the human EML4-ALK that announces according to the COSMIC data is the wild type gene sequence, merges sudden change for 9 kinds to the EML4-ALK gene, designs special primer and probe.

(2) extract the RNA that detects sample, detect sample and comprise fresh pathological tissue, paraffin-embedded tissue or pleural fluid.

(3) preparation real-time fluorescence PCR amplification reaction system.

(4) the Ct value that shows according to fluorescent PCR amplification appearance is judged detected result: the FAM of detection reaction system and HEX fluorescence intensity, and needed cycle index Ct value is as yin and yang attribute criterion when reaching preset threshold with FAM, and the Ct value is more than or equal to 30: feminine gender; The Ct value is less than 30: the positive.

The invention has the beneficial effects as follows: the present invention has adopted special primer and probe technique, can the human EML4-ALK gene fusion sudden change of special detection.This method: the real-time fluorescence PCR system has been set up in (1), can detect the EML4-ALK gene simultaneously and merge sudden change for 9 kinds; (2) highly sensitive, the sudden change of 5-10 copy can detect; (3) simple to operate, detect cheapness, clinical application range is wide; (4) the pattern detection scope is wide, and sample can be fresh pathological tissue, paraffin-embedded tissue or pleural fluid; (5) detection speed is fast, and testing process only needed to accomplish in 90 minutes.

Description of drawings

Fig. 1 detects plasmid PCR figure for the present invention.

Fig. 2 is sensitivity analysis test-results PCR figure.

Fig. 3 is positive PCR figure for the detection clinical sample suddenlys change.

Fig. 4 is for detecting clinical sample wild-type PCR figure.

Embodiment

The present invention is a template with the mutant plasmid that genetically engineered makes up; Make up EML4-ALK real-time fluorescence PCR amplification reaction system; With FAM is the jump signal sense channel; Merge 9 site designs specificity probes of sudden change and two primers to EML4-ALK, through the highly sensitive special detection of the optimization implementation of primer and detection architecture.The method that detects the sudden change of EML4-ALK gene fusion may further comprise the steps:

(1) to mutational site design synthetic primer and probe:

The human EML4-ALK gene order of announcing according to the COSMIC DB is a wild-type sequence, merges sudden change to 9 kinds of EML4-ALK genes and comes design specific primers and probe.Through Auele Specific Primer and probe system optimization, realize highly sensitive and special detection, 9 of EML4-ALK genes merge the mutational site sees table 2.

To 9 selected fusion mutational sites, the design of Using P remier 6.0 primer-design softwares is many to special primer and many probes, and primer and probe sequence are as shown in table 1.

(2) extraction of sample process and RNA:

The extraction of sample preparation and RNA: the sample scope of application comprises fresh tumor tissues and pleural fluid.Fresh pathological tissue is got about 1 gram, uses the RNA of TIANGEN to extract its RNA of test kit extraction.Pleural fluid uses the RNA that organizes of TIANGEN to extract its RNA of test kit extraction.Paraffin-embedded tissue uses the RNA that organizes of Qiagen to extract its RNA of test kit extraction.Above-mentioned concrete operations step is pressed the operation of test kit specification sheets.

(3) set up the pcr amplification reaction system:

With put on and state RNA and be dissolved in the 0.1%DEPC water, extract quality through UV spectrophotometer measuring, confirm that its concentration OD260/OD280 is 1.9-2.1, and read its content.The RNA that gets 0.1～5 μ g adopts the synthetic cDNA of test kit of Xiamen Amoydx Bio-Pharmaceutical Technology Co., Ltd. as its cDNA synthetic template, and the cDNA synthetic system is following:

Use above-mentioned reverse transcription system and carry out rt as follows:

(a) get reverse transcription reaction mixed solution 18 μ l, M-MLV reversed transcriptive enzyme 1 μ l adds in the aseptic centrifuge tube mixing.

(b) add testing sample RNA 6 μ l, the RNA total amount in 0.1～5 μ g scope, moisturizing to 25 μ l.

(c) 42 ℃ are incubated 1 hour.

(d) 95 ℃ the insulation 5 minutes after cooled on ice, obtain the cDNA template..

With above-mentioned gained cDNA template,, carry out pcr amplification according to following amplification system as the template of real-time fluorescence PCR amplification:

The real-time PCR reactions condition is 95 ℃ of preparatory sex change 5 minutes, 1 circulation; 95 ℃ of sex change 25 seconds, 64 ℃ of annealing 20 seconds, 72 ℃ were extended 15 circulations 20 seconds; 93 ℃ of sex change 25 seconds, 60 ℃ of annealing 35 seconds, 72 ℃ were extended 31 circulations 20 seconds.When circulating in annealing, 31 of backs detect FAM and HEX or ROX fluorescent signal.

(4) detect fluorescent signal, the standard of as a result of judging according to the Ct value:

Detect FAM fluorescent signal Ct value; Ct value judged result according to the demonstration of fluorescent PCR amplification appearance: the FAM fluorescence intensity of detection reaction system; Needed cycle index Ct value is as yin and yang attribute criterion when reaching preset threshold with FAM, and the Ct value is more than or equal to 30: feminine gender; The Ct value is less than 30: the positive.

Below in conjunction with specific embodiment, the present invention is further set forth.Should be understood that these embodiment only to be used for the present invention and be not used in the restriction scope of the present invention.Only if definition or explanation are arranged in addition, the described scientific and technical term of this patent is understood with those of ordinary skills and is had identical implication.

Embodiment 1

Use system of the present invention to detect plasmid, experiment utilizes the method for above-mentioned fluorescent PCR detection EML4-ALK gene fusion sudden change following with plasmid template (containing EML4-ALK variant 1 sudden change):

(1) plasmid is handled and is extracted:

TIANGEN is adopted in the extraction of plasmid, and (HighPure Plasmid Kit, plasmid extraction kit DP116) extracts, and specifically extracts operation steps and operates by the test kit specification sheets.The DNA that carries is dissolved among the Tris-HCl that (10mmol/L PH8.0), extracts quality through UV spectrophotometer measuring; Confirm its concentration; (10mmol/L, PH8.0) solution adjustment DNA concentration, is got 5 μ L and is carried out PCR reaction amplification as pcr template to 2ng/ μ L to use Tris-HCl then.

(2) set up the pcr amplification reaction system:

With above-mentioned gained cDNA template,, carry out pcr amplification according to following amplification system as the template of real-time fluorescence PCR amplification:

The real-time PCR reactions condition is 95 ℃ of preparatory sex change 5 minutes, 1 circulation; 95 ℃ of sex change 25 seconds, 64 ℃ of annealing 20 seconds, 72 ℃ were extended 15 circulations 20 seconds; 93 ℃ of sex change 25 seconds, 60 ℃ of annealing 35 seconds, 72 ℃ were extended 31 circulations 20 seconds.When circulating in annealing, 31 of backs detect FAM and HEX or ROX fluorescent signal.

(4) detect fluorescent signal, the standard of as a result of judging according to the Ct value:

Adopt MX3000P real-time fluorescence PCR appearance to increase, at the fluorescent signal of back 31 cycle annealing stages detection FAM and HEX, needed cycle index Ct value is as yin and yang attribute criterion when reaching preset threshold with FAM, and the Ct value is more than or equal to 30: feminine gender; The Ct value is less than 30: the positive

Sensitivity analysis: concentration is the sample DNA of 1000 copies after learning from else's experience quantitatively, carries out 10 times of dilutions, respectively 3 concentration is detected then, and each reaction adds 5 μ L DNA.The result shows the highly sensitive of fluorescence PCR method of the present invention, and 10 copy DNA genomes can detect result such as Fig. 2.

Replica test: each reaction adds mutant plasmid DNA1000 copy, 100 copies respectively, repeats 10 times and carries out the fluorescent PCR amplification, and 10 times the Ct value differs less than 0.5 circulation.

Detected result shows that detection architecture of the present invention can accurately detect plasmid and detect EML4-ALK fusion sudden change, and the sensitivity of detection can reach the 5-10 copy.

Embodiment 2

Utilization the present invention detects clinical sample, fetches and delivers my company clinical lung cancer paraffin-embedded tissue sample 110 examples to be detected, the male sex's 65 examples, and women's 45 examples, the age is 34-75 year, the mean age is 54 years old, The median age 50 years old.It is following to utilize special primer of the present invention and fluorescence probe PCR system to detect the gene fusion sudden change step of EML4-ALK of 110 routine clinical samples:

(1) extraction of sample process and RNA:

(a) get above-mentioned each lung cancer sample, add 1ml YLENE respectively, mixing, the centrifugal 2min of 14000RPM under the room temperature; Abandon supernatant, add the 1ml absolute ethyl alcohol in deposition, concussion mixing (removal YLENE); The centrifugal 2min of 14000RPM abandons supernatant under the room temperature, opens the centrifuge tube lid, and 37 ℃ are dried;

(b) in centrifuge tube, add 150 μ l Buffer PKD and 10 μ l Proteinase Ks, the concussion mixing is hatched 15min for 56 ℃; Hatch 15min for 80 ℃; After waiting to drop to room temperature, add 16ul DNase Booster Buffer and 10ul DNaseI stoste, incubated at room 15min; The back adds 320 μ l Buffer RBC, mixing;

(c) add 720 μ l absolute ethyl alcohols toward supernatant; Mixing; Get the deposition that 700 μ l samples comprise that the front generates and transfer in the centrifugal post of RNA MinElute that has the 2ml collection tube, greater than 10, the centrifugal 15s of 000rpm; Abandon waste liquid, repeat one and go on foot up to sample transfer in the centrifugal post of RNA MinElute.

(d) uncap adds 500 μ l Buffer RPE, covers tight lid, greater than the centrifugal 2min of 10000rpm, posts transfer in collection tube, is dripped 14-30 μ l RNase-free water to the adsorption film middle part, collects RNA. behind the centrifugal 1min

(2) set up the pcr amplification reaction system:

With put on and state RNA and be dissolved in the 0.1%DEPC water, extract quality through UV spectrophotometer measuring, confirm that its concentration OD260/OD280 is 1.9-2.1, and read its content.The RNA that gets 0.1～5 μ g adopts the synthetic cDNA of test kit of Xiamen Amoydx Bio-Pharmaceutical Technology Co., Ltd. as its cDNA synthetic template, and the cDNA synthetic system is following:

Use above-mentioned reverse transcription system and carry out rt as follows:

(a) get reverse transcription reaction mixed solution 18 μ l, M-MLV reversed transcriptive enzyme 1 μ l adds in the aseptic centrifuge tube mixing.

(b) add testing sample RNA 6 μ l, the RNA total amount in 0.1～5 μ g scope, moisturizing to 25 μ l.

(c) 42 ℃ are incubated 1 hour.

(d) 95 ℃ the insulation 5 minutes after cooled on ice, obtain the cDNA template..

With above-mentioned gained cDNA template,, carry out pcr amplification according to following amplification system as the template of real-time fluorescence PCR amplification:

The real-time PCR reactions condition is 95 ℃ of preparatory sex change 5 minutes, 1 circulation; 95 ℃ of sex change 25 seconds, 64 ℃ of annealing 20 seconds, 72 ℃ were extended 15 circulations 20 seconds; 93 ℃ of sex change 25 seconds, 60 ℃ of annealing 35 seconds, 72 ℃ were extended 31 circulations 20 seconds.When circulating in annealing, 31 of backs detect FAM and HEX or ROX fluorescent signal.

(4) detect fluorescent signal, the standard of as a result of judging according to the Ct value:

Detect FAM fluorescent signal Ct value; Ct value judged result according to the demonstration of fluorescent PCR amplification appearance: the FAM fluorescence intensity of detection reaction system; Needed cycle index Ct value is as yin and yang attribute criterion when reaching preset threshold with FAM, and the Ct value is more than or equal to 30: feminine gender; The Ct value is less than 30: the positive

Detected result show detect and have 8 examples to have EML4-ALK merge to suddenly change in the 110 routine lung cancer samples; Mutation rate is 7.2%; Simultaneously above-mentioned all samples are carried out the FISH comparison and detection, FISH result shows that it is 100% that sudden change has 8 examples, the coincidence rate of two kinds of detection methods; Further proved the accuracy that system of the present invention detects, the result sees table 4.

Table 2EML4-ALK gene merges sudden change for 9 kinds

Table 3EML4-ALK gene merges each pipe of sudden change PCR reaction for 9 kinds and detects catastrophe point

Table 4 clinical sample detected result relatively

Claims (6)

1. be used to detect primer, the probe of the sudden change of EML4-ALK fusion gene, it is characterized in that, comprise following sequence: SEQ IDNO 1-SEQ ID NO 24.

2. be used to detect the test kit of EML4-ALK fusion gene sudden change, it is characterized in that, comprise the primer and the probe of following sequence: SEQ ID NO 1-SEQ ID NO 24.

3. the detection kit that is used to detect the sudden change of EML4-ALK fusion gene as claimed in claim 2 is characterized in that: the reaction system that comprises following fluorescent PCR:

。

4. the detection kit of detection EML4-ALK fusion gene as claimed in claim 3 sudden change, its method of use may further comprise the steps:

(1) extracts the RNA that detects in the sample, detect sample and comprise the RNA in fresh pathological tissue, paraffin-embedded tissue or the pleural fluid tissue;

(2) RNA reverse transcription cDNA, preparation real-time fluorescence PCR amplification reaction system;

(3) the Ct value that shows according to fluorescent PCR amplification appearance is judged detected result: the FAM of detection reaction system and HEX fluorescence intensity, and needed cycle index Ct value is as yin and yang attribute criterion when reaching preset threshold with FAM, and the Ct value is more than or equal to 30: feminine gender; The Ct value is less than 30: the positive.

5. the detection kit of detection EML4-ALK fusion gene as claimed in claim 4 sudden change is characterized in that the reaction system of mRNA reverse transcription cDNA is:

。

6. the detection kit of detection EML4-ALK fusion gene as claimed in claim 4 sudden change is characterized in that RNA reverse transcription cDNA comprises following operation steps:

(a) get reverse transcription reaction mixed solution 18 μ l, M-MLV reversed transcriptive enzyme 1 μ l adds in the aseptic centrifuge tube mixing.

(b) add testing sample RNA6 μ l, the RNA total amount in 0.1～5 μ g scope, moisturizing to 25 μ l.

(c) 42 ℃ are incubated 1 hour.

(d) 95 ℃ the insulation 5 minutes after cooled on ice, obtain the cDNA template.

Images