CN104480215B - A kind of gene association detection method and test kit - Google Patents
A kind of gene association detection method and test kit Download PDFInfo
- Publication number
- CN104480215B CN104480215B CN201410849552.XA CN201410849552A CN104480215B CN 104480215 B CN104480215 B CN 104480215B CN 201410849552 A CN201410849552 A CN 201410849552A CN 104480215 B CN104480215 B CN 104480215B
- Authority
- CN
- China
- Prior art keywords
- seq
- pik3ca
- pcr
- probe
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Pathology (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A kind of method that the present invention relates to joint-detection gene mutation, with 20-50ng DNA as sample, detects KRAS, PIK3CA, BRAF and EGFR gene 16 kinds of sudden changes altogether simultaneously.The method comprise the steps that design specific probe, set up MLPA amplification mutant gene sequence reaction system, react a large amount of amplifying target genes sequence by PCR.High specificity of the present invention, the wild type DNA of 10～100ng will not produce nonspecific interference signal；Selectivity is strong, can 99～99.9% wild type DNA background under detect the saltant type of 0.1%～1.0%.
Description
Technical field
The present invention relates to biology field, a kind of method being specifically related to joint-detection gene mutation, particularly to
A kind of with MLPA method as technology platform, detect KRAS, PIK3CA, BRAF and the method for EGFR gene 16 kinds of sudden changes altogether simultaneously.
Background technology
RAS gene includes KRAS, HRAS and NRAS tri-kinds, the mainly KRAS gene relevant to pulmonary carcinoma, is positioned at No. 12 dyes
On colour solid, encode P21 albumen, by accepting to affect the mcroorganism molecules such as intracellular ribozyme with transfer sell outgrowth stimulus signal
Synthesize, and then the growth and differentiation to cell regulates and controls.When KRAS gene extron 2,3 is undergone mutation, sudden change
KRAS gene can cause undesired cell proliferation with sustained activation RAF-MEK-ERK-MAPK signal transduction pathway, break up and regulate and control
Disorderly.In the tumors such as leukemia, pulmonary carcinoma, colorectal cancer and cancer of pancreas, all it is found that KRAS gene has higher mutation rate.
Phosphatidyl-inositol 3-kinase (phosphatidylinositol-3-kinase, PI3K) is an important signal
Pathway molecule, is made up of a catalytic subunit p110 and a regulation subunit p85.P110 construction features according to PI3K and
Substrate molecule difference can be classified as 3 hypotypes such as I type, II type and III type.The signal transduction pathway of PI3K mediation is at cell
The generation of propagation, conversion, apoptosis and tumor plays an important role, the propagation of regulation tumor cell and survival.Research finds,
The imbalance of PI3K-AKT signal path may result in pulmonary carcinoma, ovarian cancer, breast carcinoma, glioblastoma, carcinoma of endometrium and nasopharyngeal carcinoma etc. and dislikes
The generation of property tumor.
BRAF is one of most important proto-oncogene of the mankind, and the human tumor of about 8% occurs BRAF sudden change.BRAF is the biggest
Fractional mutations occurs near BRAF protein kinase active region or its, and the most about 70%～90% is BRAF gene exons 15
1799th nucleotide T sports A, causes its valine encoded to be replaced (i.e. BRAF V600E sudden change) by glutamic acid.BRAF
Gene is positioned at No. 7 chromosomes, is the serine/threonine in cell mitogen element former activated protein kinase (MAPK) signal path
Kinases, once this gene expression changes, and biological function will be made to get muddled, so that the signal path of its mediation is lacked of proper care also
Ultimately result in cell transformation even to cancerate.
EGF-R ELISA (EGFR) is a kind of tyrosine kinase receptor (RTK), is positioned at No. 7 chromosome, by 28
Individual exon forms, and encodes 1186 aminoacid, its glycoprotein molecule amount about 170kDa.EGFR is I type tyrosine kinase receptor
One of gene family member, is that transfer sell external signal is to endonuclear important channel albumen.The key signal transduction of EGFR
Approach has: RAS-RAF-MEK-ERK-MAPK path, PI3K-PDK path, PLC-γ path, JAK-STAT path etc..By this
A little approach, are converted into extracellular signal intracellular signal, thus successfully manage the signal stimulus in the external world, regulate the growth of cell, increasing
Grow, break up, the apoptosis of suppression cell.The sudden change of EGFR occur mainly on front four exons in intracellular TK region (18～
21) the TK region mutagenesis, having now been found that has kind more than 30.The wherein deletion mutation (delE746-A750) of exons 19 and exon
Replacement sudden change (L858R) on 21 is again classical sudden change or hot spot mutation, accounts for the 90% of sudden change.In addition occur at extron 20
On replacement mutation T 790M be medicament-resistant mutation, Molecular Detection has important reference value equally.
Multiplex ligation-dependent probe amplification (multiplex ligation-dependent probe
Amplification, MLPA) it is that the one first reported by Schouten etc. carries out qualitative and semidefinite for DNA sequence to be checked
The Multiple detection technology of component analysis.In MLPA reacts, expanding each target sequence and be required for a pair probe, each probe includes
One section of primer sequence and one section of specific sequence.After this pair probe and target sequence hybridize, then it is connected to become with ligase
Article one, oligonucleotide chain.Coupled reaction high special, only hybridizes with target sequence when two probes, i.e. target sequence and probe completely
Specific sequence complete complementary, two sections of probes could be connected into a complete single nucleic acid strands by ligase；Whereas if target sequence
Arrange not fully complementary with probe sequence, even if the difference of only one of which base, also result in hybridization not exclusively, make coupled reaction without
Method is carried out.After coupled reaction completes, expand the probe connected, the length of the amplified production of each probe with a pair universal primer
Being all unique, scope is between 130～480bp.MLPA technology can be used for Multiple detection, is designed by rational probe,
Primary first-order equation can detect multiple target sequence simultaneously.In the feelings using capillary electrophoresis amplified production to be separated, analyzes
Under condition, the target sequence simultaneously detected can reach 45.Multiple detection method is conducive to improving detection efficiency, reduces the use of template
Amount, is particularly suited for the situation that template amount is few and target spot to be measured is more.If the target sequence generation point mutation of detection or disappearance, expansion
Increase sudden change, then the amplified peak of correspondent probe will lack, reduces or increase, and therefore, just can determine whether according to the change of amplified peak
Whether target sequence is with the presence of exception or the point mutation of copy number.
Before formulating clinical treatment, application molecular diagnostic techniques detects each gene in patient's tumor cell exactly
Mutation status, thus select suitable target therapeutic agent, it is the application targeted drug premise to cancer implementation personalized treatment
And basis, also can be that the prognosis of clinic judge patient provides help simultaneously.It is specifically designed for the target of EGFR, PIK3CA, BRAF at present
Clinical practice is had been enter into medicine, and for the targeted drug of KRAS also in research and development.In lung cancer patient, KRAS, PIK3CA,
BRAF and the modal mutant form of EGFR gene have 16 kinds, if using the method for quantitative fluorescent PCR to detect, then need big
The clinical sample of amount, not only adds the difficulty of clinical sampling, also makes patient pay higher testing cost.In order to reduce clinic
The usage amount of sample, simplifies detection operation, the invention provides a kind of based on MLPA technology, detection side efficient, highly sensitive
Method, can detect KRAS, PIK3CA, BRAF and EGFR gene totally 16 kinds of sudden changes, for clinic in the DNA sample of 20-50ng simultaneously
Personalized medicine provides foundation.
Summary of the invention
In order to improve Clinical Laboratory ability, existing provide a kind of based on MLPA technology, can detect simultaneously KRAS, PIK3CA,
The method of BRAF and EGFR gene 16 kinds of sudden changes altogether, the method can detect 16 kinds in the DNA sample of 20-50ng simultaneously
Sudden change.
Technical scheme comprises the steps of
1. detection gene mutation site
According to mankind's KRAS gene 2, the wildtype gene sequence of 3 exons and corresponding mutated genes sequence
Row, design multipair specific probe, detect the catastrophe in following site:
According to mankind's PIK3CA gene 9, the wildtype gene sequence of 20 exons and corresponding mutated genes
Sequence, designs multipair specific probe, detects the catastrophe in following site:
Wildtype gene sequence according to mankind's BRAF gene 15 exon and corresponding mutated genes sequence, if
Count out specific probe, detection BRAF V600E sudden change.1799th nucleotide T of i.e. 15 exons sports A, causes it
The valine of coding is replaced (Cosmic ID 476) by glutamic acid.
According to human EGFR gene 19, No. 20 and the wildtype gene sequence of 21 exons and corresponding saltant type
Gene order, designs specific probe, detects the replacement sudden change on the deletion mutation of 19 exons, 21 exons
Replacement mutation T 790M on L858R (Cosmic ID 6224, c.2573T > G) and 20 exons (Cosmic ID 6240,
c.2369C>T)。
2. probe design process
Need a pair probe that target sequence is detected, the structure of probe contains and the complementation of target sequence strictly complementary
District, the fill area of regulation probe length, as the guiding region of PCR primer.The primer sequence in PCR primer district can be universal primer
Or specific primer.Can not comprise sudden change in probe or comprise sudden change, mutating alkali yl position within the probe can be located at last
Individual (when complementary region is positioned at 3 ' end of probe) or first (when complementary region is positioned at 5 ' end of probe).A pair probe is through even
After connecing enzyme connection, length is between 100～250nt.
3.19 exon deletion mutation detection methods
Easily occur the region of disappearance c.2230_2270 to design probe to A at EGFR gene 19 exon, work as region
C.2230_2270 occur to amplify strips A during disappearance；EGFR gene conserved sequence designs probe to B.Work as sample
When DNA does not comprise the disappearance in EGFR 19 exon c.2230_2270 region, amplifiable go out two kinds of bars of a certain proportion of A, B
Band.When containing the disappearance in EGFR 19 exon c.2230_2270 region in sample DNA, the ratio of A band and B band is sent out
Changing, thus judge that EGFR gene 19 exon there occurs deletion mutation.
4. set up the reaction system of MLPA amplification mutant gene sequence, react a large amount of amplifying target genes sequence by PCR.
MLPA reaction system is made up of following reaction:
Template denaturation: added by template DNA in PCR pipe, is placed in PCR instrument, and arranging temperature is 95～100 DEG C, maintain 3～
10min, is cooled to 25 DEG C.
Hybridization: add MLPA Buffer and the mixture of probe in template after denaturing.The concentration of its middle probe is
0.5～10nM；Containing Tris-HCl (50～500mM, pH8.2～9.0) in MLPA Buffer, KCl (2～5M), MgCl2
(0.5～5M), EDTA (0.5～5mM).Operation hybridization procedures in PCR instrument: 95 DEG C of 1min；60 DEG C 16～24h.
Connect: after hybridization is terminated, each PCR pipe adds ultra-pure water and ligase, PCR instrument is run and connects
Program: 50～58 DEG C 10～30min；95～100 DEG C 10～30min；It is cooled to 20 DEG C.
PCR expands: coupled reaction terminates the amplification of laggard performing PCR.PCR universal primer, dNTPs is added in each PCR pipe
And Taq enzyme, operation PCR program in PCR instrument:
Detection: the core of the method detection amplifications such as sepharose electrophoresis, polyacrylamide gel electrophoresis and capillary electrophoresis can be used
Acid fragment.
The present invention provides a kind of and detects KRAS, PIK3CA, BRAF and EGFR gene 16 kinds of sudden changes altogether for detection simultaneously
Test kit, the specific probe in test kit is shown in Table 1.
Table 1: specific probe sequence table
Described based on MLPA technology, detect KRAS, PIK3CA, BRAF and the side of EGFR gene 16 kinds of sudden changes altogether simultaneously
Method does not include sample DNA extraction step, but for from formaldehyde fix the DNA fragmentation that paraffin-embedded sample obtains still have with
The amplification same for DNA extracted from fresh tissue sample and power of test.
Compared with existing detection method, present invention have the advantage that
(1) detect KRAS, PIK3CA, BRAF and EGFR gene 16 kinds of sudden changes altogether simultaneously；
(2) high specificity, the wild type DNA of 10～100ng will not produce nonspecific interference signal；
(3) selectivity is strong, can 99～99.9% wild type DNA background under detect the sudden change of 0.1%～1.0%
Type；
(4) amount of samples is low, can detect KRAS, PIK3CA, BRAF and EGFR with 20-50ng DNA for sample simultaneously
Gene 16 kinds of sudden changes altogether.
Accompanying drawing explanation
Fig. 1: embodiment 1 polyacrylamide gel electrophoresis figure
Fig. 2: embodiment 2 polyacrylamide gel electrophoresis figure
Fig. 3: embodiment 3 polyacrylamide gel electrophoresis figure
Detailed description of the invention
With specific embodiment, the present invention is described in further detail below.It should be appreciated that specific embodiment is only
It is that the present invention is made clearer explanation rather than limitation of the present invention.
Embodiment 1
Respectively taking the DNA 2 μ L in table 2 in PCR pipe as template, be placed in PCR instrument, arranging temperature is 95 DEG C, maintains
5min, is cooled to 25 DEG C.Template after denaturing adds 1.5 μ L MLPA Buffer and 1.5 μ L Probemix
(containing 34 probes in table 1 in Probemix), operation hybridization procedures in PCR instrument: 95 DEG C of 1min；60℃ 16h.Hybridization
After reaction terminates, each PCR pipe adds 15 μ L ultra-pure waters and 0.1 μ L ligase, operation linker in PCR instrument: 54
℃ 20min；95℃ 10min；It is cooled to 20 DEG C.Coupled reaction terminates the amplification of laggard performing PCR.1.0 are added in each PCR pipe
μ LPCR universal primer, 1.0 μ L dNTPs and 0.5 μ L Taq enzyme, operation PCR program in PCR instrument:
By the nucleic acid fragment of polyacrylamide gel electrophoresis detection amplification, see Fig. 1.Each catastrophe point is all accurately detected
Coming, the nucleotide fragments length of PCR amplification is consistent with the length of probe.
Table 2: embodiment 1 template DNA
Embodiment 2
Respectively taking the DNA 2 μ L in table 3 in PCR pipe as template, remaining checked operation, with embodiment 1, passes through polypropylene
The nucleic acid fragment of amide electrophoresis detection amplification, is shown in Fig. 2.When the DNA extracted in healthy human blood is as sample, PCR amplifies
Two band of a length of 186bp and 194bp；And with E746-A750 disappearance HCC827 cell genomic dna for sample time,
Only amplify a band of a length of 194bp.
Table 3: embodiment 2 template DNA
Embodiment 3
Respectively taking the DNA 2 μ L in table 4 in PCR pipe as template, remaining checked operation, with embodiment 1, passes through polypropylene
The nucleic acid fragment of amide electrophoresis detection amplification, is shown in Fig. 3.When sample exists several genes sudden change simultaneously, this method of inspection energy
Out by the gene test of sudden change the most simultaneously.
Table 4: embodiment 3 template DNA
Embodiment 4
Collect the tumor tissues (including flesh tissue and paraffin section) of the 57 example patients that clinical diagnosis is pulmonary carcinoma, use
DNA extraction kit and the paraffin embedding DNA extraction kit of Qiagen company extract genomic DNA as template.Remaining
Checked operation is with embodiment 1, by the nucleic acid fragment of capillary electrophoresis detection amplification.The gene mutation detected in 57 example samples
Situation is shown in Table 5.
Table 5: Tumor Tissues of Patients with Lung Cancer DNA detection in Gene Mutation result
Additionally the sample in embodiment 4 is carried out the testing result complete of sequence verification, sequencing result and the present embodiment
Cause.
Claims (3)
1. a gene association detection kit, it is characterised in that comprise 34 primers and probe, these 34 primers and probe divide
Not:
P_KRAS1_L:P-SEQ-1:gagtacgctagatgttggatttggcatataactcagta cgaacttgtggtagttg
gagcta
P_KRAS1_R:P-SEQ-2:gtggcgtaggcaagagtgcgcctactacgatgctgaat tctctagattgcttcga
gctggctc
P_KRAS2_L:P-SEQ-3:gagtctcgtgaccgttggagtacagagtatacccttgt ggtagttggagctgt
P_KRAS2_R:P-SEQ-4:tggcgtaggcaagagtgcgtagtccaagcatctagatt ggatgactctggcaa
P_KRAS3_L:P-SEQ-5:ggagactatacaggttggataatcgctctttagtccgc tgatatatagccttgtg
gtagttggagctggtga
P_KRAS3_R:P-SEQ-6:cgtaggcaagagtgcgttgaattgaactcataatctca ttgagtttctagattgg
atcatcctgaaac
P_KRAS4_L:P-SEQ-7:gagctctatagacgttggatcattggtacggatatcaa cttgtggtagttggagc
tc
P_KRAS4_R:P-SEQ-8:gtggcgtaggcaagagtgcgtcatctttgtatttctag attggatccagcttggac
P_KRAS5_L:P-SEQ-9:gagctcaatgagtgttggatgatatgtcagctgccaag gaatgtgataaacttgt
ggtagttggagctt
P_KRAS5_R:P-SEQ-10:tggcgtaggcaagagtgcgttacctagagtgaatcat ctagattggatcttgcc
aggtc
P_KRAS6_L:P-SEQ-11:gagatacttgagagctggataacgatgagtgcataag aacttgtggtagttgga
gctga
P_KRAS6_R:P-SEQ-12:tggcgtaggcaagagtgcgttacctagagtgaatcat ctagattagatgatgag
tgctc
P_KRAS7_L:P-SEQ-13:gagttgactactagtttaataccatctagtaggctat cataatgctaagcttac
acttgtggtagttggagctgc
P_KRAS7_R:P-SEQ-14:
tggcgtaggcaagagtgcgttaaggcttcacctagctcaatctcattgagtttctagattagaccttagtgca
ac
P_PIK3CA-E542K_L:P-SEQ-15:
gagttcactgagacatggacggcattatcagcatcagtacacaattcagaacctatgctacacgagatcctct
ctcta
P_PIK3CA-E542K_R:P-SEQ-16:
aaatcactgagcaggagaaaggtcatttatagggccagaaattgtaaaacattggtcgagcttgaagctagcg
gacac
P_PIK3CA-E545K_L:P-SEQ-17:gagtcctctagcggttggataacaccagac atgtatccaaggaatcc
tctctctgaaatcacta
P_PIK3CA-E545K_F:P-SEQ-18:agcaggagaaagattttgtatagcgtaagg gctagactaattctaga
ttagctctaggtagtcc
P_PIK3CA-E545G_L:P-SEQ-19:gagctcctactacttggatgtctatacgcc tcgtcctctctctgaa
atcactgg
P_PIK3CA-E545G_R:P-SEQ-20:gcaggagaaagattttgtatgaactcagta tctagattgtcacgtgc
agcatc
P_PIK3CA-H1047R_L:P-SEQ-21:gagtctacgactgatggtagatcaatgct agaaacaaatgaatga
tgcacg
P_PIK3CA-H1047R_R:P-SEQ-22:tcatggtggctggacaacaaacagattct agattggatcttggacc
P_PIK3CA-H1047L_L:P-SEQ-23:
gagtctcctaggacttagagtcccaaagtcgtagaattcgttcgtgaaacaaatgaatgatgcact
P_PIK3CA-H1047L_R:P-SEQ-24:
tcatggtggctggacaacaaacatcgttaggctatccaagatcattctagattggatcatgcagtacac
P_BRAF-V600E_L:P-SEQ-25:
gggttccctaagggttggactctggattaacgcctacgccgtgagtagaaccgattttggtctagctacaga
P_BRAF-V600E_R:P-SEQ-26:
gcaattgagactagccttgggtcacgtcaatctggagaactttggctatgtagtctagattggatcttgctgg
cac
P_EGFR-L858R_L:P-SEQ-27:gggttccctaagggttggagataccaagatca cagataatgcatg
P_EGFR-L858R_R:P-SEQ-28:gcgatactactggatgcgtgcggaggtcatct agattggatcttgctgg
cac
P_EGFR-T790M_L:P-SEQ-29:
gggttccctaagggttggagttaatgtagactaactcatcacgtagtgcgcacttgctgggcatcctgcctgc
acctccaacgtgtagcccgtcgt
P_EGFR-T790M_R:P-SEQ-30:
gaagccattcacttggacggcgtccggactttgaccgggcacagaaagacattactggcacccagttctagat
tggatcttgctggcac
P_EXON19-WT1_L:P-SEQ-31:
gacttctatactggtaatatccttcagaagcattcaggctcgcaaacggtaagtactttagaaccgtcgacgc
tatcaaggaattaagagaag
P_EXON19-WT1_R:P-SEQ-32:
caacatctccgaaagccaacatggacatccgcgcttagagttcctactttgatgcgtcgggctcgatagctct
agatttgatgttactcgctc
P_EXON19-WT2_L:P-SEQ-33:
gagttcactaagggatgcatttaactggtctctatcgatatcttgccgtgtcgagcccttgtaggtctaagtg
catccccttagagacagcactggc
P_EXON19-WT2_R:P-SEQ-34:
ctctcccatgctggtatccaccccagggtctcgaaacgggcaaatactggcatcttcacggaagtagtctgtt
tctagataagctatggctggac 。
2. a kind of gene association detection kit as claimed in claim 1, including following operating procedure:
Template denaturation: added by template DNA in PCR pipe, is placed in PCR instrument, and arranging temperature is 95～100 DEG C, maintain 3～
10min, is cooled to 25 DEG C；
Hybridization: add MLPA Buffer and the mixture of probe in template after denaturing, the concentration of its middle probe be 0.5～
10nM；Containing Tris-HCl in MLPA Buffer, concentration is 50～500mM, pH8.2～9.0；KCl, concentration is 2～5M；
MgCl2, concentration is 0.5～5M；EDTA, concentration is 0.5～5mM；Operation hybridization procedures in PCR instrument: 95 DEG C of 1min；60℃16
～24h；
Connect: after hybridization is terminated, each PCR pipe adds ultra-pure water and ligase, PCR instrument is run and connects journey
Sequence: 50～58 DEG C 10～30min；95～100 DEG C 10～30min；It is cooled to 20 DEG C；
PCR expands: coupled reaction terminates the amplification of laggard performing PCR, adds PCR universal primer, dNTPs and Taq in each PCR pipe
Enzyme, runs PCR program in PCR instrument；
Detection: sepharose electrophoresis, polyacrylamide gel electrophoresis and the nucleic acid fragment of capillary electrophoresis detection amplification can be used.
3. a kind of gene association detection kit as claimed in claim 1, detected sample includes fresh pathological tissue, paraffin
Embedding pathological tissue, paraffin section, saliva, sputum, urine and blood.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410849552.XA CN104480215B (en) | 2014-12-30 | 2014-12-30 | A kind of gene association detection method and test kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410849552.XA CN104480215B (en) | 2014-12-30 | 2014-12-30 | A kind of gene association detection method and test kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104480215A CN104480215A (en) | 2015-04-01 |
| CN104480215B true CN104480215B (en) | 2016-12-07 |
Family
ID=52754817
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410849552.XA Active CN104480215B (en) | 2014-12-30 | 2014-12-30 | A kind of gene association detection method and test kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104480215B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106566880A (en) * | 2016-11-02 | 2017-04-19 | 哈尔滨星云生物信息技术开发有限公司 | Hereditary hearing loss gene mutation detection kit |
| CN108287984A (en) * | 2018-01-17 | 2018-07-17 | 张明鑫 | The accurate processing method of polygene combined faeces DNA DNA methylation assay data |
| CN108118092A (en) * | 2018-01-17 | 2018-06-05 | 王景杰 | The processing method of polygene combined faeces DNA DNA methylation assay data |
| CN112553310A (en) * | 2020-08-07 | 2021-03-26 | 中国医学科学院血液病医院(中国医学科学院血液学研究所) | Method and kit for detecting cytogenetic abnormality by applying MLPA (MLPA) |
-
2014
- 2014-12-30 CN CN201410849552.XA patent/CN104480215B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN104480215A (en) | 2015-04-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP3090068B1 (en) | Method and kit for non-invasively detecting egfr gene mutations | |
| CN103382503B (en) | EGFR gene 19 exon 19 kinds of deletion mutantion detection kit and detection method | |
| CN106591438B (en) | Nucleic acid combination, kit and application for detecting Her2 gene | |
| CN103114133B (en) | Probe, primer and detection kit for detecting C-KIT gene mutation | |
| EP3334834A1 (en) | Method of preparing cell free nucleic acid molecules by in situ amplification | |
| CN104480215B (en) | A kind of gene association detection method and test kit | |
| WO2015153732A2 (en) | Use of double-stranded dna in exosomes: a novel biomarker in cancer detection | |
| WO2014028862A1 (en) | Use of dna in circulating exosomes as a diagnostic marker for metastasic disease | |
| CN104372103A (en) | NRAS gene mutation detection kit | |
| CN105039514A (en) | Detection kit for human BRAF gene V600E mutation | |
| CN102533958A (en) | Method and kit for detecting human PIK3CA gene mutation | |
| CN105002283A (en) | QPCR composition used for detecting c-kit gene mutation of people and reagent kit | |
| CN104372102A (en) | Reagent kit used for testing PIK3CA (phosphatidylinositol-4,5-bisphosphate3-kinase, catalytic subunit alpha) gene mutations | |
| CN103773837A (en) | Fluorescent quantitation PCR detection kit and detection method for PIK3CA (phosphatidylinositol3-kinase catalytic alpha) gene mutations | |
| CN108410982A (en) | A kind of kit based on 34 mutational sites of MALDI-TOF-MS detection lung cancer | |
| CN106148497A (en) | BRAF gene mutation detection kit and application thereof | |
| JP2016510982A (en) | Methods and compositions for detecting human PI3KCA (PIK3CA) gene mutations | |
| CN106086169B (en) | Primer for detecting EGFR genetic mutation in microcomponent combines and its application | |
| CN106755551A (en) | A kind of EGFR/L858R is mutated liquid biopsy kit and its application | |
| CN102443626A (en) | Detection kit for lung cancer driving gene mutation | |
| CN106011253B (en) | Primer for detecting PDGFRA gene mutation in microcomponent combines and its application | |
| CN103589795B (en) | Kit for detecting polymorphism of gene related to munity of lung cancer and chemosensitivity and application of kit | |
| CN105969876B (en) | Primer for detecting C-KIT gene mutation in microcomponent combines and its application | |
| CN105969875B (en) | Primer for detecting PIK3CA gene mutation in microcomponent combines and its application | |
| CN105969877B (en) | Primer for detecting BRAF gene mutation in microcomponent combines and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Zhou Xiwu Inventor after: Tang Tao Inventor before: Tang Tao Inventor before: Zhou Xiwu |
|
| COR | Change of bibliographic data | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CB03 | Change of inventor or designer information |
Inventor after: Yu Ning Inventor after: Liang Jianjia Inventor after: He Fajian Inventor after: He Xinliu Inventor after: Liu Piqiong Inventor before: Zhou Xiwu Inventor before: Tang Tao |
|
| CB03 | Change of inventor or designer information | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20171214 Address after: 530000 the Guangxi Zhuang Autonomous Region Jiangnan District of Nanning goodcan Road No. 19 U lianxun Valley Science and Technology Park building A room 319 Patentee after: Nanning Wilke Biotechnology Co., Ltd. Address before: 315040 business building, No. 66, academician Road, Ningbo, Zhejiang Province, 532 Patentee before: NINGBO UNIGENEDX BIO-PHARMACEUTICAL CO., LTD. |
|
| TR01 | Transfer of patent right |