CN111440852A

CN111440852A - Kit and method for detecting methylation sites of DMR2 region of MGMT gene promoter through multiple probes

Info

Publication number: CN111440852A
Application number: CN201911139568.0A
Authority: CN
Inventors: 龚建; 于祥春; 穆珑丹; 黄慧; 冯晓燕; 林挺
Original assignee: Beijing Apex Biotechnology Co ltd
Current assignee: Beijing Apex Biotechnology Co ltd
Priority date: 2019-11-20
Filing date: 2019-11-20
Publication date: 2020-07-24
Anticipated expiration: 2039-11-20
Also published as: CN111440852B

Abstract

The invention provides a kit and a method for detecting a methylation site of a DMR2 region of an MGMT gene promoter by multiple probes. The kit comprises: mixture of 2 primer pairs and 5 probes for detecting the DMR2 region of MGMT promoter, digital PCR master mix, luciferase, ddH₂O and a calibration file. The kit and the method amplify the region of the MGMT promoter DMR2 by using degenerate primers designed aiming at the MGMT gene, simultaneously detect all 16 CpG island enrichment regions in the region of the MGMT gene promoter DMR2 by using a plurality of probes, and calibrate a fluorescence signal by introducing a calibration file, thereby avoiding false negative results caused by different methylation states of the sample CpG island enrichment regions, and greatly improving the detection accuracy and the detection rate.

Description

Kit and method for detecting methylation sites of DMR2 region of MGMT gene promoter through multiple probes

Technical Field

The invention relates to a kit and a method for detecting a methylation site in a DMR2 region of an MGMT gene promoter by multiple probes, belonging to the technical field of biomedical nucleic acid detection.

Background

The brain glioma is the most common primary intracranial tumor, the malignancy degree is high, the median total survival time is less than 15 months, the annual incidence rate of the brain glioma in China is 5-8 people/10 ten thousand, and the 5-year mortality rate is second to pancreatic cancer and lung cancer. About 30% of patients with brain glioma have a deletion of MGMT (O6-methylguanine-DNA-methyltransferase) protein, a DNA repair protein that is ubiquitous in human cells and whose coding gene is located on chromosome 10q26.3, 170kb in length, and consists of 5 exons and 4 introns. The primary function of the MGMT protein is to protect cells from the mutagenic, carcinogenic, and cytotoxic effects of alkylating agents by irreversibly transferring the alkylating group from O6-mG to the cysteine residue at position 145 of the MGMT protein. The MGMT gene is usually not mutated or deleted, and this phenomenon causing MGMT protein deletion may be caused by a modification change of the gene, and methylation of the gene is a major type of epigenetic modification of the gene. Methylation often occurs in CpG islands in the promoter region of genes, the CpG island in the promoter of MGMT gene has two main regions, DMR1 and DMR2, and when the DMR1 region is methylated, the DMR2 region is also methylated. Several methylation sites in the DMR2 region were shown to play a crucial role in the transcription of the MGMT gene, and therefore the DMR2 region was considered as the best target for methylation analysis on the MGMT gene promoter. As early as 2012, chinese central nervous system glioma diagnosis and treatment guidelines recommend testing patients for MGMT gene methylation status to guide the selection of chemotherapeutic drugs. Further, the "chinese brain glioma molecular diagnosis and treatment guideline" issued in 2014 clearly indicates that: glioma patients with MGMT gene methylation are more sensitive to chemotherapy and radiotherapy, and the treatment effect by Temozolomide (TMZ) is better. Therefore, the method can be used for rapidly and accurately detecting whether the glioma patient has methylation in the region of the MGMT gene promoter DMR2, and has important guiding significance for formulating a reasonable administration scheme and improving the curative effect of the drug. At present, the detection technology of the methylation site of the DMR2 region of the MGMT gene promoter mainly comprises four methods: 1. a gene chip method; 2. sequencing methods, and methylation detection methods based on sequencing include direct pyrosequencing, Bisulfite Sequencing PCR (BSP), and second-generation sequencing; 3. a Methylation-Sensitive restriction enzyme (MS-RE) method; 4. methylation-specific PCR (MSP) method; 5. fluorescence probe method. The gene chip method and the sequencing method are generally complicated in detection process, long in period, difficult in result interpretation and high in price; the MS-RE method has high false positive and limited endonuclease types; the MSP method is a classical method for detecting the methylation state of a gene, only a primer is used for amplifying a target fragment, two known regions containing a plurality of completely methylated or unmethylated CpG sites are needed during primer design, but the CpG sites of the MGMT gene promoter DMR2 region with the characteristics are not many, so that the use of MSP is limited; the fluorescence probe method is based on a fluorescence quantitative PCR or digital PCR platform and combines a Taqman fluorescence probe to detect a sample, so that the detection sensitivity and specificity are improved. The currently known methods for detecting methylation sites by using a fluorescence probe method can be divided into two types, wherein the first method is detection by combining an MSP primer with a general probe or a methylation specific probe. For example, the CN102424857A document discloses the quantitative detection of methylated DNA template by using methylated primers P1/P2 in combination with Taqman universal probe, and the quantitative detection of unmethylated DNA template by using unmethylated primers P3/P4 in combination with Taqman universal probe, wherein forward and reverse primers of two pairs of primers cover 5 and 4 CpG islands respectively. The method can detect 3 CpG island enrichment areas positioned in a primer area and a probe area at most, and the detection method is mainly obtained by identifying methylation through primer design and combining primers and carrying out PCR amplification only if methylation states exist in forward and reverse primer coverage areas, so that the method can detect methylation positivity generally depending on methylation of all sites in a detection area, and a sample with methylation in a part of the area has a missed detection result; the second method is detection by combining a universal primer and a methylation specific probe. For example, in the CN105463096A document, a general forward primer a and a reverse primer b are designed within about 200bp range upstream and downstream of an MGMT gene promoter methylation detection region, and a methylation specific detection probe c is designed for an MGMT gene promoter methylation detection region, wherein the probe covers 5 CpG islands, this method mainly identifies methylation sites through the specific probe, so that detection of a CpG island enrichment region is emphasized, that is, the methylation state of a CpG island covered by a methylation specific probe determines whether a sample is methylated or not, because of the restriction of the design length of the probe, the region can only cover a limited number of CpG islands, and the methylation island state far away cannot be detected. However, from the sequencing results of a large number of methylation sites, it is found for the first time that the methylation levels of the individual CpG islands in the sample judged to be positive for methylation are not consistent, and the result that some CpG island enriched regions are negative for methylation appears, so that all sites which are possibly methylated are necessarily detected for judging the methylation site state of the DMR2 region of the MGMT gene promoter, and the fluorescence probe method related to the methylation detection of the DMR2 region of the MGMT gene promoter by adopting the method one or the method two is often caused by a large number of false negative results because the detection region is incomplete. This undesirable result can be eliminated if multiple probes of different methylation sites are mixed for simultaneous detection.

However, when a sample is detected by using multiple probes at present, both a fluorescence quantitative PCR method and a digital PCR method have the phenomenon that background fluorescence signals and positive sample fluorescence signals are mixed together and cannot be distinguished due to non-specific combination or competition of primers or probes, multi-channel fluorescence penetration and other reasons, and the occurrence of the phenomenon can cause great interference on a detection result. Particularly, for the fluorescent quantitative PCR platform, there is no capability of correcting mutual interference of fluorescence, so that when the fluorescent quantitative PCR is detected by using multiple primers and multiple probes, the detection result cannot be analyzed due to strong mutual interference between fluorescent signals. The digital PCR platform has certain calibration capability on interference among fluorescent signals through software, but calibration files in the currently known digital PCR detection platform are fixed and unadjustable, and cannot be flexibly adjusted according to the change of detection conditions in the experimental process, so that the problem that the fluorescent signals interfere with each other when multiple probes are detected still cannot be solved, the fluorescent signals are mixed together and cannot be distinguished, and the detection result cannot be determined.

Disclosure of Invention

Aiming at the problems existing in the detection of the methylation state of MGMT gene at present, one of the purposes of the invention is firstly to use the calibration file carried in the kit of the invention to overcome the phenomenon of strong interference of fluorescence signals existing in the multi-primer and multi-probe detection system of the existing fluorescence quantitative PCR and digital PCR, thereby ensuring the accuracy of the detection result to the maximum extent; the invention also aims to overcome the phenomenon of a large number of false negative results in the detection of the methylation site of the DMR2 region of the MGMT gene promoter by the conventional detection method, and designs and provides a kit and a method for detecting the methylation site state of the DMR2 region of the MGMT gene promoter by multiple probes. The kit and the method completely cover the methylation sites in the DMR2 region of the MGMT gene promoter, and have the advantages of simple operation, high sensitivity and high accuracy, and the occurrence of false negative results is greatly reduced. So far, a method for detecting the methylation site of the DMR2 region of the MGMT gene promoter by multi-probe anchoring has not been reported internationally, so that the method has extremely high innovation and application value.

In a first aspect of the present invention, there is provided a primer pair for determining methylation sites of the DMR2 region of MGMT gene promoter, wherein the primer pair consists of SEQ ID NO: 1 and SEQ ID NO: 2 is shown in the sequence of the sequence; the nucleotide sequence of SEQ ID NO: 1 is 5'-GTTTYGGATATGTTGGGATAG-3', wherein the 5 th base is degenerate Y; the nucleotide sequence of SEQ ID NO: 2 is 5'-AAAACCACTCRAAACTACCAC-3', wherein the 11 th base is a degenerate base R.

In a second aspect of the present invention, there is provided a probe set for determining the methylation site of the DMR2 region of the MGMT gene promoter, said probe set consisting of SEQ ID NO: 3. SEQ ID NO: 4. SEQ ID NO: 5. SEQ ID NO: 6; the nucleotide sequence of SEQ ID NO: 3 is 5'-CGAACGTCGAAACGCAAAACG-3', and the sequence shown in SEQ ID NO: 4 is 5'-CGCAAACGATACGCACCGCG-3', and the sequence shown in SEQ ID NO: sequence 5 is 5'-CCGAAAACGAAACGACCCAAAC-3', and the sequence shown in SEQ ID NO: sequence 6 is 5'-CGTCCCGAAAAAAAACTCCGCAC-3'; the 5' end of the probe is modified by a fluorescent group, and the fluorescent group comprises any one of FAM, HEX or VIC; the 3' end of the probe is modified by a quenching group, and the quenching group comprises any one of BHQ1, BHQ2 or MGB.

The third aspect of the invention provides a primer pair and a probe for determining β -actin gene, wherein the primer pair consists of primers with sequences shown in SEQ ID NO. 7 and SEQ ID NO. 8, the probe is a sequence shown in SEQ ID NO. 9, the 5 'end of the detection probe is modified by a fluorescent group, the fluorescent group comprises any one of FAM, HEX or VIC, the 3' end of the probe is modified by a quenching group, and the quenching group comprises any one of BHQ1, BHQ2 or MGB.

In the fourth aspect of the invention, a kit for detecting the methylation site of the DMR2 region of the MGMT gene promoter through multiple probes is provided, and the kit contains a mixture of 2 pairs of primer pairs and 5 probes, a digital PCR premix, fluorescein sodium salt, ddH₂O and a calibration file.

In a fifth aspect of the invention, there is provided a chemotherapeutic regimen for determining the methylation site status of the region based on the MGMT gene promoter DMR2, comprising: (1) extracting genome DNA from a sample to be detected; (2) carrying out methylation conversion treatment on the genome by using bisulfite to serve as a PCR reaction template; (3) primer and probe mixed solution, digital PCR premixed solution, fluorescein sodium salt and ddH added into the kit₂And (4) after the digital PCR amplification is finished, introducing a calibration file and counting the copy number of the amplification product, wherein the copy number of the amplification product of the MGMT gene promoter DMR2 region methylation site is abbreviated as M, and the copy number of the amplification product of the β -action gene is abbreviated as A, when the M/A is more than or equal to 3 percent, the methylation site state of the MGMT gene promoter DMR2 region of the sample is considered as positive, and when the M/A is less than 3 percent, the methylation site state of the MGMT gene promoter DMR2 region of the sample is considered as negative.

The sixth aspect of the invention provides a kit and a method for detecting the methylation sites of the region of the MGMT gene promoter DMR2 by multiple probes, which are suitable for a droplet-type digital PCR instrument and a chip-type digital PCR instrument.

The kits and methods of the invention are further described below:

the kit and the method are technically characterized in that the fluorescent signal result of the blank control of the detected sample is used as a calibration file, and the fluorescent signal of the detected sample is corrected by using the calibration file, so that the phenomenon that the detection result cannot be determined due to the fact that the fluorescent signals cannot be distinguished because of the addition of multiple primers and multiple probes in a detection system is avoided to the greatest extent.

The second technical characteristic of the kit and the method is that degenerate primer pairs are used for amplifying chr10 on human chromosome 10: 131265471-131265636 region of MGMT gene promoter DMR2 region, the degenerate primer is used because the degenerate primer can amplify the region of MGMT gene promoter DMR2 region methylation site and non-methylation site simultaneously, which can solve the problem of the limitation of region selection caused by primer design in MSP method on one hand, and also solve the problem of false negative result caused by the inability to recognize and amplify methylation site depending on specific primer amplification on the other hand.

The third technical characteristic of the kit and the method of the invention is that multiple probes are used for simultaneously detecting the region of MGMT gene promoter DMR2, namely the region is located on the chromosome 10 of human and is chr 10: 131265507, 131265514, 131265519, 131265522, 131265526, 131265536, 131265538, 131265543, 131265548, 131265554, 131265575, 131265580, 131265586, 131265596, 131265609 and 131265614 are all 16 methylation sites with CpG island enrichment region characteristics, so that false negative results of detection of methylation sites in the region of the MGMT gene promoter DMR2 due to different methylation sites in the CpG island enrichment region of the sample are avoided, and the detection rate is greatly improved.

The detection rate of the MGMT gene promoter DMR2 regional methylation sites of the tissue sample and the cerebrospinal fluid sample by using the kit and the method provided by the invention is 100%, and the situations of detection omission and false detection do not occur.

Drawings

FIG. 1 is an indicator diagram of the anchoring region of a methylation site detection probe in the DMR2 region of the MGMT gene promoter according to the present invention. Wherein the detection probe SEQ ID NO.3(MGMT-P1) is anchored chr 10: 131265507, 131265514, 131265519, 131265522, 131265526 sites, covering 5 CpG islands; detection probe SEQ ID NO.4(MGMT-P2) anchored chr 10: 131265536, 131265538, 131265543, 131265548, 131265554 sites, covering 5 CpG islands; detection probe SEQ ID NO.5(MGMT-P3) anchored chr 10: 131265575, 131265580, 131265586 sites, covering 3 CpG islands; detection probe SEQ ID NO.6(MGMT-P4) and chr 10: 131265596, 131265609, 131265614, covering 3 CpG islands.

FIG. 2 is a graph showing the amplification of the methylation sites of the MGMT gene promoter DMR2 region by using a multi-probe system of fluorescent quantitative PCR.

FIG. 3 is a graph showing comparison between the results of detecting the methylation site of the DMR2 region of the MGMT gene promoter using the multi-probe system of digital PCR without fluorescent signal calibration and with fluorescent signal calibration.

FIG. 4 is a 2D diagram of the kit and method of the present invention and a single probe method for detecting methylation sites of the DMR2 region of the MGMT gene promoter of tissue sample 1(S1), respectively.

FIG. 5 is a 2D diagram of the kit and method of the present invention and a single probe method for detecting methylation sites of the region DMR2 of MGMT gene promoter in tissue sample 2(S2), respectively.

FIG. 6 is a 2D diagram of the kit and method of the present invention and a single probe method for detecting methylation sites of the DMR2 region of the MGMT gene promoter of tissue sample 3(S3), respectively.

FIG. 7 is a 2D diagram of the kit and method of the present invention and a single probe method for detecting methylation sites of the DMR2 region of the MGMT gene promoter of tissue sample 4(S4), respectively.

FIG. 8 is a 2D diagram of the kit and method of the present invention and a single probe method for detecting methylation sites of the DMR2 region of the MGMT gene promoter of tissue sample 5(S5), respectively.

FIG. 9 is a 2D diagram of the kit and method of the present invention and a single probe method for detecting the methylation site of the DMR2 region of the MGMT gene promoter in cerebrospinal fluid sample 1(NS1), respectively.

FIG. 10 is a 2D diagram of the kit and method of the present invention and a single probe method for detecting the site of methylation in the DMR2 region of the MGMT gene promoter of cerebrospinal fluid sample 2(NS2), respectively.

FIG. 11 is a 2D diagram of the kit and method of the present invention and a single probe method for detecting methylation sites of the DMR2 region of the MGMT gene promoter of cerebrospinal fluid sample 4(NS4), respectively.

Detailed Description

The invention will be described in further detail with reference to the following examples, which are given by way of illustration only and do not limit the scope of the invention in any way. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and modifications may be made without departing from the spirit and scope of the invention.

Example 1 detection of methylation sites of the region of the MGMT gene promoter DMR2 using high throughput sequencing method on tissue samples from 5 patients with glioma

1. Sample information: tissue samples from 5 patients with glioma.

2. DNA extraction: extracting genomic DNA from the sample. The tissue sample extraction kit is QIAamp DNA MiniKit, the number of the kit is Cat number/ID: 51304, and the specific extraction steps refer to the kit operating instruction.

3. And (3) concentration determination: the DNA concentration was measured using a spectrophotometer.

4. Bisulfite conversion and recovery: methylcode is used in bisulfite conversion and recovery kit^TMThe Kit number of the Bisulite Conversion Kit is MECOV50, and the specific operation steps are as follows:

4.1 melting the extracted sample genome diluent on ice, mixing well, adding 200ng of DNA template into a 200 mu L sterile PCR tube, filling the volume to 20 mu L with sterile water, and marking the tube cover with the corresponding sample number.

4.2 Add 130. mu. L CT Conversion Reagent to the 20. mu. L specimen, flick the PCR tube or blow the mixed specimen using a pipette gun.

4.3 Place PCR tubes in a thermal cycler, run the program of Table 1:

TABLE 1 PCR run program

98℃	10min (degeneration)
		64℃	2.5h (bisulfite conversion)
4℃	～20h

4.4 Place the adsorption column in the collection tube and add 600. mu. L Binding Buffer.

4.5 adding the product obtained in the step 4.3 into the Binding Buffer in the step 4.4, covering the Binding Buffer, and reversing and mixing the reaction solution.

4.6 placing the collecting pipe in a centrifuge, centrifuging for 30s at the maximum rotating speed (not less than 10000g), and discarding the waste liquid.

4.7 Add 100 u L Wash buffer to the adsorption column, centrifuge for 30s at maximum speed (not less than 10000g), discard waste liquid.

4.8 adding 200 u L Desphoration Buffer in the adsorption column, standing for 15-20min at room temperature.

4.9 placing the collecting pipe in a centrifuge, centrifuging for 30s at the maximum rotating speed (not less than 10000g), and discarding the waste liquid.

4.10 Add 200 u L wash Buffer in the adsorption column, centrifuge for 30s at the maximum rotation speed (not less than 10000g), discard the waste liquid.

4.11 repeat step 4.10 wash the column again, centrifuge and place the column into a new 1.5m L centrifuge tube.

4.12 Add 10 u L Elution Buffer to the center of the adsorption column, maximum speed (. gtoreq.10000 g) centrifuge for 30s Elution of DNA product at-20 ℃.

5. Library preparation: enrichment of a methylation region to be detected of a DNA sample treated by bisulfite through two rounds of PCR amplification, addition of a sequencing joint, and collection of a DNA library with a target fragment size of about 300bp through magnetic bead purification.

6. The collected libraries were subjected to high throughput sequencing using an illumina sequencer and raw data were obtained. And (3) performing quality control on the original data through a FASTQC file, removing bases with the end quality lower than 30bp, and removing an adapter sequence and a sequencing primer sequence. The methylation sites associated with clinical samples of glioma were analyzed by bismurak software, the results of which are shown in table 2.

TABLE 2, 5 sequencing results of the methylation sites of MGMT gene promoter DMR2 region in tissue samples of glioma patients

7. And (4) analyzing results: by sequencing the methylation sites of the region of the MGMT gene promoter DMR2 from 5 tissue samples of glioma patients, the 16 methylation detection sites listed in Table 2 are all known to be associated with gliomas. The negative and positive determination method of the methylation sites of the MGMT gene promoter DMR2 region of 5 samples comprises the following steps: if chr 10: the methylation rate of any site in the CpG island in the 131265507-131265614 region is more than or equal to 20%, the methylation appears in the MGMT gene promoter DMR2 region of the sample, and the result is positive; if chr 10: and the methylation rate of all sites of the CpG island in the 131265507-131265614 region is less than 20%, and the result of the methylation site of the MGMT gene promoter DMR2 region of the sample is considered to be negative. In the detection, the coincidence rate of the tissue sample high-throughput sequencing detection result and the pyrosequencing result of 5 cases of glioma patients is 100%, wherein the sample 1, the sample 4 and the sample 5 are methylation positive samples, the sample 2 and the sample 3 are methylation negative samples, and the methylation levels of CpG islands in different positions of the same sample are different. Therefore, as can be seen from the test results of this example, if the method involved only detects one or a few of the 16 methylated sites, it is very likely to result in missed test or false negative results due to insufficient detection sites. At present, the number of methylation detection sites related in the published prior art is generally 5-6, and because the sites which can be detected are more limited due to the use of specific primers, erroneous judgment results are very easy to generate.

Example 2A kit and method for multi-probe detection of MGMT gene promoter DMR2 region methylation site for the verification of the calibration effect of the detection of fluorescent signals

1. The design of specific PCR primers and detection probe sequences for detecting multiple methylation sites in the DMR2 region of the MGMT gene promoter is shown in Table 3.

TABLE 3 detection region of MGMT gene and β -actin gene

Gene	Region of gene locus
		MGMT	chr10：131265471-131265636
β-actin	chr7：5567643-5567831

2. Obtaining a sequence: a plurality of methylation sites in the region of the promoter DMR2 of the MGMT gene related to the invention are shown in Table 4.

TABLE 4 multiple methylation sites in the region of the MGMT gene promoter DMR2

Detection probe	Containing CpG sites and positions (chr10)
		MGMT-P1	131265507、131265514、131265519、131265522、131265526
MGMT-P2	131265536、131265538、131265543、131265548、131265554
		MGMT-P3	131265575、131265580、131265586
MGMT-P4	131265596、131265609、131265614

3. Designing primers and probes, namely designing specific primers and detection probes according to MGMT gene and β -actin gene sequences published by NCBI database, wherein a nucleotide sequence table is shown in Table 5.

TABLE 5 primers and probes for detecting the DMR2 region of MGMT gene promoter, β -actin gene

Including primer Probe name	Serial number	Sequence (5'-3')
			MGMT-F	SEQ ID No.1	GTTTYGGATATGTTGGGATAG
MGMT-R	SEQ ID No.2	AAAACCACTCRAAACTACCAC
			MGMT-P1	SEQ ID No.3	CGAACGTCGAAACGCAAAACG
MGMT-P2	SEQ ID No.4	CGCAAACGATACGCACCGCG
			MGMT-P3	SEQ ID No.5	CCGAAAACGAAACGACCCAAAC
MGMT-P4	SEQ ID No.6	CGTCCCGAAAAAAAACTCCGCAC
			β-actin-F	SEQ ID No.7	TTATTGTGTTGGGTGTTAGGGTAGT
β-actin-R	SEQ ID No.8	TCATTTCCCTCTCAAACATAAAATC
			β-actin-P	SEQ ID No.9	GGTAATGTTAGGGTATATGGTGGTGT

4. Primers and detection probes were designed based on the specific sequences obtained above, and the primers and detection probes used in the present invention were synthesized by Saimer Feishol science and technology, USA (Shanghai).

5. Fluorescent quantitative PCR detection process

5.1 fluorescent quantitative PCR detection was performed using CFX96 real-time fluorescent quantitative PCR instrument (BIO-RAD). Digital PCR reaction solutions were prepared according to Table 6, two replicates were set for each reaction, and after the preparation, the PCR reaction tubes were vortexed and mixed for 15 seconds, and then centrifuged rapidly for 15 seconds.

TABLE 6 fluorescent quantitative PCR reaction solution preparation table for multi-probe detection of MGMT gene DMR2 region methylation sites

5.2 the reaction tube is placed on the reaction panel of the fluorescence quantitative PCR instrument, the reaction conditions of the fluorescence quantitative PCR are set according to the table 7, and FAM and VIC are selected as the reaction fluorescence.

Table 7, fluorescent quantitative PCR reaction condition table for multi-probe detection of MGMT gene DMR2 region methylation site

5.3 edit the sample information and derive data see Table 8, and analyze the results.

TABLE 8 fluorescent quantitative PCR detection results of multiple probes for detecting the DMR2 region methylation site of MGMT gene

5.4 analysis of results: results fig. 2 and table 8 show that the measured Cq values of the FAM fluorescence quantitative assay of the sample with 10% Methylated are not significantly different from the Cq values of the FAM fluorescence quantitative assay of the blank control due to the absence of the fluorescence calibration procedure, and therefore the accuracy of the assay results cannot be determined.

6. Digital PCR detection process

6.1 sample information: bisulfite conversion of 10% methylation rate to human genome standards.

6.2 use of Naica Crystal Digital^TMDigital PCR detection was performed by a digital PCR machine (STI LL A Technologies, France).

6.3 preparing digital PCR reaction solution according to Table 9, after the preparation, vortex and mix the PCR reaction tube for 15 seconds, and then quickly centrifuge for 15 seconds.

TABLE 9 digital PCR reaction solution preparation table for multi-probe detection of MGMT gene DMR2 region methylation sites

6.4 remove the chip, gently rotate the white lid 1/4 loop and discard the white lid, remove the 25. mu. L reaction solution from step 6.3 and add to the well of the chip and cover with the long white lid.

6.5 Place the chip with 25. mu. L digital PCR reaction solution in Naica^TMIn the Geode microdroplet generation amplification system, the digital PCR reaction conditions were set as shown in Table 10.

TABLE 10 digital PCR reaction condition table for multi-probe detection of MGMT gene DMR2 region methylation site

6.6, information acquisition: after the digital PCR amplification is finished, the chip is placed in Naica^TMThe prism3 droplet reads the assay system, and the detection and interpretation of the fluorescent signal is performed.

6.7 generation of fluorescent signal calibration file and calibration of fluorescent signal: clicking 'computer' on a display panel of Crystal Miner analysis software, selecting 'monocolour Controls', clicking 'computeCompeneration' after adjusting a threshold value, clicking 'Aply', forming and establishing a fluorescent signal calibration file taking a blank contrast as a fluorescent signal adjustment basis, introducing the same group of calibration file parameters when analyzing a result, calibrating a fluorescent signal and storing a calibrated detection result.

6.8 analysis of results detection results FIG. 3 shows a one-dimensional detection chart for detecting methylation sites in the DMR2 region of the MGMT gene promoter and β -actin gene by using a multi-probe method (P1-P4). FIGS. 3A and 3D are a one-dimensional detection chart for detecting methylation sites in the DMR2 region of a blank sample MGMT gene promoter after fluorescence calibration and a one-dimensional detection chart for detecting β -actin gene respectively, FIGS. 3B and 3E are a one-dimensional detection chart for detecting methylation sites in the MGMT gene promoter and a one-dimensional detection chart for detecting β -actin gene in a 10% methylated sample without fluorescence correction respectively, and FIGS. 3C and 3F are a one-dimensional detection chart for detecting methylation sites in the MGMT gene promoter and a one-dimensional detection chart for detecting β -actin gene in a 10% methylated sample after fluorescence correction respectively.

Example 3 kit and method for detecting methylation sites of DMR2 region of MGMT gene promoter by multiple probes and comparison of detection of tissue sample by single probe method

1. Sample information: tissue samples from 5 patients with glioma.

2. DNA extraction: extracting genomic DNA from the sample. The tissue sample extraction kit is QIAamp DNA MiniKit, and the kit number is Cat: No./ID:51304 the specific extraction steps are described in the kit instructions.

4. Bisulfite conversion and recovery (same as step 4 in example 1).

5. Using a Naica Crystal Digital^TMDigital PCR detection was performed by a digital PCR machine (STI LL A Technologies, France).

5.1 preparing a digital PCR reaction solution for detecting the methylation sites of the DMR2 region of the MGMT gene promoter through multiple probes according to the table 11, preparing a digital PCR reaction solution for detecting the methylation sites of the DMR2 region of the MGMT gene promoter through single probes according to the table 12, after the preparation, uniformly mixing the PCR reaction tubes in a vortex mode for 15 seconds, and then quickly centrifuging the mixture for 15 seconds.

TABLE 11 digital PCR reaction solution preparation table for multi-probe detection of MGMT gene promoter DMR2 region methylation sites

TABLE 12 digital PCR reaction solution preparation table for single probe detection of MGMT gene promoter DMR2 region methylation site

5.2 take out the chip, gently rotate the white cover 1/4 circle and discard the white cover, remove the 25. mu. L reaction solution from step (1) above and add to the well of the chip and cover with the long white cover.

5.3 Place the chip with 25. mu. L digital PCR reaction solution in Naica^TMIn the Geode microdroplet generation amplification system, the digital PCR reaction conditions were set as shown in Table 13.

TABLE 13 digital PCR reaction conditions Table

5.4, information acquisition: after the digital PCR amplification is finished, the chip is placed in Naica^TMprism3 droplets were read into the assay system and introduced into the calibration file contained within the kit of the invention, followed by detection and interpretation of the fluorescent signal.

5.5 analysis of results data analysis was carried out by using Crystal Miner, the copy number of amplification product of methylation site in the DMR2 region of MGMT gene promoter is abbreviated as M, the copy number of amplification product of β -actin gene is abbreviated as A, and the detection results are shown in Table 14.

Tables 14 and 5 digital PCR detection results of MGMT gene promoter DMR2 region methylation sites in tissue samples

5.6 ratio result judging method: if the M/A is more than or equal to 3 percent, the methylation site detection of the DMR2 region of the MGMT gene promoter of the sample is considered as positive, and if the M/A is less than 3 percent, the methylation site detection of the DMR2 region of the MGMT gene promoter of the sample is considered as negative.

6. The results of the two-dimensional detection of the methylation site of the MGMT gene promoter region 1 (S) and the methylation site of the MGMT gene promoter region DMR region and the fluorescence intensity of the actin gene region-I, the two-dimensional detection of the methylation site of the MGMT gene promoter region and the methylation site of the actin gene droplet-I, the two-dimensional detection of the MGMT gene promoter region, the single-dimensional detection of the MGMT gene promoter region, the MGMT-P-P, the MGMT-P-I, the MGMT gene promoter region, the single-methylated site of the MGMT gene promoter region, the MGMT-I, the MGT-promoter region, the single-MGT-I, the MGT-I-II, the MGT-gene promoter region, the MGT-MT-P-I, the MGT gene promoter region, the single-I-DNA gene promoter region, the MGT-I-DNA-I, the single-DNA-I-DNA-I, the MGT-DNA-.

Example 4 detection and comparison of multiple-probe detection kit and method for MGMT gene promoter DMR2 region methylation site and single-probe detection method for cerebrospinal fluid sample

1. Sample information: cerebrospinal fluid samples from 3 patients with brain glioma.

2. DNA extraction: extracting genomic DNA from the sample. The sample extraction Kit is QIAamp DNA Mini Kit, and the Kit number is Cat No/ID: 51304 the specific extraction steps are described in the kit instructions.

4. Bisulfite conversion and recovery (same as step 4 in example 1).

5.1 preparing a digital PCR reaction solution for detecting the methylation sites of the DMR2 region of the MGMT gene promoter through multiple probes according to the table 15, preparing a digital PCR reaction solution for detecting the methylation sites of the DMR2 region of the MGMT gene promoter through single probe according to the table 16, after the preparation, uniformly mixing the PCR reaction tubes in a vortex mode for 15 seconds, and then quickly centrifuging the mixture for 15 seconds.

TABLE 15 digital PCR reaction solution preparation table for multi-probe detection of MGMT gene promoter DMR2 region methylation sites

TABLE 16 digital PCR reaction solution preparation table for single probe detection of MGMT gene promoter DMR2 region methylation site

5.2 remove the chip, gently rotate the white cap 1/4 loop and discard the white cap, remove the 25. mu. L reaction solution from step 5.1 above and add to the well of the chip and cover with the long white cap.

5.3 Place the chip with 25. mu. L digital PCR reaction solution in Naica^TMIn the Geode microdroplet generation amplification system, the digital PCR reaction conditions were set as shown in Table 17.

TABLE 17 digital PCR reaction conditions Table

5.5 analysis of results data analysis was carried out by using Crystal Miner, the copy number of amplification product of methylation site in the DMR2 region of MGMT gene promoter is abbreviated as M, the copy number of amplification product of β -actin gene is abbreviated as A, and the detection results are shown in Table 18.

TABLE 18, 3 digital PCR detection results of MGMT gene promoter DMR2 region methylation site in cerebrospinal fluid samples

5.6 ratio result judging method: if the M/A is more than or equal to 3 percent, the methylation state of the region of the MGMT gene promoter DMR2 of the sample is considered to be positive; if M/A is less than 3%, the methylation state of the DMR2 region of the MGMT gene promoter of the sample is considered as negative.

6. FIG. 9 shows two-dimensional detection graphs of methylated sites of the DMR region of MGMT gene promoter 1 (NS) and the cerebrospinal fluid gene promoter DMR region and of-actin gene, respectively, using the kit and method according to the present invention (FIG. 9A is a combination of multiple probes using MGMT-P to MGMT-P) and the single probe method (FIGS. 9B to 9E are single probes using MGMT-P, and MGMT-P), respectively, wherein the horizontal coordinates are fluorescence intensities detected from the methylated sites of the DMR region of MGMT gene promoter and the vertical coordinates are fluorescence intensities detected from-actin gene, the first quadrant is a common positive droplet detected from methylated sites of MGMT gene promoter DMR region and 0-actin gene, the second quadrant is a positive droplet detected from methylated sites of 1-actin gene, the third quadrant is a negative droplet detected from methylated sites of MGMT gene promoter and the second quadrant detected from methyl gene promoter, the second droplet detected from the same DMMT-MT-P, the second droplet detected from methylated sites of MGMT-MGMT gene promoter, the same as MGMT-P, the first droplet detected from the second droplet detected from methylated sites of MGMT-MGMT gene promoter, the same as the cerebrospinal fluid gene promoter, the second droplet detected from methylated sites of MGMT-MGMT gene promoter, the same as the first droplet, the first droplet detected from the second droplet detected from methylated sites of MGMT gene promoter, the same, the second droplet, the same as the first droplet, the second droplet detected from the second droplet, the third droplet detected from the third droplet, the same droplet detected from methylated sites detected from the same, the same droplet, the same, the second droplet, the third droplet, the same, the third droplet detected from the same, the same droplet detected from the third droplet detected from the same, the same droplet, the same as the same, the same as the third droplet detected from the same, the same as the same, the same as the same, the same as the third droplet, the same as the same, the same as the same, and the same, and the same, the same as the same, wherein the same as the same, the same as the same, and the same, and the same, and the same, the same.

Sequence listing

<110> Beijing Epipurb Biotechnology Co., Ltd

<120> kit and method for detecting MGMT gene promoter DMR2 region methylation site by multiple probes

<141>2019-11-20

<160>9

<170>SIPOSequenceListing 1.0

<210>1

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

gtttyggata tgttgggata g 21

<210>2

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

aaaaccactc raaactacca c 21

<210>3

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

cgaacgtcga aacgcaaaac g 21

<210>4

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

cgcaaacgat acgcaccgcg 20

<210>5

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

ccgaaaacga aacgacccaa ac 22

<210>6

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

cgtcccgaaa aaaaactccg cac 23

<210>7

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

ttattgtgtt gggtgttagg gtagt 25

<210>8

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

tcatttccct ctcaaacata aaatc 25

<210>9

<211>26

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

ggtaatgtta gggtatatgg tggtgt 26

Claims

1. Primer pair for determining methylation sites of the DMR2 region of the MGMT gene promoter, characterized in that: the primer pair consists of SEQ ID NO: 1 and SEQ ID NO: 2 is shown in the sequence of the sequence; the nucleotide sequence of SEQ ID NO: 1 is 5'-GTTTYGGATATGTTGGGATAG-3', wherein the 5 th base is degenerate Y; the nucleotide sequence of SEQ ID NO: 2 is 5'-AAAACCACTCRAAACTACCAC-3', wherein the 11 th base is a degenerate base R.

2. A probe combination for determining methylation sites of the DMR2 region of the MGMT gene promoter, characterized in that: the probe combination consists of SEQ ID NO: 3. SEQ ID NO: 4. SEQ ID NO: 5. SEQ ID NO: 6; the nucleotide sequence of SEQ ID NO: 3 is 5'-CGAACGTCGAAACGCAAAACG-3', and the sequence shown in SEQ ID NO: 4 is 5'-CGCAAACGATACGCACCGCG-3', and the sequence shown in SEQ ID NO: sequence 5 is 5'-CCGAAAACGAAACGACCCAAAC-3', and the sequence shown in SEQ ID NO: the 6-sequence is 5'-CGTCCCGAAAAAAAACTCCGCAC-3'.

3. A primer pair and a probe for determining β -actin gene are characterized in that the primer pair consists of primers with sequences shown in SEQ ID NO. 7 and SEQ ID NO. 8, and the probe is a sequence shown in SEQ ID NO. 9.

4. A kit for detecting methylation sites of a promoter DMR2 region of an MGMT gene by multiple probes is characterized in that: the kit contains a mixture of 2 pairs of primer pairs and 5 probes, wherein the mixture of 2 pairs of primer pairs and 5 probes consists of SEQ ID NO: 1 to SEQ ID NO: 9, and (b) the sequence shown in the figure.

5. The kit for multi-probe detection of the methylation site of the DMR2 region of the MGMT gene promoter according to claim 4, wherein: also comprises a digital PCR premix, fluorescein sodium salt and ddH₂O and a calibration file.

6. The kit for multi-probe detection of methylation sites of the DMR2 region of the MGMT gene promoter according to claim 4, wherein the kit can be used for determining the methylation status of the DMR2 region of the MGMT gene promoter based chemotherapy, and comprises:

(1) extracting genome DNA from a sample to be detected;

(2) carrying out methylation conversion treatment on the genome by using bisulfite to serve as a PCR reaction template;

(3) primer and probe mixed solution, digital PCR premixed solution, fluorescein sodium salt and ddH added into the kit₂O, performing digital PCR amplification;

(4) after the digital PCR amplification is finished, introducing a calibration file and carrying out copy number statistics on the amplification product, wherein the copy number of the MGMT gene amplification product is abbreviated as M, and the copy number of the β -actin gene amplification product is abbreviated as A, when the M/A is more than or equal to 3%, the methylation state of the DMR2 region of the MGMT gene promoter is considered to be positive, and when the M/A is less than 3%, the methylation state of the DMR2 region of the MGMT gene promoter is considered to be negative.

7. A kit for detecting methylation sites of a promoter DMR2 region of an MGMT gene by multiple probes is characterized in that: the kit is suitable for a micro-drop type digital PCR instrument and a chip type digital PCR instrument.