CN107446990A - A kind of method and its application of quick Non-invasive detection EML4 ALK fusion genes - Google Patents
A kind of method and its application of quick Non-invasive detection EML4 ALK fusion genes Download PDFInfo
- Publication number
- CN107446990A CN107446990A CN201610377728.5A CN201610377728A CN107446990A CN 107446990 A CN107446990 A CN 107446990A CN 201610377728 A CN201610377728 A CN 201610377728A CN 107446990 A CN107446990 A CN 107446990A
- Authority
- CN
- China
- Prior art keywords
- eml4
- seq
- pcr
- alk
- indicates
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Physics & Mathematics (AREA)
- Pathology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a kind of primer sets, the primer sets include the primer shown in SEQ ID NO.1 8.Present invention also offers purposes of the primer sets as described above in the product of diagnosing tumour is prepared.Present invention also offers a kind of kit for diagnosing tumour.Present invention also offers a kind of method of detection EML4 ALK fusion genes.Pass through above-mentioned technical proposal, the present invention more easily can carry out non-invasive diagnosis to tumour, and considerably improve the Sensitivity and Specificity of diagnosing tumor.
Description
Technical field
The present invention relates to biomedicine field, in particular it relates to which a kind of be used for quick Non-invasive detection EML4-ALK fusion bases
Primer sets, kit, the method and its application of cause.
Background technology
Lung cancer is most common malignant tumour, and morbidity and mortality occupy the first place of malignant tumour.In the past 50 years, the world is each
Particularly industrially developed country of state, the morbidity and mortality of lung cancer substantially increase, and male lung cancer morbidity and mortality are equal
First of all malignant tumours is accounted for, the women incidence of disease accounts for second, and the death rate accounts for second.The cause of disease of lung cancer is still endless so far
Complete clear and definite, Medical Statistics shows that the pathogenic factor of lung cancer is mainly smoking, 80% male lung cancer and 75% female lung cancer
Be as caused by smoking, in addition with the contact of the industrial cancerogen such as ionising radiation, polycyclic aromatic compound, nickel, chromium, arsenic, kind
Race, family members' history have an impact to lung cancer.
Lung cancer is divided into non-small cell lung cancer (Non-small cell lung cancer, NSCLC) and ED-SCLC
(Small cell lung cancer, SCLC), NSCLC include squamous carcinoma, gland cancer, adenosquamous carcinoma, large cell carcinoma, class cancer etc., account for lung
The 85% of cancer.NSCLC treatment includes a variety of methods such as operation, chemotherapy, radiotherapy, molecular targeted therapy and biological immune treatment.
About 70% has belonged to late period during lung cancer initial diagnosis, and prognosis is poor.The primary treatments of advanced lung cancer are systemic chemotherapy and targeting
Treatment, and fractionated radiation treatments.Targeted therapy with its meet physiology, low toxicity and it is efficient in theory the characteristics of, it has also become most by
One of concern and most promising treatment means.Different from chemotherapy, the tumor tissues of targeted therapy patient must carry certain spy
Different gene or albumen (being referred to as target spot), and the growth relationship of this species specific target spot and lung cancer is close.
ALK is a kind of anaplastic lymphoma kinase (Anaplastic lymphoma kinase, ALK), is found within 2007
Because chromosome inversion forms (the Echinoderm microtubule- of echinoderm micro-pipe correlation albuminoid 4 in patients with lung cancer
Associated protein-like 4, EML4) gene merges (EML4-ALK) with ALK gene, and ALK enzymes composing type is lived
Change, promote lung cancer to occur and be in progress.EML4-ALK fusions are likely to be present in a variety of solid tumors including lung cancer, but
In NSCLC recall rate highest, while because of it, mutation, K-ras mutation do not coexist phenomenon and contain EML4-ALK with EGFR
The distinct Clinical symptoms of fusion patient, it is the higher molecular marked compound of adenocarcinoma of lung specificity to prompt the target spot.EML4-ALK
The discovery of fusion (being called the ALK positives) defines a NSCLC new subtype, can be rated as in recent years one on NSCLC research histories
Individual landmark event.At present, 14 kinds of EML4-ALK variation hypotype has at least been found that.These variation hypotypes are EML4
20 extrons of different extrons and ALK blend.Hypotype 1 (V1), it is aobvious outside EML4 the 13rd extron and the 20th of ALK
Son is connected；Hypotype 2 (V2), it is connected for EML4 the 20th extron with ALK the 20th extron；Hypotype 3 (V3), there are two Asias sub-
Type (V3a/b), the 6th extron that V3a is EML4 are connected with ALK the 20th extron, and the 6th extron that V3b is EML4 adds
Upper 33bp small fragment is connected with ALK the 20th extron again；Hypotype 4 (V4), the 14th extron for being EML4 add one
20th extron of the individual 11bp small fragment again with above missing 49bp ALK is connected；Hypotype 5 (V5), there are two hypotypes
(V5a/b) exon 2 that, V5a is EML4 is connected with ALK the 20th extron, and the exon 2 that V3b is EML4 adds
One 117bp small fragment is connected with ALK the 20th extron again；Hypotype 6 (V6), the 13rd extron for being EML4 add one
49bp small fragment is connected with ALK the 20th extron again；Hypotype 7 (V7) is EML4 the 14th extron with above lacking
12bp ALK the 20th extron is connected；Hypotype 8 (" V4 "), the 15th Exon deletion for being EML4 below 19bp again with it is preceding
Face missing 20bp ALK the 20th extron is connected；Hypotype 9 (" V5 "), it is aobvious outside EML4 the 18th extron and the 20th of ALK
Son is connected.Most common fusion is hypotype 1, is secondly hypotype 3.All these fusions are respectively provided with biological function,
The product of expression is a kind of mosaic type TYR kinases, can activate catalysis region in the film of ALK gene, and activation coherent signal leads to
Road, promote cell propagation, survival, migration, reach the effect of cell carcinogenesis.
Since fusion is found, to find easier and more accurately method, it is a large amount of that researcher has done each side
Research.Detection method currently used for ALK fusion gene mainly has FISH (fluorescence in situ
Hybridization, FISH), immunohistochemistry (immunohistochemistry, IHC) and reverse transcriptase polymerase chain it is anti-
Answer (reverse transcriptase-polymerase chain reaction, RT-PCR) etc..
FISH is to be hybridized using the specific nucleic acid probe of fluorescence labeling with intracellular corresponding target DNA molecule or RNA molecule,
By observing fluorescence signal under fluorescence microscope or common focus point migration instrument, to determine with being colored after specific probe hybridization
Cell or organelle form and distribution, or be combined with fluorescence probe region of DNA domain or RNA molecule chromosome or its
Positioning in its organelle.By carrying out fluorescence labeling to EML4 genes and ALK gene, both are checked under fluorescence microscope
The position relationship of gene determines whether chromosome translocation, to determine whether EML4-ALK fusions.Although FISH is inspection
A kind of sensitive and special method of ALK fusion gene is surveyed, but FISH not can determine that ALK fusion hypotype, and its is expensive,
The fluorescence signal of separation is not easy to explain.
Similar to FISH, IHC is by antigen-antibody reaction and histochemical to be in tissue in situ with specific antibody
Colour response, corresponding antigens are carried out with a technology of qualitative, positioning and quantitative determination.IHC needs to cut one from FFPE tissue blocks
Undyed section is opened, as long as the tumor cell group at least containing some survivals.IHC can successfully detect various different tumour marks
This, including FNA cell blocks.IHC advantage is energy in situ detection destination protein, and can apply to puncture and cell sample, and
Relative low price.But simultaneously as sample tissue and the heterogeneity of biology, IHC are difficult to detect specific target sometimes
Molecule.
RT-PCR is a kind of very sensitive technology, can detect the RNA of very low copy number.Using surgery excision sample or its
His sample, RT-PCR is carried out after extracting total serum IgE, electrophoresis is carried out to PCR primer to determine whether containing EML4-ALK fusions.
By the way that various different subtypes are carried out with the design of special primer, the EML4-ALK fusion bases of various different subtypes can be told
Cause.The method needs the RNA of high quality, but DNA in paraffin section and RNA can gradually degrade in detection process, eventually shadow
The accuracy of testing result is rung, therefore, RT-PCR is more suitable for the genetic test of flesh tissue sample.
More than in addition to several conventional methods, also other various conventional or new methods.Including：western
Blot, RACE-coupled PCR, ImmunohistochemistryMethods Methods-iAEP (antibody-enhanced polymer) etc..But it is all this
What a little methods were carried out both for the tumor tissues after operation or biopsy extraction, materials should ensure that enough tumour cells,
Nonneoplastic tissue and cell are rejected as far as possible.There are many drawbacks in this, be that acquisition tumor tissues are invasive operations first, it is difficult to be used for
Routine inspection.For advanced tumor is not resistant to the patient of operation or biopsy, because tumor tissues progress can not be obtained
The detection of related gene, the effect of with regard to unpredictable medicine, also imply that the possibility for losing targeted therapy.Next to that gene
The change of state.With the use of medicine, the expression of body fusion or mutation status may change, so as to cause machine
Body changes to the sensitiveness of medicine.So during drug therapy, it should gene expression or mutation to tumour
Monitored in real time, adjust therapeutic scheme at any time.But in real work, repeatedly acquisition tumor tissues are extremely difficult, most
Patient is difficult the focus for finding desirable biopsy after tumor resection, even if there is focus, it is also difficult to enough tissues are obtained, thus not
This target can be realized.In a word, it is difficult that tumor tissues are obtained, are that current targeted drug treats the biggest obstacle faced.Therefore, such as
What simple non-invasively acquisition tumorgenesis material, serves targeted drug treatment and gradually attracts attention recently, and start to turn into heat
Point problem.
But at present in lesion detection approach, the defects of cumbersome and wound is larger be present, and be difficult to Gao Min
Sense, height specifically detect to all EML4-ALK fusions hypotypes.
The content of the invention
The purpose of the present invention is overcome in current lesion detection approach, the defects of cumbersome and wound is larger be present, and
And improve the Sensitivity and Specificity of diagnosing tumor.
To achieve these goals, on the one hand, the invention provides a kind of primer sets, the primer sets include SEQ ID
Primer shown in NO.1-8.
On the other hand, the purposes present invention also offers primer sets as described above in the product of diagnosing tumour is prepared.
Another further aspect, present invention also offers a kind of kit for diagnosing tumour, wherein, the kit is included as above
Described primer sets and PCR reagent.
Another further aspect, present invention also offers a kind of method of detection EML4-ALK fusions, wherein, this method includes
Following steps：
(1) the separation and Extraction excretion body from test serum, and extract the total serum IgE of excretion body；
(2) using the total serum IgE of excretion body as template, by reversing recording method to synthesize cDNA, then using drawing as described above
Thing group enters performing PCR reaction, obtains the material after PCR amplifications；
(3) electrophoresis result of the material after PCR amplifications is obtained, is contained if electrophoresis result is shown in the material after PCR amplifications
There is pcr amplification product, it indicates that contain EML4-ALK fusions in the test serum.
Another further aspect, present invention also offers a kind of method of diagnosing tumour, this method comprises the following steps：
(1) the separation and Extraction excretion body from from the test serum of subject, and extract the total serum IgE of excretion body；
(2) using the total serum IgE of excretion body as template, by reversing recording method to synthesize cDNA, then performing PCR is entered using primer sets
Reaction, obtain the material after PCR amplifications；
(3) electrophoresis result of the material after PCR amplifications is obtained, is contained if electrophoresis result is shown in the material after PCR amplifications
There is the pcr amplification product of EML4-ALK fusions, it indicates that the subject is tumor patient.
Pass through above-mentioned technical proposal, the present invention more easily can carry out non-invasive diagnosis to tumour, and significantly carry
The high Sensitivity and Specificity of diagnosing tumor.
Other features and advantages of the present invention will be described in detail in subsequent specific embodiment part.
Brief description of the drawings
Accompanying drawing is for providing a further understanding of the present invention, and a part for constitution instruction, with following tool
Body embodiment is used to explain the present invention together, but is not construed as limiting the invention.In the accompanying drawings：
Fig. 1 be the result of the suspected patient SABC of 53 non-small cell knurls in embodiment 1, tumor tissues PCR results,
The contrast of excretion body PCR results.
Fig. 2 is that numbering is that P8, P10, P17 and P23 subject contain EML4-ALK fusions hypotype 1 in embodiment 1
(V1) PCR electrophoresis results.
Fig. 3 is that numbering is that P8, P10, P17 and P23 subject contain EML4-ALK fusions hypotype 1 in embodiment 1
(V1) sequencing result.
Fig. 4 is the PCR electricity that the subject that numbering is L008 in embodiment 1 contains EML4-ALK fusions hypotype 2 (V2)
Swimming result.
Fig. 5 is the sequencing knot that the subject that numbering is L008 in embodiment 1 contains EML4-ALK fusions hypotype 2 (V2)
Fruit.
Fig. 6 is the PCR that the subject that numbering is L007 in embodiment 1 contains EML4-ALK fusions hypotype 3 (V3a/b)
Electrophoresis result.
Fig. 7 is the survey that the subject that numbering is L007 in embodiment 1 contains EML4-ALK fusions hypotype 3 (V3a/b)
Sequence result.
Fig. 8 is the PCR electrophoresis result figures of comparative example 1.
Embodiment
The embodiment of the present invention is described in detail below in conjunction with accompanying drawing.It should be appreciated that this place is retouched
The embodiment stated is merely to illustrate and explain the present invention, and is not intended to limit the invention.
On the one hand, the invention provides a kind of primer sets, the primer sets to include the primer shown in SEQ ID NO.1-8.
On the other hand, the purposes present invention also offers primer sets as described above in the product of diagnosing tumour is prepared.
Wherein, the tumour can include non-small cell lung cancer, ED-SCLC, primary cutaneous type, inflammatory
At least one of myofibroblast knurl and neuroblastoma.Wherein, the non-small cell lung cancer can include squamous carcinoma, gland
At least one of cancer, adenosquamous carcinoma, large cell carcinoma and class cancer.
Another further aspect, present invention also offers a kind of kit for diagnosing tumour, the kit includes as described above
Primer sets and PCR reagent.
Wherein, the tumour can include non-small cell lung cancer, ED-SCLC, primary cutaneous type, inflammatory
At least one of myofibroblast knurl and neuroblastoma.Wherein, the non-small cell lung cancer can include squamous carcinoma, gland
At least one of cancer, adenosquamous carcinoma, large cell carcinoma and class cancer.
Wherein, the PCR reagent can include at least one of archaeal dna polymerase, PCR buffer solutions and dNTP.
Wherein it is preferred to the kit also includes the reagent of extraction serum excretion body.
Another further aspect, present invention also offers a kind of method of detection EML4-ALK fusions, wherein, this method includes
Following steps：
(1) the separation and Extraction excretion body from test serum, and extract the total serum IgE of excretion body；
(2) using the total serum IgE of excretion body as template, by reversing recording method to synthesize cDNA, then using drawing as described above
Thing group enters performing PCR reaction, obtains the material after PCR amplifications；
(3) electrophoresis result of the material after PCR amplifications is obtained, is contained if electrophoresis result is shown in the material after PCR amplifications
There is pcr amplification product, it indicates that contain EML4-ALK fusions in the test serum.
Wherein, the mode for obtaining the electrophoresis result of the material after PCR amplifications can be agarose gel electrophoresis, polyacrylamide
Ammonia gel electrophoresis or Capillary Electrophoresis.
Wherein, EML4-ALK variation hypotype includes：Hypotype 1 (V1), it is outside EML4 the 13rd extron and the 20th of ALK
Aobvious son is connected；Hypotype 2 (V2), it is connected for EML4 the 20th extron with ALK the 20th extron；Hypotype 3 (V3), there are two Asias
Hypotype (V3a/b), the 6th extron that V3a is EML4 are connected with ALK the 20th extron, and V3b is EML4 the 6th extron
It is connected again with ALK the 20th extron plus 33bp small fragment；Hypotype 4 (V4), added for EML4 the 14th extron
20th extron of the one 11bp small fragment again with above missing 49bp ALK is connected；Hypotype 5 (V5), there are two hypotypes
(V5a/b) exon 2 that, V5a is EML4 is connected with ALK the 20th extron, and the exon 2 that V3b is EML4 adds
One 117bp small fragment is connected with ALK the 20th extron again；Hypotype 6 (V6), the 13rd extron for being EML4 add one
49bp small fragment is connected with ALK the 20th extron again；Hypotype 7 (V7) is EML4 the 14th extron with above lacking
12bp ALK the 20th extron is connected；Hypotype 8 (" V4 "), the 15th Exon deletion for being EML4 below 19bp again with it is preceding
Face missing 20bp ALK the 20th extron is connected；Hypotype 9 (" V5 "), it is aobvious outside EML4 the 18th extron and the 20th of ALK
Son is connected.
Wherein, SEQ ID NO.1:The target spot that 5'GAGCTTGCTCAGCTTGTACTCAG 3' primer is matched is located at
On the extron 20 of ALK gene；SEQ ID NO.2:The target spot that 5'GGGGAATGGAGATGTTCTTACTG 3 primer is matched
On the exons 13 of EML4 genes；SEQ ID NO.3:5'GCTACATCACACACCTTGACTGG 3' primer is matched
Target spot be located on the extron 20 of EML4 genes；SEQ ID NO.4:5'AAATTGTCGAAAATACCTTCAACAC 3''s draws
The target spot that thing is matched is located on the extron 5 of EML4 genes；SEQ ID NO.5:5'CACTTTGTCAGATGAGAAATGGG
The target spot that 3' primer is matched is located on the exons 14 of EML4 genes；SEQ ID NO.6:5'
The target spot that GATGAAATCACTGTGCTAAAGGC 3' primer is matched is located on the exon 2 of EML4 genes；SEQ ID
NO.7:The target spot that 5'TCAATTTTTAGTAGGCACATCACG 3' primer is matched is located on the exons 15 of EML4 genes；
SEQ ID NO.8:The target spot that 5'TGGATGCAGAAACCAGAGATCTAG 3' primer is matched is located at the outer aobvious of EML4 genes
On son 18.
Wherein it is preferred in the case of containing pcr amplification product in the material that electrophoresis result shows after PCR amplifications, should
Method also includes：Pcr amplification product is sequenced, existed if sequencing is shown in pcr amplification product shown in SEQ ID NO.9
DNA, it indicates that contain the V1 hypotypes in EML4-ALK fusions in the test serum；
If sequencing shows the DNA existed in pcr amplification product shown in SEQ ID NO.10, it indicates that the test serum
In contain the V2 hypotypes in EML4-ALK fusions；
If sequencing shows the DNA existed in pcr amplification product shown in SEQ ID NO.11, it indicates that the test serum
In contain the V3a hypotypes in EML4-ALK fusions；
If sequencing shows the DNA existed in pcr amplification product shown in SEQ ID NO.12, it indicates that the test serum
In contain the V3b hypotypes in EML4-ALK fusions；
If sequencing shows the DNA existed in pcr amplification product shown in SEQ ID NO.13, it indicates that the test serum
In contain the V4 hypotypes in EML4-ALK fusions；
If sequencing shows the DNA existed in pcr amplification product shown in SEQ ID NO.14, it indicates that the test serum
In contain the V5a hypotypes in EML4-ALK fusions；
If sequencing shows the DNA existed in pcr amplification product shown in SEQ ID NO.15, it indicates that the test serum
In contain the V5b hypotypes in EML4-ALK fusions；
If sequencing shows the DNA existed in pcr amplification product shown in SEQ ID NO.16, it indicates that the test serum
In contain the V6 hypotypes in EML4-ALK fusions；
If sequencing shows the DNA existed in pcr amplification product shown in SEQ ID NO.17, it indicates that the test serum
In contain the V7 hypotypes in EML4-ALK fusions；
If sequencing shows the DNA existed in pcr amplification product shown in SEQ ID NO.18, it indicates that the test serum
In contain the V8 hypotypes in EML4-ALK fusions；
If sequencing shows the DNA existed in pcr amplification product shown in SEQ ID NO.19, it indicates that the test serum
In contain the V9 hypotypes in EML4-ALK fusions.
Wherein, SEQ ID NO.9 are V1 type EML4-ALK fusion amplified productions, and sequence is：ggggaa
tggagatgtt cttactggag actcaggtgg agtcatgctt atatggagca aaactactgt
agagcccacacctgggaaag gacctaaagt gtaccgccgg aagcaccagg agctgcaagc catgcagatg
gagctgcaga gccctgagta caagctgagc aagctc.SEQ ID NO.10 are that V2 type EML4-ALK fusions expand
Increase production thing, sequence is：agctaca tcacacacct tgactggtcc ccagacaaca agtatataat gtctaactcg
ggagactatg aaatattgta cttgtaccgc cggaagcacc aggagctgca agccatgcag atggagctgc
agagccctga gtacaagctg agcaagctc；SEQ ID NO.11 are V3a type EML4-ALK fusion amplified productions,
Sequence is：aaat tgtcgaaaat accttcaaca cccaaattaa taccaaaagt taccaaaact gcagacaagc
ataaagatgtcatcatcaac caagtgtacc gccggaagca ccaggagctg caagccatgc agatggagct
gcagagccct gagtacaagc tgagcaagct c；SEQ ID NO.12 are the amplification productions of V3b type EML4-ALK fusions
Thing, sequence are：aaat tgtcgaaaat accttcaaca cccaaattaa taccaaaagt taccaaaact
gcagacaagc ataaagatgt catcatcaac caagcaaaaa tgtcaactcg cgaaaaaaac agccaagtgt
accgccggaa gcaccaggag ctgcaagcca tgcagatgga gctgcagagc cctgagtaca agctgagcaa
gctc；SEQ ID NO.13 are V4 type EML4-ALK fusion amplified productions, and sequence is：cac tttgtcagat
gagaaatggg atgttattaa ctggaggagg gaaagacaga aaaataattc tgtgggatca tgatctgaat
cctgaaagag aaatagagat atgctggatg agccctgagt acaagctgag caagctc；SEQ ID NO.14 are
V5a type EML4-ALK fusion amplified productions, sequence are：gatgaaat cactgtgcta aaggcggctt
tggctgatgt tttgaggcgt cttgcaatct ctgaagatca tgtggcctca gtgaaaaaat cagtctcaag
taaagtgtac cgccggaagc accaggagct gcaagccatg cagatggagc tgcagagccc tgagtacaag
ctgagcaagc tc；SEQ ID NO.15 are V5b type EML4-ALK fusion amplified productions, and sequence is：gatgaaat
cactgtgcta aaggcggctt tggctgatgt tttgaggcgt cttgcaatct ctgaagatca tgtggcctca
gtgaaaaaat cagtctcaag taaaggttca gagctcaggg gaggatatgg agatccaggg aggcttcctg
taggaagtgg cctgtgtagt gcttcaaggg ccaggctgcc aggccatgtt gcagctgacc acccacctgc
agtgtaccgc cggaagcacc aggagctgca agccatgcag atggagctgc agagccctga gtacaagctg
agcaagctc；SEQ ID NO.16 are V6 type EML4-ALK fusion amplified productions, and sequence is：ggggaatg
gagatgttct tactggagac tcaggtggag tcatgcttat atggagcaaa actactgtag agcccacacc
tgggaaagga cctaaaggaa gtggcctgtg tagtgcttca agggccaggc tgccaggcca tgttgcagct
gaccacccac ctgcagtgta ccgccggaag caccaggagc tgcaagccat gcagatggag ctgcagagcc
ctgagtacaa gctgagcaag ctc；SEQ ID NO.17 are V7 type EML4-ALK fusion amplified productions, and sequence is：
ca ctttgtcaga tgagaaatgg gatgttatta actggaggag ggaaagacag aaaaataatt
ctgtgggatc atgatctgaa tcctgaaaga gaaatagagc accaggagct gcaagccatg cagatggagc
tgcagagccc tgagtacaag ctgagcaagc tc；SEQ ID NO.18 are V8 (" V4 ") type EML4-ALK fusions
Amplified production, sequence are：tcaat ttttagtagg cacatcacga aactttattt tacgaggaac atttaatgat
ggc gagctg caagccatgc agatggagct gcagagccct gagtacaagc tgagcaagct c；SEQ ID
NO.19 is V9 (" V5 ") type EML4-ALK fusion amplified productions, and sequence is：tggatgca gaaaccagag
atctagtttc tatccacaca gacgggaatg aacagctctc tgtgatgcgc tactcaatag tgtacc
gccggaagca ccaggagctg caagccatgc agatggagct gcagagccct gagtacaagc tgagcaagct
c。
Another further aspect, present invention also offers a kind of method of diagnosing tumour, this method comprises the following steps：
(1) the separation and Extraction excretion body from from the test serum of subject, and extract the total serum IgE of excretion body；
(2) using the total serum IgE of excretion body as template, by reversing recording method to synthesize cDNA, then performing PCR is entered using primer sets
Reaction, obtain the material after PCR amplifications；
(3) electrophoresis result of the material after PCR amplifications is obtained, is contained if electrophoresis result is shown in the material after PCR amplifications
There is the pcr amplification product of EML4-ALK fusions, it indicates that the subject is tumor patient.
Wherein, the primer sets are preferably present invention primer sets as described above.
Compared with prior art, the invention has the characteristics that：Existing EML4-ALK fusions detection method according to
Rely in tumor tissues, be invasive detection method；This method detects EML4-ALK fusions from serum, is noninvasive/minimally invasive
Detection method.The fused type of detection is more, can almost detect all types of EML4-ALK fusions.Can be clear and definite
Fused type.Simple to operate, detection time is short.Specific good, high sensitivity.
Hereinafter, the present invention is further described by embodiment.
Embodiment 1
The peripheric venous blood 4mL of subject is taken in serum separation test tube, it is not reverse to mix, after being stored at room temperature 30 minutes,
300 × g is centrifuged 15 minutes, and the sample through isolating clearly is divided into 2 layers from top to bottom, is followed successively by serum layer and haemocyte layer.
Serum layer 2000 × g of supernatant is taken, centrifuges 10 minutes and removes dead cell, takes 10000 × g of supernatant to centrifuge 30 minutes and goes
Except cell fragment, finally take supernatant, after packing -80 DEG C freeze it is standby.Above procedure ensures to complete within 4-6 hours.
The extraction of serum excretion body uses SBI companies ExoQuickTMExcretion body extracts kit is extracted, by kit specification
Operated with reference to document report, step includes：Serum is taken out from -80 DEG C of refrigerators, respectively takes every part of μ L of blood serum sample 500 quick
Thaw, 4 DEG C of 3000 × g are centrifuged 15 minutes.Supernatant is taken after centrifugation, is filtered by 0.45 μm of filter.Sera liquid after filtering is about
500 μ L add ExoQuickTMThe μ L of reagent 120, cover tightly lid, overturn and mix 3 times.Mixture, which is placed in 4 DEG C of refrigerators, to react overnight
(at least 12 hours).4 DEG C, 13000rpm, centrifuge 30 minutes, remove supernatant, retain precipitation.4 DEG C, 13000rpm, centrifuge 3 points
Clock, supernatant is fully removed, it is excretion body particulate to retain precipitation, and -80 DEG C of refrigerators save backup.
Serum excretion body Total RNAs extraction uses Invitrogen companiesReagent extracts, and is combined by reagent specification
Document report is operated, and step includes：1mL Trizol are added into excretion body particulate, fully mixes, divides in incubated at room temperature 5
Clock.0.2mL chloroforms are added, bottle cap acutely vibration 15 seconds is covered tightly, places 2-3 minutes.2-8 DEG C, 10000-12000 × g centrifugations 15
Minute.Upper strata aqueous phase is transferred in a new centrifuge tube, adds 0.25mL isopropanols, is mixed, room temperature is placed 10 minutes, 2-
8 DEG C, 10000-12000 × g is centrifuged 10 minutes.Supernatant is abandoned, at least 1mL75% isopropanol washing is added, 2-8 DEG C, is not more than
7500 × g is centrifuged 5 minutes.Supernatant is abandoned, is air-dried 5-10 minutes, adds the no RNase μ L of water 20, suction repeatedly makes RNA molten
Solution.10 minutes -80 DEG C of refrigerator storages of 55-60 DEG C of insulation are standby.
Reverse transcription is carried out to RNA using Promega GoScriptTM Reverse Transcription System,
Step includes：Volume according to needed for the concentration of each RNA sample calculates 200ng RNA.Added according to the volume number of each sample
Enter the water without RNA of appropriate volume, cumulative volume is 4 μ L.1 μ L Random Primer (0.5 μ g/ are added into each sample
reaction).70 DEG C are put it into after mixing to heat 5 minutes, are placed it in immediately after heating on ice, with small-sized after 5 minutes
Centrifuge 10 seconds, is then placed within ice.Reversion system is prepared according to table 1：
Table 1
| Reagent | Usage amount | Whole solubility |
| Buffer solution | 4μL | 1× |
| MgCl2 | 3.5μL | 1.5-5.0mM |
| dNTP | 1μL | 0.5mM |
| RNase inhibitor | 0.5μL | |
| Reverse transcriptase | 1μL | |
| Water | Add to 15 μ L |
The reversion mixed liquor that 15 μ L are prepared and 5 μ L samples before are sufficiently mixed, annealed 5 minutes at 25 DEG C.42℃
Extension 1 hour.Sample is first positioned over 70 DEG C before RT-PCR is and heats 15 minutes to inactivate the activity of reverse transcriptase.
RT-PCR is carried out using primer as follows：SEQ ID NO.1:5'GAGCTTGCTCAGCTTGTACTCAG
3'；SEQ ID NO.2:5'GGGGAATGGAGATGTTCTTACTG 3'；SEQ ID NO.3:5'
GCTACATCACACACCTTGACTGG 3'；SEQ ID NO.4:5'AAATTGTCGAAAATACCTTCAACAC 3'；SEQ ID
NO.5:5'CACTTTGTCAGATGAGAAATGGG 3'；SEQ ID NO.6:5'GATGAAATCACTGTGCTAAAGGC 3'；
SEQ ID NO.7:5'TCAATTTTTAGTAGGCACATCACG 3'；SEQ ID NO.8:5'
TGGATGCAGAAACCAGAGATCTAG 3'。
Prepare 50 μ L PCR reaction solutions：25 μ L 2 × Taq PCR mixtures, 2 μ L RT-PCR joint primers (SEQ ID
NO.1-8, concentration are 10pM/ bars), the cDNA and 20 μ L distilled waters of 3 μ L reversions.Enter performing PCR reaction by following condition：94℃
2min；94 DEG C of 30sec, 60 DEG C of 30sec, 72 DEG C of 4min, 35 circulations；72℃5min.2% agarose gel electrophoresis inspection.PCR
Product is sequenced.
Wherein, subject includes the suspected patient of 53 non-small cell knurls, and the tumor tissues for obtaining all subjects are immunized
Groupization result and tumor tissues PCR results as with reference to (the method reference literature of SABC (Liu L, Zhan P, Zhou X,
Song Y,Zhou X,Yu L,et al.(2015)Detection of EML4-ALK in Lung Adenocarcinoma
Using Pleural Effusion with FISH,IHC,and RT-PCR Methods.PLoS ONE 10(3):
E0117032.) carry out, wherein antibody used is respectively ALK antibody and the purchase purchased from Cell Signaling Technoloy
From the immunologic combined detection reagent kit of Zhong Shan Golden Bridge), result, tumor tissues PCR results, the excretion body PCR results of SABC
Contrast see Fig. 1.
Wherein, numbering P8, P10, P17 and P23 subject contains EML4-ALK fusions hypotype 1 (V1), its PCR
Electrophoresis result is as shown in Fig. 2 its sequencing result is as shown in Figure 3；The subject that numbering is L008 contains EML4-ALK fusions
Hypotype 2 (V2), its PCR electrophoresis result is as shown in figure 4, its sequencing result is as shown in Figure 5；The subject that numbering is L007 is contained
EML4-ALK fusions hypotype 3 (V3a/b), its PCR electrophoresis result is as shown in fig. 6, its sequencing result is as shown in Figure 7.
Visible according to Fig. 1 result, primer sets of the invention are in the case where meeting high sensitive, high requirement specifically, significantly
Reduce the false negative rate of EML4-ALK fusion hypotypes.
Comparative example 1
Primer sets shown in primer combination 1-17 design for EML4-ALK fusions, and it forms such as table 2
It is shown：
Table 2
The DNA sample for the subject that the numbering that EML4-ALK fusions hypotype 1 (V1) will be contained is P8 makes as template
With SEQ ID NO.1-8 primer sets, and the primer sets shown in primer combination 1-17, enter performing PCR according to the condition of embodiment 1
To carry out parallel contrast (i.e. primer sequence is different outer, and other conditions are identical), its PCR electrophoresis result is as shown in Figure 8 for reaction.Fig. 8
Result show that the amplified band of the primer sets of the present invention is most bright, and do not interfere with band.The primer sets of the present invention can
Meet high sensitive, high requirement specifically.
The preferred embodiment of the present invention is described in detail above in association with accompanying drawing, still, the present invention is not limited to above-mentioned reality
The detail in mode is applied, in the range of the technology design of the present invention, a variety of letters can be carried out to technical scheme
Monotropic type, these simple variants belong to protection scope of the present invention.
It is further to note that each particular technique feature described in above-mentioned embodiment, in not lance
In the case of shield, can be combined by any suitable means, in order to avoid unnecessary repetition, the present invention to it is various can
The combination of energy no longer separately illustrates.
In addition, various embodiments of the present invention can be combined randomly, as long as it is without prejudice to originally
The thought of invention, it should equally be considered as content disclosed in this invention.
Claims (10)
1. a kind of primer sets, it is characterised in that the primer sets include the primer shown in SEQ ID NO.1-8.
2. purposes of the primer sets described in claim 1 in the product of diagnosing tumour is prepared.
3. purposes according to claim 2, wherein, the tumour includes non-small cell lung cancer, ED-SCLC, a denaturation
At least one of large celllymphoma, inflammatory myofibroblast knurl and neuroblastoma.
4. purposes according to claim 3, wherein, the non-small cell lung cancer includes squamous carcinoma, gland cancer, adenosquamous carcinoma, big thin
At least one of born of the same parents' cancer and class cancer.
5. a kind of kit for diagnosing tumour, it is characterised in that the kit includes primer sets as claimed in claim 1
And PCR reagent.
6. kit according to claim 5, wherein, the tumour includes non-small cell lung cancer, ED-SCLC, anaplasia
At least one of property large celllymphoma, inflammatory myofibroblast knurl and neuroblastoma.
7. kit according to claim 6, wherein, non-small cell lung cancer includes squamous carcinoma, gland cancer, adenosquamous carcinoma, maxicell
At least one of cancer and class cancer.
8. according to the kit described in any one in claim 5-7, wherein, the PCR reagent includes archaeal dna polymerase, PCR
At least one of buffer solution and dNTP.
9. a kind of method of detection EML4-ALK fusions, wherein, this method comprises the following steps：
(1) the separation and Extraction excretion body from test serum, and extract the total serum IgE of excretion body；
(2) using the total serum IgE of excretion body as template, by reversing recording method to synthesize cDNA, then using as claimed in claim 1
Primer sets enter performing PCR reaction, obtain the material after PCR amplifications；
(3) electrophoresis result of the material after PCR amplifications is obtained, if electrophoresis result, which is shown in the material after PCR amplifications, contains PCR
Amplified production, it indicates that contain EML4-ALK fusions in the test serum.
10. according to the method for claim 9, wherein, expand in the material that electrophoresis result shows after PCR amplifications containing PCR
In the case of increasing production thing, this method also includes：Pcr amplification product is sequenced, deposited if sequencing is shown in pcr amplification product
In the DNA shown in SEQ ID NO.9, it indicates that contain the V1 hypotypes in EML4-ALK fusions in the test serum；
If sequencing shows the DNA existed in pcr amplification product shown in SEQ ID NO.10, it indicates that contains in the test serum
There are the V2 hypotypes in EML4-ALK fusions；
If sequencing shows the DNA existed in pcr amplification product shown in SEQ ID NO.11, it indicates that contains in the test serum
There are the V3a hypotypes in EML4-ALK fusions；
If sequencing shows the DNA existed in pcr amplification product shown in SEQ ID NO.12, it indicates that contains in the test serum
There are the V3b hypotypes in EML4-ALK fusions；
If sequencing shows the DNA existed in pcr amplification product shown in SEQ ID NO.13, it indicates that contains in the test serum
There are the V4 hypotypes in EML4-ALK fusions；
If sequencing shows the DNA existed in pcr amplification product shown in SEQ ID NO.14, it indicates that contains in the test serum
There are the V5a hypotypes in EML4-ALK fusions；
If sequencing shows the DNA existed in pcr amplification product shown in SEQ ID NO.15, it indicates that contains in the test serum
There are the V5b hypotypes in EML4-ALK fusions；
If sequencing shows the DNA existed in pcr amplification product shown in SEQ ID NO.16, it indicates that contains in the test serum
There are the V6 hypotypes in EML4-ALK fusions；
If sequencing shows the DNA existed in pcr amplification product shown in SEQ ID NO.17, it indicates that contains in the test serum
There are the V7 hypotypes in EML4-ALK fusions；
If sequencing shows the DNA existed in pcr amplification product shown in SEQ ID NO.18, it indicates that contains in the test serum
There are the V8 hypotypes in EML4-ALK fusions；
If sequencing shows the DNA existed in pcr amplification product shown in SEQ ID NO.19, it indicates that contains in the test serum
There are the V9 hypotypes in EML4-ALK fusions.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610377728.5A CN107446990A (en) | 2016-05-31 | 2016-05-31 | A kind of method and its application of quick Non-invasive detection EML4 ALK fusion genes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610377728.5A CN107446990A (en) | 2016-05-31 | 2016-05-31 | A kind of method and its application of quick Non-invasive detection EML4 ALK fusion genes |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107446990A true CN107446990A (en) | 2017-12-08 |
Family
ID=60485476
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610377728.5A Pending CN107446990A (en) | 2016-05-31 | 2016-05-31 | A kind of method and its application of quick Non-invasive detection EML4 ALK fusion genes |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107446990A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107058305A (en) * | 2017-03-15 | 2017-08-18 | 中国人民解放军总医院 | One group of nucleotide sequence and the application in EML4 ALK fusion gene quick detections |
| WO2023046005A1 (en) | 2021-09-22 | 2023-03-30 | 烟台正海磁性材料股份有限公司 | High-remanence neodymium-iron-boron magnet, and preparation method therefor and use thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8163524B2 (en) * | 1998-09-22 | 2012-04-24 | Oncomedx, Inc. | Comparative analysis of extracellular RNA species |
| CN102719525A (en) * | 2012-04-12 | 2012-10-10 | 厦门艾德生物医药科技有限公司 | Primer, probe and detection kit for detection of EML4-ALK fusion gene mutation |
| CN103805684A (en) * | 2012-11-09 | 2014-05-21 | 益善生物技术股份有限公司 | PCR primer, kit and liquid phase chip for EML4-ALK fusion gene detection |
| CN105039580A (en) * | 2015-09-06 | 2015-11-11 | 武汉海吉力生物科技有限公司 | Human ALK fusion gene detection primer set and detection kit |
-
2016
- 2016-05-31 CN CN201610377728.5A patent/CN107446990A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8163524B2 (en) * | 1998-09-22 | 2012-04-24 | Oncomedx, Inc. | Comparative analysis of extracellular RNA species |
| CN102719525A (en) * | 2012-04-12 | 2012-10-10 | 厦门艾德生物医药科技有限公司 | Primer, probe and detection kit for detection of EML4-ALK fusion gene mutation |
| CN103805684A (en) * | 2012-11-09 | 2014-05-21 | 益善生物技术股份有限公司 | PCR primer, kit and liquid phase chip for EML4-ALK fusion gene detection |
| CN105039580A (en) * | 2015-09-06 | 2015-11-11 | 武汉海吉力生物科技有限公司 | Human ALK fusion gene detection primer set and detection kit |
Non-Patent Citations (3)
| Title |
|---|
| K. BRINKMANN1等: "Plasma-based diagnostics for detection of EML4-ALK fusion transcripts in NSCLC patients", 《AMERICAN ASSOCIATION FOR CANCER RESEARCH ANNUAL MEETING》 * |
| LEORA HORN AND WILLIAM PAO等: "EML4-ALK: Honing In on a New Target in Non–Small-Cell Lung Cancer", 《JOURNAL OF CLINICAL ONCOLOGY》 * |
| XUCHAO ZHANG等: "RFeusesaricoh n of EML4 and ALK is associated with development of lung adenocarcinomas lacking EGFR and KRAS mutations and is correlated with ALK expression", 《MOLECULAR CANCER》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107058305A (en) * | 2017-03-15 | 2017-08-18 | 中国人民解放军总医院 | One group of nucleotide sequence and the application in EML4 ALK fusion gene quick detections |
| WO2023046005A1 (en) | 2021-09-22 | 2023-03-30 | 烟台正海磁性材料股份有限公司 | High-remanence neodymium-iron-boron magnet, and preparation method therefor and use thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Juratli et al. | Intratumoral heterogeneity and TERT promoter mutations in progressive/higher-grade meningiomas | |
| Dobashi et al. | Stepwise participation of p53 gene mutation during dedifferentiation of human thyroid carcinomas | |
| TWI316963B (en) | Method for detection of htr and htert telomerase-associated rna in plasma or serum | |
| Bellone et al. | Overexpression of epithelial cell adhesion molecule in primary, metastatic, and recurrent/chemotherapy-resistant epithelial ovarian cancer: implications for epithelial cell adhesion molecule-specific immunotherapy | |
| Orchel et al. | Expression patterns of kinin-dependent genes in endometrial cancer | |
| Lee et al. | Comparison of HER 2 expression between primary colorectal cancer and their corresponding metastases | |
| Ansari et al. | The liquid biopsy in lung cancer | |
| JPH08502649A (en) | Translocation of the cyclin complex and related uses | |
| Jin et al. | AFP mRNA level in enriched circulating tumor cells from hepatocellular carcinoma patient blood samples is a pivotal predictive marker for metastasis | |
| Cai et al. | Expression of hMOF in different ovarian tissues and its effects on ovarian cancer prognosis | |
| CN106662543B (en) | Non-invasive gene mutation detection in lung cancer patients | |
| CA2796277A1 (en) | Tumor cell-derived microvesicles | |
| Kawakami et al. | Detection of novel paraja ring finger 2‐fer tyrosine kinase mRNA chimeras is associated with poor postoperative prognosis in non‐small cell lung cancer | |
| CN103874768A (en) | A method of diagnosing neoplasms | |
| Wallace et al. | Detection of the bcl-2 t (14; 18) translocation and proto-oncogene expression in primary intraocular lymphoma | |
| CN107446990A (en) | A kind of method and its application of quick Non-invasive detection EML4 ALK fusion genes | |
| Watanabe et al. | Expression of mesothelin mRNA in pure pancreatic juice from patients with pancreatic carcinoma, intraductal papillary mucinous neoplasm of the pancreas, and chronic pancreatitis | |
| CN100355770C (en) | Method of determining a chemotherapeutic regimen based on glutathione-S-transferase pi expression | |
| Ueda et al. | The landscape of MYB/MYBL1-and peri-MYB/MYBL1-associated rearrangements in adenoid cystic carcinoma | |
| CN107058305A (en) | One group of nucleotide sequence and the application in EML4 ALK fusion gene quick detections | |
| Tang et al. | EVI5 is a novel independent prognostic predictor in hepatocellular carcinoma after radical hepatectomy | |
| CN109182519B (en) | It is a kind of for diagnosing the probe combinations and its application of ACTA2-MITF transposition blood vessel week epithelioid cell's tumour | |
| Gui et al. | Expression of LAMP3 and its correlation with clinicopathologic characteristics and prognosis in hepatocellular carcinoma | |
| CN106755309A (en) | Application of the molecular marked compound in cancer of pancreas prognosis evaluation product is prepared | |
| Sheen et al. | Is the expression of γ-glutamyl transpeptidase messenger RNA an indicator of biological behavior in recurrent hepatocellular carcinoma? |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20190103 Address after: 110100 No. 4 Hangzhou West Road, Shenbei New District, Shenyang City, Liaoning Province Applicant after: Shenyang Tian Bang Pharmaceutical Co., Ltd. Address before: Room 201, 2nd floor, 23 Building, 72 Sanjie, Qinghe, Haidian District, Beijing 100085 Applicant before: Keskin Biotechnology (Beijing) Co., Ltd. |
|
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20171208 |