CN110982903A

CN110982903A - Kit and method for multiplex detection of ALK gene mutation

Info

Publication number: CN110982903A
Application number: CN201911402343.XA
Authority: CN
Inventors: 蒋析文; 邓洁; 朱小亚; 黄志文; 钟灵秀
Original assignee: Daan Gene Co Ltd of Sun Yat Sen University
Current assignee: Daan Gene Co Ltd of Sun Yat Sen University
Priority date: 2019-12-31
Filing date: 2019-12-31
Publication date: 2020-04-10

Abstract

The invention provides a kit and a method for multiple detection of ALK fusion gene mutation, and particularly discloses a primer and a probe for multiple detection of ALK fusion gene mutation and a kit comprising a primer-probe mixed solution, wherein 7 ALK fusion gene mutation types can be detected simultaneously.

Description

Kit and method for multiplex detection of ALK gene mutation

Technical Field

The invention belongs to the field of biotechnology and tumor diagnosis, and particularly relates to a kit and a method for multiple detection of ALK gene mutation.

Background

Lung cancer is one of the most common malignancies with the highest incidence and mortality, with the number of non-small cell lung cancers (NSCLC) accounting for approximately 85% of all lung cancer patients and 5-year survival rate of advanced non-small cell lung cancer patients of approximately 15%. With the development of technology, genetic mutation occurring in tumors is more and more emphasized by people, and non-small cell lung cancer has high heterogeneity, so that clinical manifestations and therapeutic effects of the non-small cell lung cancer are extremely diversified.

The incidence of ALK fusion gene mutations in lung cancer patients is about 3% to 7%. The ALK fusion gene mutation means that ALK gene (anaplastic lymphoma kinase) is fused with genes such as echinoderm microtubular associated protein 4(echinoderm microtubular associated protein-like4, EML 4). Currently, multiple ALK gene fusion gene mutations have been found, such as fusions with KIF5B, TFG, KLC1, PTPN3, HIP1, and TPR genes, with EML4-ALK fusions accounting for approximately 81% of all ALK fusion gene mutations. The NCCN clinical practice guideline for non-small cell lung cancer and the CSCO diagnosis and treatment guideline for primary lung cancer recommend that ALK gene detection is carried out on non-small cell lung cancer (NSCLC) patients containing adenocarcinoma components. NSCLC patients carrying ALK gene fusions can be clinically treated with Crizotinib (Crizotinib), Ceritinib (Ceritinib), and Alectinib.

The detection method commonly used for the gene mutation at present comprises the following steps: fluorescence in situ hybridization, fluorescence PCR, immunohistochemistry, high throughput sequencing, etc.

(1) Fluorescence In Situ Hybridization (FISH): FISH is a gold standard for detecting gene fusions. The fluorescence probe labeling method of FISH includes a plurality of methods, including a nick translation method, a random primer method, an amino compound labeling method, and the like, and the nick translation method is most used at present. However, FISH has the defects of high requirements on operation and interpretation technology, long time consumption and the like, and is influenced by enzyme dosage and enzyme digestion preference, and the labeling efficiency of different templates is different, so that the labeled probe has insufficient accuracy in detecting gene fusion.

(2) Fluorescence PCR method: the currently common gene mutation detection method has high detection sensitivity, can detect mutant genes with the content as low as 1 percent in a sample, greatly shortens the length of a target product, and can solve the problem of nucleic acid fragmentation extracted from paraffin-embedded tissue samples, thereby obtaining more accurate detection results. The fluorescent PCR method is simple to operate and can greatly avoid the pollution of amplification products. However, this method is mostly used for detecting single base mutation, deletion and insertion, and since there are many fusion sites and it is difficult to design and cover all mutations simultaneously when detecting gene fusion, the fluorescence PCR method has many advantages, but it is rarely applied to the detection of multiple gene fusion mutations.

(3) Immunohistochemistry (IHC): the combination between antigen and antibody has high specificity, and the IHC can be used for positioning and relatively quantitatively detecting the target protein in pathological tissues. IHC has the advantages of low price, mature operation method and the like, but has the defects of complicated operation process, low sensitivity, poor repeatability and the like.

(4) High throughput sequencing: the high-throughput sequencing method is expensive, the reading length is about 30-250bp, the burden is caused to sequence splicing, the detection result still needs to be verified, and the accuracy of detecting small fragment deletion of the exon-intron junction region is not enough. The high-throughput sequencing method is complicated to operate and limits the sequencing speed.

Therefore, the development of a technology capable of effectively detecting the ALK fusion gene mutation of a tumor patient is urgently needed in the field so as to meet the requirements of clinical accuracy, rapidness and low cost.

Disclosure of Invention

The invention aims to provide a kit and a method for multiplex detection of ALK fusion gene mutation.

In a first aspect of the present invention, there is provided a set of primer pairs for multiplex detection of ALK fusion gene mutations, the set of primer pairs comprising:

a forward primer as shown in SEQ ID No. 1; and, a reverse primer as set forth in SEQ ID No. 6.

In another preferred embodiment, the primer pair set further includes:

a forward primer shown in SEQ ID No. 2; and/or the presence of a gas in the gas,

a forward primer shown in SEQ ID No. 3; and/or the presence of a gas in the gas,

a forward primer shown in SEQ ID No. 4; and/or the presence of a gas in the gas,

the forward primer shown in SEQ ID No. 5.

In another preferred embodiment, the primer pair set further includes:

a reverse primer as shown in SEQ ID No. 7.

In another preferred embodiment, the primer pair set includes: forward primers as shown in SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, and SEQ ID No. 5; and a reverse primer as shown in SEQ ID No. 6.

In another preferred embodiment, the primer pair set includes: forward primers as shown in SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, and SEQ ID No. 5; and, reverse primers as set forth in SEQ ID No. 6, and SEQ ID No. 7.

In another preferred embodiment, the primer pair set further comprises (internal standard):

a forward primer as set forth in SEQ ID No. 10; and, a reverse primer as set forth in SEQ ID No. 11.

In a second aspect of the invention, the invention provides a probe set for multiplex detection of ALK fusion gene mutation, which comprises a first mutation probe with a nucleotide sequence shown in SEQ ID No. 8 and/or a second mutation probe with a nucleotide sequence shown in SEQ ID No. 9.

In another preferred embodiment, the probe set further comprises an internal control probe with the nucleotide sequence shown in SEQ ID No. 12.

In another preferred embodiment, the 5' end of the mutation probe comprises a fluorescent reporter group; and/or, the 3' end of the mutation probe comprises a fluorescence quenching group.

In another preferred embodiment, the 5' end of the internal control probe comprises a fluorescent reporter group; and/or the 3' end of the internal control probe contains a fluorescence quenching group.

In another preferred embodiment, the mutation probe-labeled fluorescent reporter group is different from the internal control probe-labeled fluorescent reporter group.

In a third aspect of the invention, a kit for multiplex detection of ALK fusion gene mutation is provided, and the kit comprises the primer pair set of the first aspect of the invention.

In another preferred embodiment, the kit further comprises a set of probes according to the second aspect of the invention.

In another preferred example, the kit comprises a first container, wherein a primer probe mixture is contained in the first container, and the primer probe mixture contains a polynucleotide sequence shown in SEQ ID NO. 1-12.

In another preferred embodiment, the primer probe mixture is prepared using a Buffer for PCR (Buffer).

In another preferred embodiment, the kit further comprises a second container comprising an rnase system comprising reverse transcriptase, a hot start enzyme, an rnase inhibitor, and dNTPs.

In another preferred embodiment, the kit further comprises a third container, and the third container contains a positive quality control product.

In another preferred embodiment, the kit further comprises a fourth container, and the fourth container contains a negative quality control product.

In a fourth aspect of the present invention, there is provided a method for multiplex detection of ALK fusion gene mutations, the method comprising the steps of:

(1) providing a total nucleic acid sample of an object to be detected;

(2) preparing a PCR reaction system and carrying out PCR detection:

wherein, the PCR reaction system comprises: the total nucleic acid sample provided in step (1), the set of primer pairs according to the first aspect of the invention, and the set of probes according to the second aspect of the invention.

In another preferred example, the PCR reaction system includes the total nucleic acid sample provided in step (1) and a primer probe mixture, wherein the primer probe mixture includes a polynucleotide sequence shown in SEQ ID No. 1-12.

In another preferred example, the total nucleic acid can be from paraffin-embedded tissue, fresh tissue.

In another preferred embodiment, the method is a detection method for non-diagnostic purposes.

In another preferred embodiment, the PCR reaction system further comprises a positive quality control substance, and/or a negative quality control substance.

In another preferred embodiment, the PCR reaction system further comprises an rnase system; and/or a buffer for PCR.

In a fifth aspect of the invention, the use of the primer pair set of the first aspect of the invention and/or the probe set of the second aspect of the invention is provided for preparing a PCR detection kit for detecting ALK fusion gene mutation.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.

Drawings

FIG. 1 is a diagram showing the detection sensitivity of ALK fusion gene mutation;

FIG. 2 example 3 shows a typical positive test result of a clinical specimen 1;

FIG. 3 example 3 shows a typical positive test result of a clinical specimen 2;

FIG. 4 is a schematic diagram showing the results of the control common downstream primer 1;

FIG. 5 is a schematic representation of the results for control common downstream primer 2;

FIG. 6 shows the results of the control common downstream primer 3.

Detailed Description

The invention obtains a kit and a method for multiplex detection of ALK fusion gene mutation through extensive and intensive research, can simultaneously detect 7 mutation types of ALK fusion gene, and has the advantages of simple detection process, more detectable mutation types, high sensitivity, small sample dependence and the like.

The invention provides a primer, a probe, a kit and a primer distribution mode for detecting multiple lung cancer ALK fusion gene mutation with high specificity and high sensitivity. The invention uses the fresh tissue sample and the paraffin embedded tissue sample to carry out the detection of the gene fusion through the fluorescence detection technology, has the advantages of convenient material taking, high specificity, high sensitivity, good repeatability of the detection result, quick and simple operation and the like, can detect 7 hot point mutations of the lung cancer ALK fusion gene mutation at one time, greatly shortens the detection time, improves the sensitivity and the accuracy, and provides a reliable and convenient detection method.

Before the present invention is described, it is to be understood that this invention is not limited to the particular methodology and experimental conditions described, as such methodologies and conditions may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. As used herein, the term "about" when used in reference to a specifically recited value means that the value may vary by no more than 1% from the recited value. For example, as used herein, the expression "about 100" includes 99 and 101 and all values in between (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now exemplified.

Multiplex PCR

Multiplex PCR (multiplex PCR), also called multiplex PCR or multiplex PCR, is a PCR reaction in which two or more pairs of primers are added to the same PCR reaction system to simultaneously amplify multiple nucleic acid fragments, and the reaction principle, reaction reagents and operation process are the same as those of ordinary PCR.

There are many factors that affect multiplex PCR reactions, such as:

(1) the imbalance of the reaction system causes some dominant primers and templates thereof to be rapidly amplified in the previous rounds of reactions, and a large amount of amplification products are obtained, and the amplification products are good inhibitors of DNA polymerase. Therefore, the polymerization ability of polymerase is more and more strongly inhibited with the occurrence of a large amount of amplification products, and thus, primers and templates thereof which are at a disadvantage in the early stage are more difficult to react, and finally, the amount of amplification products is so small that they cannot be detected.

(2) The primer specificity, if the primer has stronger binding force with other non-target gene fragments in the system, the ability of the target gene to bind the primer is contended, thereby leading to the reduction of the amplification efficiency.

(3) The optimal annealing temperatures are different, a plurality of pairs of primers are placed in a system for amplification, and the optimal annealing temperatures of each pair of primers are required to be close to each other because the annealing temperatures for PCR reaction are the same.

(4) Primer dimers, including dimers between primers and hairpin structures formed by the primers themselves, are third-party DNA-mediated dimers, and these dimers, like non-specific primers, interfere with the competition between primers and target binding sites, affecting amplification efficiency.

Although several factors affecting amplification efficiency are mentioned above, more are not clear. To date, there is no effective method for clearly predicting amplification efficiency.

The invention aims to provide a PCR detection kit capable of detecting 7 ALK fusion gene mutations. Consists of different mutation site detection reagents and internal control detection reagents. The gene mutation detection is indicated by FAM signals, and the internal control detection is indicated by VIC signals.

The fusion types detected by the kit are shown in table 1:

TABLE 1 information on all mutation types detected by the kit

The gene information is from a Cosmic database.

The kit is shown in tables 2 and 3 in detail, can detect 7 tumor hotspot gene mutations simultaneously, simplifies the operation, greatly shortens the detection time, and has guiding significance for the personalized treatment of the non-small cell lung cancer.

TABLE 2 kit composition

The sequences of primers and probes required by the kit are shown in Table 3:

TABLE 3 primers, probes and sequence Numbers

Preferably, the length of the primer and probe sequence is 18-30 bases; a fusion gene primer spanning fusion region sequence; the GC content is 40-60%, and the length of the amplification sequence is 100-350 bp; the Tm value is controlled at 50-60 ℃.

Preferably, the fluorescent group is any one or combination of FAM, HEX, NED, ROX, TET, JOE, TAMRA, CY3 and CY5, and is preferably FAM fluorescent group.

Preferably, the quenching group is selected from one or more of MGB, BHQ-1, BHQ-2, BHQ-3 and the like, and is preferably MGB quenching group.

In addition, in the development of the primer probe set, the inventors found that the primer probe set was directed against EML4Exon 14; the ALK Exon20 fusion gene mutation detection is difficult. In order to improve the detection sensitivity of the mutation, a reverse primer ALK-10-R2 and a probe ALK-10-P2 which are suitable for the multiple detection system are obtained through a large amount of screening, and finally, the detection sensitivity of the fusion gene is obviously improved.

And (2) screening the specific primers and the probes through a large number of tests, selecting 12 sequences (including the primers and the probes) from the primers and the probes, combining, optimizing and verifying the sequences, and finally optimizing the optimal detection combination for multiple detection, which cannot interfere with each other after combination, is high in amplification efficiency and good in specificity.

In the invention, the common upstream primer and downstream primer or probe are designed, and the minimum primer probe is used while a plurality of mutation sites are identified, so that the cost is saved.

The sequence combination comprises primers and probes required by detection of lung cancer multiple gene mutation regions, and can complete detection of 7 ALK gene fusion mutations at one time.

On the other hand, the kit provides a primer probe, a reaction system and a quality control product for detecting the lung cancer ALK gene fusion mutation:

TABLE 4 other Components of the kit

Preferably, the Buffer has a composition of 0.5-2mol/L Tris-Cl pH8.8, 0.5-3mol/L KCl, 0.1-1mol/L (NH4)₂SO₄、0.5-2mol/L MgCl₂10-20% Tween-20, most preferably 1mol/L Tris-Cl pH8.8, 1mol/L KCl, 0.5mol/L (NH4)₂SO₄、1mol/L MgCl₂、20％Tween-20。

Preferably, the RNase system consists of reverse transcriptase 2-40U/. mu.L, hot start enzyme 5-40U/. mu. L, RNA enzyme inhibitor 0.1-1. mu. L, dNTPs 5-25mM, most preferably reverse transcriptase 20U/. mu.L, hot start enzyme 15U/. mu. L, RNA enzyme inhibitor 0.5. mu. L, dNTPs 15 mM.

The kit provided by the invention is used for judging the effective detection standard as follows:

and (3) detecting the negative quality control material and the positive quality control material simultaneously in each detection, and when the positive quality control material and the negative quality control material in the detection result are positive and negative, indicating that the experimental result is effective.

The use method of the kit comprises the following steps:

(1) extracting total nucleic acid in the detection sample, including 2-100 ng/. mu.L total nucleic acid in samples of fresh pathological tissues, paraffin-embedded tissues and the like.

(2) Adding the enzyme system into a PCR reaction tube, and sequentially adding a negative quality control product, a detection sample nucleic acid and a positive quality control product.

(3) Real-time fluorescent PCR reaction, the procedure was as follows:

the first stage is as follows: 2-15min at 50 ℃, 10-15min at 95 ℃, 1 cycle;

and a second stage: at 94 ℃ for 10-15s, at 55-60 ℃ for 45s, and for 45 cycles;

and (3) judging the detection result by combining the Ct value and the fluorescence curve according to the highest fluorescence value 1/20 of the positive quality control signal displayed by the real-time fluorescent PCR amplification instrument as a threshold line.

Preferably, the detection result is judged only by Ct and the fluorescence curve, thereby simplifying the judgment method.

The invention has the beneficial effects that:

(1) the invention is suitable for various sample types such as fresh tissues, paraffin embedded tissues and the like, and adopts total nucleic acid as a detection sample, so that the method is simpler, more convenient and faster and is easy to operate.

(2) The reagent adopts pre-divided single tube single person, the operation is simple, and the detection can be carried out by directly adding the enzyme system and the sample.

(3) By adopting a specific primer and a novel probe technology and a double-fluorescence channel detection mode, the internal control gene is set to detect the VIC signal, so that the quality of the sample nucleic acid can be monitored while the fusion mutation is detected, and the judgment accuracy is improved.

(4) And a common downstream primer and a common probe are designed, so that the number of the primers and the probes is reduced while the same number of mutation sites are identified, and the cost is effectively saved.

(5) And the 7 ALK fusion gene mutations are detected simultaneously, and the detection can be completed in only 110 minutes, so that the operation is easy, and the detection time is effectively shortened.

(6) The specificity is strong, and 100 ng/. mu.L wild nucleic acid can not generate non-specific signals.

(7) The sensitivity is high, and the fusion gene with 10 copies/. mu.L in 100 ng/. mu.L can be detected.

(8) The determination method is simple and convenient, the detection result is determined by combining the Ct value and the fluorescence curve according to the highest fluorescence value 1/20 of the positive quality control product displayed by the real-time fluorescent PCR amplification instrument as a threshold line, and the determination method is easy to understand and determine.

The invention is suitable for detecting 7 ALK fusion gene mutation sites of tumor patients, is a feasible way for exploring the high-efficiency treatment of the non-small cell lung cancer, and is worthy of popularization and application. In addition, the method of the present invention is also applicable to non-diagnostic purposes, for example, in the development process of new drugs, gene mutation information used as an intermediate result is obtained by using the detection method of the present invention, and the gene mutation information can be used as the requirement of public health management, and can also be used for the research of ALK fusion gene mutation and the development of targeted new drugs.

The present invention will be described in further detail with reference to the following examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures for conditions not specified in detail in the following examples are generally carried out under conventional conditions such as those described in molecular cloning, A laboratory Manual (Huang Petang et al, Beijing: scientific Press, 2002) by Sambrook. J, USA, or under conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are by weight. The test materials and reagents used in the following examples are commercially available without specific reference.

Example 1

The invention provides a method, a primer, a probe and a kit for detecting multiple gene fusion of lung cancer. The specific implementation steps are as follows:

(1) extraction of nucleic acid template from sample to be tested

Nucleic acid extraction or purification reagent (Yuejiu apparatus 20170666) from Daan Gen Ltd, Zhongshan university, nucleic acid was extracted according to the kit instructions. The nucleic acid after tissue sample extraction is diluted to the concentration of 2-100 ng/mu L, and the purity of the nucleic acid is satisfied with A₂₆₀/A₂₈₀The ratio ranges between 1.7 and 2.3. The template can be directly used for subsequent experiments or stored at-80 ℃ for later use, and repeated freeze thawing is avoided.

(2) Sample application

Add RNase system 3. mu.L into PCR reaction tube. And (5) performing instantaneous centrifugation for 15 s.

And (3) respectively taking 5 mu L of negative quality control material, the sample nucleic acid template prepared in the step (1) and the positive quality control material, and sequentially adding the negative quality control material, the sample nucleic acid template and the positive quality control material into the reaction tube according to the sequence shown in the table 5. And (3) tightly covering the tube cover of the PCR reaction tube, fully mixing uniformly, and performing instantaneous centrifugation for 10 s.

TABLE 5 fluorescent PCR sample addition layout

Numbering

A

B

C

D

E

F

G

H

1

Yin control

Sample 1

Sample 2

Sample 3

Sample 4

Sample 5

Sample 6

Yang control

Note: negative control is negative quality control product; quality control product with positive control

(3) Real-time fluorescent PCR amplification:

and setting a real-time fluorescent PCR amplification instrument to simultaneously detect the FAM signal and the VIC signal.

The real-time fluorescent PCR reaction procedure was as follows:

the first stage is as follows: 2-15min at 50 ℃, 10-15min at 95 ℃, 1 cycle;

the effective standard of the kit for judging and detecting is as follows: and (3) detecting the negative quality control material and the positive quality control material simultaneously in each detection, and when the positive quality control material and the negative quality control material in the detection result are positive and negative, indicating that the experimental result is effective. Each tube of VIC channel has an obvious fluorescence amplification curve, the highest fluorescence value 1/20 of the positive quality control VIC signal is used as a threshold line, and the Ct value is less than 38, which indicates that the quality of the nucleic acid template is good.

Adjusting Baseline Start Cycle 3 and End Cycle 15 according to the highest fluorescence value 1/20 of the positive quality control product FAM signal displayed by the real-time fluorescent PCR amplification instrument as a threshold line, and judging a result by combining the Ct value and a fluorescence curve:

if the Ct value is less than 37 and an obvious fluorescence amplification curve exists, the result is judged to be positive;

and b, judging the sample to be negative if the Ct value is greater than or equal to 37 or no obvious fluorescence amplification curve exists.

The components and packages of the multiplex ALK fusion gene detection kit provided in this example are shown in table 6:

TABLE 6 composition, packaging and quantity of the kit

Example 2 detection of sensitivity and accuracy

The sensitivity reference substance with the total nucleic acid concentration of 100 ng/. mu.L is prepared by mixing gene locus plasmid or cell strain to be detected and wild cell strain nucleic acid according to a certain proportion respectively, wherein the 100 ng/. mu.L mixed solution contains 10 copies/. mu.L fusion gene.

(1) Sample application

mu.L of negative quality control material, sensitivity reference material (100 ng/. mu.L total nucleic acid contains 10 copies/. mu.L fusion gene), and positive quality control material were added to the reaction tube in sequence according to the sequence in Table 5. And (3) tightly covering the tube cover of the PCR reaction tube, fully mixing uniformly, and performing instantaneous centrifugation for 10 s.

For each sensitivity reference, 5 replicates were tested.

(2) Real-time fluorescent PCR amplification:

The real-time fluorescent PCR reaction procedure was as follows:

the first stage is as follows: 2-15min at 50 ℃, 10-15min at 95 ℃, 1 cycle;

judging the detection result:

a. each tube of VIC channel has an obvious fluorescence amplification curve, the highest fluorescence value 1/20 of the positive quality control VIC signal is used as a threshold line, and the Ct value is less than 38, which indicates that the quality of the nucleic acid template is good.

b. And adjusting the Baseline Start Cycle 3 and End Cycle 15 according to the highest fluorescence value 1/20 of the positive quality control product FAM signal displayed by the real-time fluorescent PCR amplification instrument as a threshold line, and judging the result by combining the Ct value and the fluorescence curve. The coincidence rate of the five detection results is 100%.

The detection result shows that the detection system can accurately detect the fusion gene mutation of 10 copies/. mu.L in the nucleic acid concentration of 100 ng/. mu.L at one time.

Example 3 clinical sample testing

Extraction of nucleic acid of a detection sample:

(1) clinical sample nucleic acid template extraction to be detected

100 clinical negative samples were collected, and known variant 1(EML 4Exon 13; ALK Exon20) and variant2(EML 4Exon 20; ALK Exon 20); variant 3a/b (EML 4Exon 20; ALK Exon 20); variant4(EML 4Exon 20; ALK Exon 20); clinical samples of variant 5a/b (EML 4Exon 20; ALK Exon20) mutation are randomly mixed into a nucleic acid extraction or purification reagent (tissue sample can use Yuejai instrument No. 20170666) of Daan Gen Ltd of Zhongshan university), nucleic acid extraction is carried out according to a kit instruction, the nucleic acid after the tissue sample is extracted is diluted to the concentration of 2-100 ng/mu L, and the purity of the nucleic acid is required to meet A₂₆₀/A₂₈₀The ratio ranges between 1.7 and 2.3. The template can be directly used for subsequent experiments or stored at-80 ℃ for later use, and repeated freeze thawing is avoided.

(2) Sample application

Taking 3 mu L of RNase system and adding the RNase system into the PCR reaction tube in sequence. And (5) performing instantaneous centrifugation for 15 s.

(3) Real-time fluorescent PCR amplification

The real-time fluorescent PCR reaction procedure was as follows:

the first stage is as follows: 2-15min at 50 ℃, 10-15min at 95 ℃, 1 cycle;

among 107 clinical specimens tested (7 clinical specimens containing known ALK fusion gene mutations), 7 mutations were detected in total, and typical positive examples are shown in fig. 2-3.

The result shows that the coincidence rate of the detection system reaches 100 percent, and the detection accuracy of the system is further proved.

The kit has the advantages of convenient material taking, high specificity, high sensitivity and high accuracy, and can meet the requirement of rapid detection of the lung cancer gene.

Comparative example 1

In the research process, the inventor screens dozens of pairs of PCR common primers aiming at target sequences of mutation sites. These primers often have problems such as poor specificity or low amplification efficiency. Through multiple rounds of screening, the primer and probe combination with sensitivity and specificity capable of meeting the clinical detection requirements is screened finally.

For example, for the 7 ALK fusion gene mutation sites of the present invention, the inventors designed partial typical primer sequences as follows:

control common downstream primer 1: ACCTCCTTCAGGTCAC (SEQ ID NO: 13).

Control common downstream primer 2: CAGGTCACTGATGGAGGA (SEQ ID NO: 14).

The specific detection steps, detection conditions and probe sequences are the same as those in the above embodiments, and detection tests are performed by respectively combining the upstream primer pair and the probe.

The detection result using the control common downstream primer 1 is shown in FIG. 4, and the detection result shows that the primer pair has poor specificity. The detection result using the control common downstream primer 2 is shown in FIG. 5, and the detection result shows that the amplification efficiency of the primer pair is low.

Moreover, in the experiment, partial primers can only detect fresh tissue samples, and paraffin-embedded tissue samples cannot be detected.

control common downstream primer 3: GCTTGTACTCAGGGCTCTGC (SEQ ID NO. 15).

The results of the test using the control common downstream primer 3 are shown in FIG. 6, and show that the primer pair can detect fresh tissue samples, but the V5b site (variant5b) is missed when detecting the total nucleic acid of paraffin-embedded tissue samples at low concentration.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> Daan Gen-Shaw Co Ltd of Zhongshan university

<120> kit and method for multiplex detection of ALK gene mutation

<130>000052

<160>15

<170>SIPOSequenceListing 1.0

<210>1

<211>22

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>1

tcttactgga gactcaggtg ga 22

<210>2

<211>20

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>2

ggtccccaga caacaagtat 20

<210>3

<211>22

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>3

tgatagccgt aataaattgt cg 22

<210>4

<211>22

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>4

ctttgtcaga tgagaaatgg ga 22

<210>5

<211>18

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>5

actgtgctaa aggcggct 18

<210>6

<211>20

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>6

ggtcactgat ggaggaggtc 20

<210>7

<211>20

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>7

agttggggtt gtagtcggtc 20

<210>8

<211>20

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>8

gcagagccct gagtacaagc 20

<210>9

<211>21

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>9

cctgagtaca agctgagcaa g 21

<210>10

<211>20

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>10

ctttccgtac cagccactac 20

<210>11

<211>19

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>11

ggtggttctt gtccctacg 19

<210>12

<211>20

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>12

tgtgaccgct atgggattgt 20

<210>13

<211>16

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>13

acctccttca ggtcac 16

<210>14

<211>18

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>14

caggtcactg atggagga 18

<210>15

<211>20

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>15

gcttgtactc agggctctgc 20

Claims

1. A primer set for multiplex detection of ALK fusion gene mutations, comprising:

2. The set of primer pairs of claim 1, further comprising:

the forward primer shown in SEQ ID No. 5.

3. The set of primer pairs of claim 1, further comprising:

a reverse primer as shown in SEQ ID No. 7.

4. The set of primer pairs of claim 1, wherein the set of primer pairs comprises: a forward primer as shown in SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4 and SEQ ID No. 5; and a reverse primer as shown in SEQ ID No. 6.

5. The set of primer pairs of claim 1, wherein the set of primer pairs comprises: a forward primer as shown in SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4 and SEQ ID No. 5; and reverse primers as shown in SEQ ID No. 6 and SEQ ID No. 7.

6. The set of primer pairs of claim 1, further comprising (internal standard):

7. A probe set for multiplex detection of ALK fusion gene mutation is characterized by comprising a first mutation probe with a nucleotide sequence shown in SEQ ID No. 8 and/or a second mutation probe with a nucleotide sequence shown in SEQ ID No. 9.

8. A kit for multiplex detection of ALK fusion gene mutations, comprising the primer set of claim 1.

9. A method for multiplex detection of ALK fusion gene mutations, comprising the steps of:

(1) providing a total nucleic acid sample of an object to be detected;

(2) preparing a PCR reaction system and carrying out PCR detection:

wherein, the PCR reaction system comprises: the total nucleic acid gene sample provided in step (1), the set of primer pairs of claim 1, and the set of probes of claim 2.

10. Use of the set of primer pairs of claim 1, and/or the set of probes of claim 2, for the preparation of a PCR detection kit for the detection of ALK fusion gene mutations.