CN109837341A - A kind of detection method and its primer sets of mgmt gene promoter methylation - Google Patents
A kind of detection method and its primer sets of mgmt gene promoter methylation Download PDFInfo
- Publication number
- CN109837341A CN109837341A CN201711216625.1A CN201711216625A CN109837341A CN 109837341 A CN109837341 A CN 109837341A CN 201711216625 A CN201711216625 A CN 201711216625A CN 109837341 A CN109837341 A CN 109837341A
- Authority
- CN
- China
- Prior art keywords
- methylation
- mgmt gene
- mgmt
- gene promoter
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to molecular biology gene technology field and medical domains, specifically disclose the detection method and its primer sets of a kind of mgmt gene promoter methylation.The present invention analyzes mgmt gene promoter CpG island methylation, designs corresponding primer sets, after carrying out methylation status of PTEN promoter (MSP) amplification to sample genomic dna, is detected with Ion Torrent semiconductor chip sequencing technologies.Detection method of the invention has flux big, specificity and high sensitivity, as a result stable, reproducible, detects fireballing advantage.A quick, reliable and accurate new way is provided for the detection of mgmt gene promoter methylation, test, analysis and assessment, so that the personalized medicine for screening sensitive individual is provided fundamental basis.
Description
Technical field
The present invention relates to molecular biology gene technology field and medical domain, it is related to being detected with molecular biology method
The degree of mgmt gene promoter CpG island methylation, in particular to Ion Torrent semiconductor chip sequencing technologies to MGMT
The relevant primer and its kit of promoter CpG island methylation degree progress qualitative and quantitative analysis.
Background technique
Malignant glioma is one of mankind's refractory neoplasm, although the treatment method of glioma is via single hand
Art treatment develop to the complex treatments such as postoperative irradiation and the chemotherapy of today, but in the past few decades in, malignant brain tumor suffer from
The prognosis of person is not significantly improved, and drug resistance is the main reason for chemotherapeutic efficacy is bad.
Some research datas have confirmed DNA repair enzyme O6Methyl guanine-dnmt rna (O6-
Methylguanine-DNA methyltransferase, MGMT) killing of the alkylating agent to tumour cell can be inhibited.And
The expression of MGMT and the activity of mgmt gene are closely related.The activity of mgmt gene is controlled by a promoter, in tumour
Mgmt gene promoter methylation can make mgmt gene silencing in cell, to no longer generate MGMT.In brain glioblastoma cell
Whether middle detection mgmt gene promoter methylates, it can be determined that it is sensitive whether tumour cell generates alkylating agent, thus into one
Step judges the treatment curative effect of alkanisation class drug.
Alkylating agent is a kind of very high reaction molecular, can lead to cell death and in conjunction with DNA.Alkylation exists
The upper most common action site of DNA is the O of guanine6Position, alkylation makes adjacent two chain of DNA constitute friendship herein
Fork connection, this explains why alkylating agent can kill tumour cell.Between the double-stranded DNA be made of alkylating agent effect
Interconnection can be by O6Methyl guanine-dnmt rna MGMT inhibits.Mgmt protein can be in the O of guanine6Position
Promptly reversion alkylation is set, to avoid the composition of this fatal interconnection.A kind of mechanism in this way, MGMT can draw
Body is played to the drug resistance of alkanisation class drug.
MGMT level be very different between different types of tumour, or even same type Different Individual it
Between there is also differences.For example, about 30% glioma lacks MGMT, the defect of this enzyme increases brain tumor to alkanisation
The sensitivity of class drug.Because what mgmt gene usually will not be mutated or lack, the scarcity of MGMT is essentially due to cell
Caused by the change of middle gene information.
In the mankind, DNA methylation is a kind of major type of epigenetic modification, and is played very in tumour generation
Important role.In particular, being located at tumor suppression and DNA on the island referred to as CpG (cytidine phosphate guanosine)
The common non-methylation sites of the promoter region of revision points, these sites and primary tumor are closely related.MGMT base
Because the methylation on the island CpG prevents the transcription of mgmt gene.
Temozolomide (Temozolomide, TMZ) takes orally antitumor alkanisation class drug as the second generation, by testing and facing
Bed research has shown which raises survival rate, qualities of life that astrocytoma patient is deformed between glioblastoma multiforme, prolongs
It has grown without tumour progression life cycle, has reduced recurrence rate, disability rate and the death rate.Have at present due to some patientss to it certain
Drug resistance and adverse reaction, therefore carried out from methylation state of the angle of molecular biology to mgmt gene promoter CpG island
Analysis judges that the indication of Therapeutic Effect of Temozolomide glioma and drug resistance just seem most important to help.One kind can be square
Just the methylation state for efficiently detecting mgmt gene promoter CpG island, the prognosis for improving patient have highly important
Meaning.
Ion Torrent semiconductor chip sequencing technologies are the sequencing technologies of a new generation, its core technology is using half
Conductor technology establishes direct connection between chemistry and digital information.It is fixed on the microballoon in the micropore of semiconductor chip
DNA chain then successively mixes mononucleotide dATP, dCTP, dGTP, dTTP.With the incorporation of each base, H is released+, H+?
They can be detected when passing through each hole bottom, by H+Detection, real-time interpretation base.Since its chemistry sequencing is former
It is simple to manage nature, literalness nucleotide, without laser or optical detection apparatus, thus can reach minimum sequencing deviation and go out
The sequencing of color covers equilibrium degree, and an instrument can be suitble to the scientific research of various sequencing throughput demands, in a relatively short period of time
Obtain true and reliable experimental result.
Compared with conventional sequencing technology, Ion Torrent technology has following Ion Torrent semiconductor chip sequencing technologies
Advantage: system is without laser light source, no optical system, no photographic system；It is sequenced using unmarked nucleotide and enzyme, background
It interferes low；By to H+Detection, base interpretation accuracy can be improved；Sequencing throughput is big, speed is fast, completes 1G flux
Sequencing detection only needs 2 ~ 3 hours, is thousands of times or more of traditional sequencing methods flux, while compensating for existing two generations high pass and measuring
Sequence method working time too long defect；In addition, quantitative detection may be implemented in the big flux sequencing of Ion Torrent technology, realize
To the quantitative detection of tumor-related gene methylation, the sensitivity of detection is improved, the false negative rate of common detection methods is reduced.
It there is no report Ion Torrent semiconductor chip sequencing technologies dedicated for mgmt gene promoter CpG island at present
The detection that methylation and alkanisation class drug Temozolomide judge glioma medication curative effect.
Summary of the invention
The purpose of the invention is to make up the deficiencies in the prior art, provide a kind of for mgmt gene promoter CpG island
Methylation state carry out qualitative and quantitative analysis method and its primer sets.
To solve the above problems, the present invention takes following technical scheme:
It is gained knowledge and relevant bioinformatics software using biological information, to the mgmt gene that can be retrieved in public database
Promoter CpG island sequence site, with 5.0 software design PCR primer of Primer Premier.
It is by SEQ ID NO:1 in sequence table and SEQ ID for detecting the primer of mgmt gene promoter CpG island sequence
The primer pair of NO:2 composition.
Upstream primer: the SEQ ID of 5 '-agggagtggtgagtttcggatatgttgggatagt -3 ' No:1
Downstream primer: the SEQ ID of 5 '-acaacccaaacactcaccaaat -3 ' No:2.
PCR amplification is carried out to sample to be detected with above-mentioned primer sets using the method for methylation status of PTEN promoter.
It is micro- that pcr amplification product is subjected to the amplification building of sublibrary, ISP(Ion Sphere Particles, Ion
Ball) template preparation, be sequenced in Ion Torrent PGM system, and related sequencing sequence is analyzed with software.
The present invention is using methylation status of PTEN promoter method combination Ion Torrent semiconductor chip sequencing technologies to GMGT
Gene methylation site is detected, it is advantageous that flux is big, specificity and high sensitivity are as a result stable, reproducible, inspection
The fast advantage of degree of testing the speed.
Specific embodiment
The present invention is described further in conjunction with specific embodiments.It should be understood that these embodiments are for illustration purposes only, without
For limiting the scope of the invention.
Embodiment 1, for the DNA methylation assay design of primers of mgmt gene promoter CpG island sequence.
It is gained knowledge and relevant bioinformatics software using biological information, to the GMGT that can be retrieved in public database
The methylation sites of Gene Promoter CpG Island sequence, with 5.0 software design PCR primer of Primer Premier, primer sequence
Are as follows:
Upstream primer: the SEQ ID of 5 '-agggagtggtgagtttcggatatgttgggatagt -3 ' No:1
Downstream primer: the SEQ ID of 5 '-acaacccaaacactcaccaaat -3 ' No:2.
Barcode sequence 5 '-of the end of upstream primer 5 ' of detection site comprising one section of sample information for identification
AGGGAGTGGT-3’。
Embodiment 2, mgmt gene promoter CpG island sequence DNA methylation assay.
1) acquisition of sample genomic dna.
Genomic DNA is extracted from tumour fresh surgical tissue, puncturing tissue or paraffin organization.Tumour fresh surgical tissue
Or puncturing tissue extracts DNA with cell cracking method, and 400 μ L cell lysis buffer solution (10mmol/ will be added after tissue freeze grinding
L Tris-HCl, pH8.0; 0.1mol EDTA, pH8.0;0.5%SDS), it mixes in 50 DEG C of water-baths of postposition and incubates 30min；
After being cooled to room temperature plus isometric phenol-chloroform-isoamyl alcohol (volume ratio 25:24:1), mixing are stored at room temperature 5000 after 10min
× g is centrifuged 10min；Upper strata aqueous phase is shifted into another centrifuge tube, is repeated phenol-chloroform-isoamyl alcohol extraction 1 time；Retransfer upper layer
Water phase adds the 3M NaAc (pH5.2) of 1/10 volume into another centrifuge tube, mixes；95% cold ethyl alcohol of 2.5 times of volumes is added,
It mixes, -20 DEG C of precipitating DNA30min；10000 × g is centrifuged 15min, abandons supernatant；The cold ethyl alcohol cleaning of 1mL70% is added to precipitate, 10000
× g is centrifuged 15min, abandons supernatant；37 DEG C of incubator 30min drying；DNA precipitating is dissolved in 50 μ L TE buffers.Paraffin embedding group
It knits and then extracts genomic DNA with paraffin-embedded tissue DNA rapidly extracting kit (Tiangeng).Extracting gained genomic DNA is used
Ultraviolet specrophotometer surveys OD value and analyzes 4 DEG C of postposition temporary or -20 DEG C of long-term preservations.
2) PCR amplification and sequencing of methylation specific.
The sample genomic dna extracted using step 1) uses EZ DNA Methylation-Gold Kit (EZ as template
DNA methylation kit-Gold, Zymo research production) a C-T transformation experiment is carried out, gained after being converted using C-T
Sample under the guidance of the primer described in embodiment 1, carries out the PCR reaction an of methylation-specific, amplification program: (95 DEG C
5 min;95 DEG C of 15 s, 60 DEG C of 1 min, totally 40 recycle), the amplified production of acquisition successively carries out the structure of amplification sublibrary
Build, ISP(Ion Sphere Particles, Ion microballoon) preparation of template and chip loading and in Ion Torrent
It is sequenced in PGM system.
3) it analyzes and obtains conclusion.
Sequencing result is analyzed with IGV2.0 software, counts GMGT promoter CpG island methylation detection site
Sequencing quantity, including each site do not methylate T sequencing quantity and methylate C sequencing quantity:
When carrying out the methylation percentage interpretation in genetic test site, the sequencing number that should meet each genetic test site be should be greater than
Or it is equal to 500, the corresponding gene site mutation ratio that ability statistic mixed-state arrives；The sequencing number in such as site is not sentenced then less than 500
It reads.
The sequencing number (C) of methylation percentage (R)=methylated form/number (C+T) always is sequenced) × 100%
Methylate percentage evaluation of classification: R >=it 4% is strong methylation；R >=2% be weak methylation；R < 2% is not methylate.
This detection detects 1 sample altogether, and testing result and conclusion see the table below.
| Gene | Gene loci | Methylation ratio (methylation sequencing number/sequencing sum) | Remarks |
| MGMT | CpG1 | 32.89% (196/596) | |
| MGMT | CpG2 | 60.00%(360/600) | |
| MGMT | CpG3 | 59.06% (352/596) | |
| MGMT | CpG4 | 61.07% (364/596) | |
| MGMT | CpG5 | 18.79% (112/596) | |
| MGMT | CpG6 | 59.73% (356/596) | |
| MGMT | CpG7 | 60.40% (360/596) | |
| MGMT | CpG8 | 63.76% (380/596) | |
| MGMT | CpG9 | 58.39% (348/596) | |
| MGMT | CpG10 | 58.39% (348/596) | |
| MGMT | Average methyl degree | 53.25% |
Testing result shows that apparent methylation, the tested island MGMT CpG has occurred in the island CpG of examinee's mgmt gene
Average methyl degree is in 53.25%(18.78%-63.76%), for strong methylation.
Sequence table
<110>Shanghai joins Co., Ltd, lucky medical test institute
<120>a kind of detection method and its primer sets of mgmt gene promoter methylation
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 34
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
agggagtggt gagtttcgga tatgttggga tagt 34
<210> 2
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
acaacccaaa cactcaccaa at 22
Claims (3)
1. a kind of detection method and its primer sets of mgmt gene promoter methylation, specific steps are as follows:
It is gained knowledge and relevant bioinformatics software using biological information, to the mgmt gene that can be retrieved in public database
Promoter CpG island sequence information, with 5.0 software design PCR primer of Primer Premier；
C-T conversion and PCR amplification are carried out to sample genomic dna to be detected using methylation status of PTEN promoter (MSP) method；
Pcr amplification product is carried out to the building of amplification sublibrary, ISP(Ion Sphere Particles, Ion microballoon) mould
The preparation of plate is sequenced in Ion Torrent PGM system, and is analyzed with software related sequencing sequence.
2. a kind of detection method and its primer sets of mgmt gene promoter methylation as described in claim 1, it is characterised in that
One group of methylation status of PTEN promoter primer, sequence are respectively as follows: SEQ ID No:1- SEQ ID No:2:
5'- agggagtggtgagtttcggatatgttgggatagt -3' SEQ ID No: 1；
5’- acaacccaaacactcaccaaat -3’ SEQ ID No: 2。
3. a kind of detection method and its primer sets of mgmt gene promoter methylation as described in claim 1, it is characterised in that
One group of methylation status of PTEN promoter primer forms a kind of kit for detecting mgmt gene promoter methylation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711216625.1A CN109837341A (en) | 2017-11-28 | 2017-11-28 | A kind of detection method and its primer sets of mgmt gene promoter methylation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711216625.1A CN109837341A (en) | 2017-11-28 | 2017-11-28 | A kind of detection method and its primer sets of mgmt gene promoter methylation |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109837341A true CN109837341A (en) | 2019-06-04 |
Family
ID=66881067
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711216625.1A Pending CN109837341A (en) | 2017-11-28 | 2017-11-28 | A kind of detection method and its primer sets of mgmt gene promoter methylation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109837341A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111440852A (en) * | 2019-11-20 | 2020-07-24 | 北京爱普拜生物技术有限公司 | Kit and method for detecting methylation sites of DMR2 region of MGMT gene promoter through multiple probes |
| CN112646808A (en) * | 2020-12-25 | 2021-04-13 | 嘉兴允英医学检验有限公司 | Primer, kit and method for detecting MGMT methylation |
| CN113817805A (en) * | 2021-09-26 | 2021-12-21 | 南京兔牙生物科技有限公司 | MGMT promoter methylation detection method, primer group and kit |
-
2017
- 2017-11-28 CN CN201711216625.1A patent/CN109837341A/en active Pending
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111440852A (en) * | 2019-11-20 | 2020-07-24 | 北京爱普拜生物技术有限公司 | Kit and method for detecting methylation sites of DMR2 region of MGMT gene promoter through multiple probes |
| CN112646808A (en) * | 2020-12-25 | 2021-04-13 | 嘉兴允英医学检验有限公司 | Primer, kit and method for detecting MGMT methylation |
| CN113817805A (en) * | 2021-09-26 | 2021-12-21 | 南京兔牙生物科技有限公司 | MGMT promoter methylation detection method, primer group and kit |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104630375B (en) | Cancer gene is mutated and gene magnification detection | |
| KR101940657B1 (en) | System for predicting prognosis and group classification based on gastric cancer reveal subtype-associated biological implication | |
| CN109797197A (en) | It a kind of single chain molecule label connector and single stranded DNA banking process and its is applied in detection Circulating tumor DNA | |
| JP2022519159A (en) | Analytical method of circulating cells | |
| CN104805208B (en) | For detecting the primer combination of probe thing, kit and detection method of 7 kinds of hot spot mutations of mankind KRAS genes | |
| JP6968894B2 (en) | Multiple detection method for methylated DNA | |
| CN108004301A (en) | Gene target region enrichment method and build storehouse kit | |
| JP2009523410A (en) | Effect of inhibitors of FGFR3 on gene transcription | |
| CN108866192A (en) | Tumor marker STAMP-EP1 based on methylation modification | |
| CN107447013B (en) | Method for detecting mutation sites of codons 12 and 13 of Kras gene and kit thereof | |
| CN106399546B (en) | Capture probe and kit for detecting human circulating tumor DNA EGFR gene by high-throughput sequencing | |
| CN106520963B (en) | Capture probe and kit for detecting human circulating tumor DNA KRAS gene by high-throughput sequencing | |
| WO2014026768A1 (en) | Colorectal cancer markers | |
| CN107723354B (en) | Multiplex PCR (polymerase chain reaction) primer, kit and method for detecting non-small cell lung cancer oncogene mutation based on high-throughput sequencing | |
| CN109837341A (en) | A kind of detection method and its primer sets of mgmt gene promoter methylation | |
| CN108342477A (en) | Detection kit based on multiple gene diagnosis patients with lung cancer | |
| CN108866191A (en) | Tumor marker STAMP-EP2 based on methylation modification | |
| CN105671187B (en) | Group of genes for molecular typing of head and neck squamous cell carcinoma and application thereof | |
| CN102776286A (en) | Primer, probe and assay kit for detecting v-ros avian UR2 sarcoma viral oncogene homolog 1 (ROS1) gene fusion mutation | |
| CN108456721A (en) | Synchronous detection gene mutation and the method and its application to methylate | |
| CN112662763A (en) | Probe composition for detecting common amphoteric cancers | |
| CN102766689B (en) | Sequencing method for increasing sequencing reading length | |
| CN107937524A (en) | Mankind's KRAS gene mutation detection kit and detection method | |
| CN111057763B (en) | Kit for detecting susceptibility genotyping of human breast cancer, and use method and application thereof | |
| EP2843047B1 (en) | Nucleic acid detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20190604 |