CN109321651A - A kind of composition, kit, sample treatment and application detecting people CYP2D6 gene pleiomorphism - Google Patents

A kind of composition, kit, sample treatment and application detecting people CYP2D6 gene pleiomorphism Download PDF

Info

Publication number
CN109321651A
CN109321651A CN201811270460.0A CN201811270460A CN109321651A CN 109321651 A CN109321651 A CN 109321651A CN 201811270460 A CN201811270460 A CN 201811270460A CN 109321651 A CN109321651 A CN 109321651A
Authority
CN
China
Prior art keywords
seq
probe
fam
cyp2d6 gene
detection
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201811270460.0A
Other languages
Chinese (zh)
Inventor
覃武明
文荻琛
罗哲容
李仁君
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hunan Jian Ji Biotechnology Co Ltd
Original Assignee
Hunan Jian Ji Biotechnology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hunan Jian Ji Biotechnology Co Ltd filed Critical Hunan Jian Ji Biotechnology Co Ltd
Priority to CN201811270460.0A priority Critical patent/CN109321651A/en
Publication of CN109321651A publication Critical patent/CN109321651A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes

Abstract

The present invention relates to the compositions for detecting people's CYP2D6 gene pleiomorphism, the composition includes the primer for detecting CYP2D6 gene C 188T and/or G4268C loci polymorphism, and the primer for detecting C188T includes sequence primer as shown in SEQ ID NO.1, SEQ ID NO.2 and/or SEQ ID NO.3；The primer in the detection site G4268C includes sequence primer as shown in SEQ ID NO.4, SEQ ID NO.5 and/or SEQ ID NO.6.The primer that the present invention detects C188T is combined with the primer of detection G4268C, can detect the polymorphism of C188T, G4268C simultaneously, specificity is high, and sensitivity is good, reproducible.

Description

A kind of composition, kit, sample treatment side detecting people CYP2D6 gene pleiomorphism Method and application
Technical field
The invention belongs to the nucleic acid detection technique fields in a kind of field of biomedicine clinical detection technique, and in particular to arrive A kind of composition, kit, sample treatment and application detecting people CYP2D6 gene pleiomorphism.
Background technique
Polymerase chain reaction (PCR) technology is one of most common technique in current detection of nucleic acids, wherein using fluorescence mark The real-time fluorescent PCR technology of the taqman sonde method of note detection of nucleic acids, clinical diagnosis and in terms of Using highly developed, which is had been applied in numerous industries such as laboratory research, food safety, medical and health, but It is that these technologies mostly use greatly single reaction tube to detect single target nucleotide, when in the multiple target nucleotides of single reaction tube detection When, the primer and probe sequence of different target nucleotides is detected due to introduce simultaneously, these introduce primer and probes can because There is hybridization from each other and generate interference, simultaneously as 188 sites of mankind's CYP2D6 gene, 4268 sites all only have one Point mutation, extremely difficult find can distinguish wild type and saltant type, and the primer that can will not be interfered with each other in single tube again is visited Needle design.Meanwhile it as soon as needing to evade false negative as a kit and needing to be added internal reference target nucleic acid sequence and can detect The primed probe of internal reference target nucleic acid sequence exacerbates the difficulty of Single-tube multiplex-PCR technology.
Currently, the method for Genotyping mainly has the restricted Length Polymorphism technique of PCR sequencing PCR, polymerase chain reaction-, core Piece method and fluorescence quantitative PCR method etc..It is higher to obtain that these technologies all have to pass through cumbersome nucleic acid extraction, purification process The template DNA of purity.The step of increasing operation, it is time-consuming and laborious, and increase false positive rate caused by manual operation error and vacation yin Property rate.
CN201610771855.3 discloses the Pyrosequencing primer pair and reagent of qualitative detection CYP2D6 Genotyping Box.The primer pair includes positive amplimer, reversed amplimer, sequencing primer, and positive amplimer and reversed amplification are drawn 5 ' ends of object carry out biotin labeling respectively；The invention further relates to a kind of pyrosequencings of qualitative detection CYP2D6 Genotyping Kit.The kit includes amplimer, PCR reaction solution 1, PCR reaction solution 2, sequencing primer, Uracil DNA Glycosylase Enzyme and Taq polymerase.The present invention has that testing result is accurate, specificity is high, detection cycle is short, easy to operate and can effectively meet The advantages of clinical examination requires；It can real-time monitoring reaction process, reaction time be short, PCR product simple process is in addition, also having Pyrophosphoric acid sequencer and high-throughput sample detection can be gone up, and than goldstandard method, i.e. Capillary Electrophoresis PCR sequencing method sensitivity Higher advantage.
CN200610072593.8 discloses a set of for detecting the oligonucleotides of CYP450 enzyme gene hot mutant site Probe and application thereof, probe separately design on each hypotype enzyme dna complete genome sequence of CYP450, sensitivity with higher and spy It is anisotropic.
Summary of the invention
In view of the deficiencies of the prior art, the technical problem to be solved in the present invention is more to provide a kind of detection people CYP2D6 gene Composition, kit, sample treatment and the application of state property, primer are not interfere with each other, and specificity is high, and sensitivity is good, are repeated Property is good.
In a first aspect, the present invention provides a kind of composition for detecting people CYP2D6 gene pleiomorphism,
The composition includes the primer for detecting CYP2D6 gene C 188T and/or G4268C loci polymorphism,
The primer of detection 188 loci polymorphism of CYP2D6 gene includes sequence such as SEQ ID NO.1, SEQ ID Primer shown in NO.2 and SEQ ID NO.3；The primer of the detection G4268C loci polymorphism includes sequence such as SEQ ID Primer shown in NO.4, SEQ ID NO.5 and SEQ ID NO.6.
The composition further includes the probe for detecting CYP2D6 gene 188 and/or 4268 loci polymorphisms, the inspection The probe for surveying 188 loci polymorphism of CYP2D6 gene includes sequence probe as shown in SEQ ID NO.9, the detection CYP2D6 The probe in 4268 site of gene includes sequence probe as shown in SEQ ID NO.10；Or the SEQ ID NO.9, SEQ ID Probe shown in NO.10 is modified by the fluorescent marker of different Detection wavelengths, and the fluorescent marker is CY5 or FAM.
The composition further include interior label primer for detecting CYP2D6 gene 188 and/or 4268 loci polymorphisms and Internal standard probe, the interior label primer sequence is as shown in SEQ ID NO.7 and/or SEQ ID NO.8, and the internal standard probe sequence is such as Shown in SEQ ID NO.11.
The present invention also provides a kind of kit, the kit contains PCR detection reagent A and PCR detection reagent B,
The PCR reaction solution A includes sequence such as SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.4, SEQ ID A variety of primers of NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11 And probe, detect 188 site of CYP2D6 gene, 4268 site wild types.
The PCR reaction solution B includes sequence respectively such as SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, a variety of of SEQ ID NO.11 draw Object and probe detect 188 site of CYP2D6 gene, 4268 site mutation types.
The kit further includes sample lysate, and the sample lysate includes Tris-HCl buffer, dodecyl Sodium sulphate, EDTA, glycerol and Proteinase K.Usually also containing protein denaturants and surface-actives such as glycerol, PEG8000, polysorbas20s Agent.
The kit further include: 1 wild type control product, 1 saltant comparison product and 1 blank control product；It is described Wild type control product are to include the recombinant plasmid of CYP2D6 gene polymorphism sites 188C, 4268G and include internal standard base The mixture of the recombinant plasmid of cause；The saltant comparison product be include CYP2D6 gene polymorphism sites 188T, 4268C Recombinant plasmid and include internal standard gene recombinant plasmid mixture；The blank control product are polymorphic not comprising CYP2D6 The physiological saline in property site and internal standard gene.The carrier of the recombinant plasmid is preferably pUC57.
The present invention also provides a kind of sample treatment, this method uses kit, includes the following steps:
1) 2 parts of human genome sample of nucleic acid pre-processed are taken, 2 parts of samples (are detected with the PCR reaction solution A respectively Reagent A 39.4ul+ enzymatic mixture 0.6ul) and PCR reaction solution B (detection reagent B 39.4ul+ enzymatic mixture 0.6ul) mixing, Wherein, probe shown in SEQ ID NO.9 is by FAM fluorescent marker, and probe shown in SEQ ID NO.10 is by CY5 fluorescent marker, SEQ Probe shown in ID NO.11 is by HEX/VIC fluorescent marker；
Pcr amplification reaction is carried out, CY5, FAM, HEX/VIC fluorescence signal are acquired；
2) result judges: is automatically saved after reaction as a result, according to the Start of image adjustment Baseline after analysis (user can voluntarily adjust according to the actual situation, and Start value can in 3~15, End value for value, End value and Threshold value Be located at 5~20, adjust negative control amplification curve it is straight or lower than threshold line)；When wild type control product and saltant comparison Product have CY5, FAM, HEX/VIC fluorescence signal initial line and CT≤35, blank control product without CY5, FAM, HEX/VIC initial line, When sample detection pipe HEX/VIC initial line and CT≤35, judgment experiment success；Believed according to CY5 fluorescence in 2 sample detection pipes A, B Number 4268 site of Δ Ct value situation interpretation CYP2D6 gene parting；According to FAM fluorescence signal in 2 sample detection pipes A, B 188 site of Δ Ct value situation interpretation CYP2D6 gene parting；If there is FAM and/or CY5 without the case where CT value display, This data CT value is denoted as 40 to be included in the calculating of Δ Ct.
The pretreatment of the human genome sample of nucleic acid includes:
Buccal swab liquid: taking 50ul human mouth swab liquid to be placed in 1.5mlEP pipe, and 50ul sample lysate, piping and druming is added It mixes, is stored at room temperature 10min；
Anticoagulated whole blood: taking 50ul anticoagulated whole blood to be placed in 1.5mlEP pipe, 100 μ L erythrocyte cracked liquids, pipettor is added Piping and druming mixes for several times, and 10000rpm/min is centrifuged 1min and abandons supernatant, adds 50 μ L sample lysates, is stored at room temperature 10min, shakes Swing mixing.
The program of pcr amplification reaction includes:
Genotyping interpretation follows following rule:
Calculation: Δ CtFAM=CtFAM(B)-CtFAM(A)-(CtHEX(B)-CtHEX(A))
ΔCtCY5=CtCY5(B)-CtCY5(A)-(CtHEX(B)-CtHEX(A))
When the probe shown in the SEQ ID NO.11 is by VIC fluorescent marker, CtHEXFor CtVIC；
The present invention also provides a kind of application of kit in terms of detecting people CYP2D6 gene pleiomorphism.
Foregoing probes have meaning well-known to those skilled in the art, for can be with the single-stranded combination of target nucleic acid that amplifies Single stranded DNA.In general, 5 ' end mark fluorescent groups of the nucleotide sequence in every kind of probe, 3 ' end label quenching groups.Using Fluorophor and quenching group can be commercially available, can such as use FAM/SYBR-GREEN, VIC/JOE/HEX, NED/ The conventional products such as TAMRA/CY3, ROX/Texas Red and CY5, their Detection wavelength is different, can also be with authorized company Directly synthesize the probe for having fluorescent marker.Probe shown in SEQ ID NO.9,10,11 of the present invention can be respectively by different detection waves Long fluorescent marker modification, the fluorescent marker are CY5, VIC or FAM；As a specific example, the fluorescence mark that each target nucleic acid uses Note is as follows:
Each target nucleic acid corresponds to fluorescent species
Type Probe Fluorescence Wavelength nm
188 site of CYP2D6 gene SEQ ID NO.9 FAM 520±5
4268 site of CYP2D6 gene SEQ ID NO.10 CY5 650±5
Internal reference SEQ ID NO.11 VIC 550±5
The PCR reaction solution A detects 188 site of CYP2D6 gene, 4268 site wild types, PCR reaction solution B detection 188 site of CYP2D6 gene, 4268 site mutation types.
Optionally, the PCR reaction solution A or B also contain taq DNA polymerase, magnesium chloride, dNTPs (dATP, DCTP, dGTP and dTTP), internal reference nucleic acid.
Fluorescence signal arrival fluorescent PCR instrument, which is defaulted, in Fluorescence PCR, in each PCR reaction tube of Ct value expression sets Recurring number experienced, with good reproducibility, therefore is used as the good finger of judging result when fixed threshold value Mark.The threshold value of default setting is preferably 10 times of the standard deviation of the fluorescence signal of 3-10 circulation.
Optionally, the human genome sample of nucleic acid may be from blood, blood product, cast-off cells.The PCR amplification is anti- System is answered to use pH buffer, such as N, N- bicine N--KOH buffer.The pcr amplification reaction system uses Salt, such as KCl.The pcr amplification reaction system has used albumen enzymatic protective reagent, such as BSA (bovine serum albumin(BSA)).The PCR expands Increase reaction system and used glycerol, activity of enzyme under the conditions of PCR can be extended.
Real time fluorescent PCR method sample detected is the vitro samples containing target nucleic acid, such as blood, blood product, is taken off Fall cell etc..The real time fluorescent PCR method is only limitted to the detection to vitro samples, and the direct result of detection is the base of target nucleic acid Because of parting.Sample is the mixed liquor that of short duration standing is mixed by sample lysate and sample of the invention, unavailable other methods The nucleic acid solution of enrichment is detected, and has the risk of failure or false negative.
In the present invention, it is in a same vessel that " single PCR reaction tube ", which refers to the real time fluorescent PCR method technically, It carries out, it is not necessary that replacement container.Wherein the container is PCR reaction tube for optimal selection, other can carry out PCR reaction simultaneously The container that can carry out real-time fluorescence detection is also within the scope of the present invention.In real-time PCR method of the invention, same The step of PCR amplification and real-time detection can be completed in a container, whole process need not replace container, thus facilitate operation Person.Operator only needs that sample and various reagents are added into container, so that it may pass through commercially available common real-time fluorescence PCR Instrument is automatically performed the detection of genetic loci of interest, very convenient in user, is also convenient for mechanical realizing automation.
Herein, " Multiple detection " refers to while detecting a variety of target nucleic acids, i.e., at least one.In first party of the invention In the method in face, due at least having detected internal reference and a kind of nucleic acid, the nucleic acid of detection at least there are two types of.When detecting Target nucleic acid type more than one when, while detect nucleic acid increase accordingly.Wherein, every kind of nucleic acid can only be DNA.In the present invention Specific embodiment in, preferential selection carries out two re-detections, three re-detections detection.
Specific primed probe design of the invention are as follows:
For 188 site of CYP2D6 gene, according to the literature, preferably its highly conserved region is as amplification region, needle Primer pair sequence to region design is wild primers SEQ ID NO.1 and mutant primers SEQ ID NO.2, and downstream is drawn Object is that sequence is SEQ ID NO.3, and probe sequence is SEQ ID NO.9.
For 4268 site of CYP2D6 gene, according to the literature, preferably its highly conserved region is as amplification region, needle Primer pair sequence to region design is wild primers SEQ ID NO.4 and mutant primers SEQ ID NO.5, and downstream is drawn Object is that sequence is SEQ ID NO.6, and probe sequence is SEQ ID NO.10.
After 188 site of CYP2D6 gene, 4268 site primer probe sequences and reaction density has been determined, design is added Internal reference primed probe as kit control false negative.The internal reference target that this kit uses is human genome A kind of house-keeping gene, corresponding primer are SEQ ID NO.7 and SEQ ID NO.8, and fluorescence probe is SEQ ID NO.11.
As an example, PCR reaction system A are as follows:
PCR reaction system B can are as follows:
Serial number Component Final concentration
1 N, N- bicine N--KOH buffer ph8.2 100mM
2 Potassium acetate 125mM
3 Glycerol glycerol 8% (V.V)
4 BSA 20μg/ml
5 KCl 5mM
6 Edta 1μM
7 Tth DNA polymerase 1U/test
8 Taq DNA polymerase 2U/test
9 dntps 2mM
10 MgCl2 2.5mM
11 SEQ ID NO.2 15pmol/test
12 SEQ ID NO.3 15pmol/test
13 SEQ ID NO.5 15pmol/test
14 SEQ ID NO.6 15pmol/test
15 SEQ ID NO.7 15pmol/test
16 SEQ ID NO.8 15pmol/test
17 SEQ ID NO.9 5pmol/test
18 SEQ ID NO.10 5pmol/test
19 SEQ ID NO.11 5pmol/test
Optionally, the pcr amplification reaction includes:
Optionally,
Fourth aspect, the answering in detection people CYP2D6 gene pleiomorphism the present invention provides aforementioned composition or kit With.Each sequence involved by this paper is specifically shown in sequence table or following table:
SEQIDNO.1 GAAGAGGAGCATTGAGGACC
SEQIDNO.2 GAAGAGGAGCATTGAGGACT
SEQIDNO.3 ACTATCTTCTCTACTGACATT
SEQIDNO.4 GTGCACGAGGTCCAGAGATACA
SEQIDNO.5 GTGCACGAGGTCCAGAGATACC
SEQIDNO.6 TAAGTTTGTTTCTCCTACA
SEQIDNO.7 TGAAAAACAACCATTGGCCG
SEQIDNO.8 TGAAAAACAACCATTGGCCA
SEQIDNO.9 CTGGCCAACATGGTGAAA
SEQIDNO.10 GCCAGGAGATCATCGACC
SEQIDNO.11 GCCAGGAGATCATCGACT
The beneficial effects of the present invention are:
The present inventor passes through to be studied repeatedly, develops the hands-free fluorescence quantifying PCR method reagent for taking, directly expanding, and Design screened mankind's CYP2D6 gene 188 sites, 4268 site wild types and mutant primers and probe each pair, optimization Sample treatment, the use concentration of primer, probe, enzyme, dNTPs and other chemical reagent, is opened finally in optimizing reaction system Issue the system that multiple target nucleic acids are detected in single reaction tube, and overcome multiple real time fluorescence PCR exploitation in encounter it is more Weight primer/probe cross contamination and the relatively low technological difficulties of detection sensitivity, and detected relative to single tube, it saves big Measure manpower, material resources and financial resources and time.By the verifying repeatedly of a large amount of samples, presently commercially available conventional fluorescent PCR is can be used in the present invention Equipment is not necessarily to any transformation, can achieve the purpose that carry out parting, specificity, sensitivity, repeatability etc. to CYP2D6 gene Technical indicator is reached advanced world standards.
Specifically, the present invention has the effect that
It 1, can be with quick release human blood sample or buccal swab suspension using the sample lysate of kit of the present invention Genomic nucleic acids in sample, entire process of testing, only need to be directly molten with sample by sample without the DNA individually extracted in sample Solution liquid is sufficiently mixed the template that can be used as PCR amplification, reduces operating procedure, avoids the ring in conventional nucleic acid extraction process Border pollution.
2, using kit of the present invention can quickly to people's CYP2D6 gene carry out parting, have it is simple and quick, it is quick The advantages such as sensitivity is high, high specificity, and as a result interpretation is objective.
3, probe used in this kit is Taqman probe, low in cost；Meanwhile all reaction whole process stopped pipes of the invention It carries out, does not have to recycle product, purify after PCR reaction, digestion, electrophoresis, both saved testing cost, shorten Detection cycle also reduces the pollution of false positive caused by PCR product.
4, this kit includes the primer and probe of internal standard gene, by the detection to internal standard gene, is reduced because of operation The false negative that process generates.
5, kit of the present invention is using common fluorescent quantitative PCR platform, and platform use scope is wide, relative to sequencing Method, chip method are easier to realize high-throughput detection, are more able to satisfy clinical needs.
Detailed description of the invention
Fig. 1-6 is the testing result figure of the gene pleiomorphism of embodiment 1.
Wherein Fig. 1-3 is PCR reaction system A respectively in the fluorescent quantitation amplification curve diagram of channel FAM, CY5 and VIC；Figure 4-6 is PCR reaction system B respectively in the fluorescent quantitation amplification curve diagram of channel FAM, CY5 and VIC.
Fig. 7-12 is the testing result figure of the gene pleiomorphism of embodiment 2.
Wherein Fig. 7-9 is PCR reaction system A respectively in the fluorescent quantitation amplification curve diagram of channel FAM, CY5 and VIC；Figure 10-12 is PCR reaction system B respectively in the fluorescent quantitation amplification curve diagram of channel FAM, CY5 and VIC.
Figure 13-18 is the testing result figure of the gene pleiomorphism of embodiment 3.
Wherein Figure 13-15 is PCR reaction system A respectively in the fluorescent quantitation amplification curve diagram of channel FAM, CY5 and VIC； Figure 16-18 is PCR reaction system B respectively in the fluorescent quantitation amplification curve diagram of channel FAM, CY5 and VIC.
Specific embodiment
Hereafter probe used, the synthesis of primer commission hundred Li Ge biotech company of Shanghai, chemical reagent buying used is westerly Lattice Ma aldrich (Shanghai) trade Co., Ltd, DNA polymerase used come from precious bioengineering (Dalian) limited public affairs Department.
Hereafter used kit composition is as follows:
The composition of 1 kit of table
PCR reaction system A are as follows:
PCR reaction system B are as follows:
Serial number Component Final concentration
1 Bicine-Koh ph8.2 100mM
2 K-acetate 125mM
3 glycerol 8% (V.V)
4 BSA 20μg/ml
5 KCl 5mM
6 Edta 1μM
7 Tth DNA polymerase 1U/test
8 Taq DNA polymerase 2U/test
9 dntps 2mM
10 MgCl2 2.5mM
11 SEQ ID NO.2 15pmol/test
12 SEQ ID NO.3 15pmol/test
13 SEQ ID NO.5 15pmol/test
14 SEQ ID NO.6 15pmol/test
15 SEQ ID NO.7 15pmol/test
16 SEQ ID NO.8 15pmol/test
17 SEQ ID NO.9 5pmol/test
18 SEQ ID NO.10 5pmol/test
19 SEQ ID NO.11 5pmol/test
The operating procedure of kit is used in implementation
(1) sample preprocessing
Buccal swab: taking 50 μ L human mouth swab suspensions with 1.5mL EP pipe, and 50ul sample lysate is added, and piping and druming is mixed It is even, it is stored at room temperature 10min；
Anticoagulated whole blood: it takes 50ul anticoagulated whole blood to be placed in 1.5mlEP pipe and 100 μ L erythrocyte cracked liquids is added, pipettor is blown It beats and mixes for several times, 10000rpm/min is centrifuged 1min and abandons supernatant, adds 50 μ L sample lysates, is stored at room temperature 10min, shakes It mixes；
(2) by two portions of 10ul sample mixed liquors respectively with 40ul reaction system CYP2D6 gene PCR reaction solution A, CYP2D6 Gene PCR reaction solution B mixing, then eight union of PCR is placed in fluorescent PCR instrument and carries out fluorescent PCR amplified reaction, acquisition CY5, FAM, VIC fluorescence signal；
(3) result judges: is automatically saved after reaction as a result, according to the Start of image adjustment Baseline after analysis (user can voluntarily adjust according to the actual situation, and Start value can in 3~15, End value for value, End value and Threshold value Be located at 5~20, adjust negative control amplification curve it is straight or lower than threshold line)；When positive control Guan Jun has CY5, FAM, VIC Fluorescence signal initial line and CT≤35, negative control without CY5, FAM initial line but have VIC fluorescence signal initial line and CT≤35, sample When detection pipe VIC initial line and CT≤35, judgment experiment success；According to the Δ Ct of CY5 fluorescence signal in 2 sample detection pipes A, B It is worth the parting in 4268 site of situation interpretation CYP2D6 gene；According to the Δ Ct value of FAM fluorescence signal in 2 sample detection pipes A, B The parting in 188 site of situation interpretation CYP2D6 gene；Under the premise of internal standard is successful, if it is aobvious without CT value FAM and/or CY5 occur When the case where showing, this data CT value is denoted as 40 and is included in the calculating of Δ Ct.(4) PCR amplification condition setting is as follows:
Genotype interpretation method:
Calculation: Δ CtFAM=CtFAM(B)-CtFAM(A)-(CtHEX(B)-CtHEX(A))
ΔCtCY5=CtCY5(B)-CtCY5(A)-(CtHEX(B)-CtHEX(A))
When the probe shown in the SEQ ID NO.11 is by VIC fluorescent marker, CtHEXFor CtVIC；
1 three re-detection of embodiment (188 heterozygotes, 4268 homozygotes).
The sample is detected using the above method, as a result as shown in Figure 1, genotype is 188CT, 4268CC.
In Fig. 1, in the left hand view in the channel FAM, abscissa 1-40 is divided into 1, and ordinate is -0.33446- 1.59350 being divided into 0.21422.The right part of flg in the channel FAM and the coordinate values of left hand view are identical.
The coordinate values in the channel CY5 are identical identical with the coordinate values in the channel FAM.
In the left hand view in the channel VIC, abscissa 1-40 is divided into 1, and ordinate is -0.68039-1.56561, interval It is 0.249555.The right part of flg in the channel VIC and the coordinate values of left hand view are identical.
2 three re-detection of embodiment (188 homozygotes, 4268 heterozygotes)
The sample is detected using the above method, as a result as shown in Fig. 2, the sample genotype is 188CC, 4268GC。
In Fig. 2, the coordinate values in the channel FAM are identical with the coordinate values in the channel FAM in Fig. 1.
The coordinate values in the channel CY5 are identical identical with the coordinate values in the channel FAM.
The coordinate values in the channel VIC are identical with the coordinate values in the channel VIC in Fig. 1.
3 three re-detection of embodiment (188 homozygotes, 4268 homozygotes)
The sample is detected using the above method, as a result as shown in figure 3, the sample genotype is 188TT, 4268GG。
In Fig. 3, the coordinate values in the channel FAM are identical with the coordinate values in the channel FAM in Fig. 1.
The coordinate values in the channel CY5 are identical identical with the coordinate values in the channel FAM.
The coordinate values in the channel VIC are identical with the coordinate values in the channel VIC in Fig. 1.
<110>Hunan Jian Ji Bioisystech Co., Ltd
<120>a kind of composition, kit, sample treatment and application for detecting people CYP2D6 gene pleiomorphism
<160>11
<210>1
<211>20
<212>DNA
<213>artificial sequence
<400>1
gaagaggagcattgaggacc 20
<210>2
<211>20
<212>DNA
<213>artificial sequence
<400>2
gaagaggagcattgaggact 20
<210>3
<211>21
<212>DNA
<213>artificial sequence
<400>3
actatcttctctactgacatt 21
<210>4
<211>22
<212>DNA
<213>artificial sequence
<400>4
gtgcacgaggtccagagataca 22
<210>5
<211>22
<212>DNA
<213>artificial sequence
<400>5
gtgcacgaggtccagagatacc 22
<210>6
<211>19
<212>DNA
<213>artificial sequence
<400>6
taagtttgtttctcctaca 19
<210>7
<211>20
<212>DNA
<213>artificial sequence
<400>7
tgaaaaacaaccattggccg 20
<210>8
<211>20
<212>DNA
<213>artificial sequence
<400>8
tgaaaaacaaccattggcca 20
<210>9
<211>18
<212>DNA
<213>artificial sequence
<400>9
ctggccaacatggtgaaa 18
<210>10
<211>18
<212>DNA
<213>artificial sequence
<400>10
gccaggagatcatcgacc 18
<210>11
<211>18
<212>DNA
<213>artificial sequence
<400>11
gccaggagatcatcgact 18

Claims (10)

1. a kind of for detecting the composition of people's CYP2D6 gene pleiomorphism, characterized in that the composition includes for detecting The primer of CYP2D6 gene 188 and/or 4268 loci polymorphisms,
It is described detection 188 loci polymorphism of CYP2D6 gene primer include sequence such as SEQ ID NO.1, SEQ ID NO.2 and Primer shown in SEQ ID NO.3；The primer of the detection G4268C loci polymorphism includes sequence such as SEQ ID NO.4, SEQ Primer shown in ID NO.5 and SEQ ID NO.6.
2. composition as described in claim 1, characterized in that the composition further includes for detecting CYP2D6 gene 188 And/or 4268 loci polymorphism probe, it is described detection 188 loci polymorphism of CYP2D6 gene probe include sequence such as SEQ The probe of probe shown in ID NO.9, detection 4268 site of CYP2D6 gene includes sequence as shown in SEQ ID NO.10 Probe；Or probe shown in the SEQ ID NO.9, SEQ ID NO.10 is repaired by the fluorescent marker of different Detection wavelengths Decorations, the fluorescent marker are CY5 or FAM.
3. composition as described in claim 1, characterized in that the composition further includes for detecting CYP2D6 gene 188 And/or 4268 loci polymorphism interior label primer and internal standard probe, the interior label primer sequence such as SEQ ID NO.7 and/or SEQ Shown in ID NO.8, the internal standard probe sequence is as shown in SEQ ID NO.11.
4. a kind of includes the kit of the composition as described in claim any one of 1-3, characterized in that the kit contains PCR detection reagent A and PCR detection reagent B,
The PCR detection reagent A includes sequence such as SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.4, SEQ ID A variety of primers of NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11 And probe；
The PCR detection reagent B includes sequence respectively such as SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.5, SEQ ID A variety of primers of NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11 And probe.
5. kit as claimed in claim 4, characterized in that the kit further includes sample lysate, and the sample is molten Solving liquid includes Tris-HCl buffer, lauryl sodium sulfate, EDTA, glycerol and Proteinase K.
6. kit as described in claim 4 or 5, characterized in that further include: 1 wild type control product, 1 saltant type pair According to product and 1 blank control product；The wild type control product be include CYP2D6 gene polymorphism sites 188C, 4268G Recombinant plasmid and include internal standard gene recombinant plasmid mixture；The saltant comparison product be include CYP2D6 base Because polymorphic site 188T, 4268C recombinant plasmid and include internal standard gene recombinant plasmid mixture；The blank Reference substance is the physiological saline not comprising CYP3D6 gene polymorphism sites.
7. a kind of sample treatment, characterized in that this method uses the described in any item kits of claim 4-6, including Following steps:
1) 2 parts of human genome sample of nucleic acid pre-processed are taken, 2 parts of samples are reacted with the PCR reaction solution A and PCR respectively Liquid B mixing, wherein probe shown in SEQ ID NO.9 is by FAM fluorescent marker, and probe shown in SEQ ID NO.10 is by CY5 fluorescence mark Note, probe shown in SEQ ID NO.11 is by HEX/VIC fluorescent marker；
Pcr amplification reaction is carried out, CY5, FAM, HEX/VIC fluorescence signal are acquired；
2) result judges: when wild type control product and saltant comparison product have CY5, FAM, VIC fluorescence signal initial line and CT≤ 35, blank control is without CY5, FAM, HEX/VIC initial line, sample detection pipe HEX/VIC initial line and CT≤35, judgment experiment success； According to the parting in 4268 site of Δ Ct value situation interpretation CYP2D6 gene of CY5 fluorescence signal in 2 sample detection pipes A, B；Root According to the parting in 188 site of Δ Ct value situation interpretation CYP2D6 gene of FAM fluorescence signal in 2 sample detection pipes A, B；If occurring When the case where FAM and/or CY5 is shown without CT value, this data CT value is denoted as 40 and is included in the calculating of Δ Ct.
8. the method for claim 7, characterized in that the program of pcr amplification reaction includes:
9. method as claimed in claim 7 or 8, characterized in that Genotyping interpretation follows following rule:
Calculation: Δ CtFAM=CtFAM(B)-CtFAM(A)-(CtHEX(B)-CtHEX(A))
ΔCtCY5=CtCY5(B)-CtCY5(A)-(CtHEX(B)-CtHEX(A))
When the probe shown in the SEQ ID NO.11 is by VIC fluorescent marker, CtHEXFor CtVIC,
10. a kind of application such as the kit of claim 4,5 or 6 in terms of detecting people CYP2D6 gene pleiomorphism.
CN201811270460.0A 2018-10-29 2018-10-29 A kind of composition, kit, sample treatment and application detecting people CYP2D6 gene pleiomorphism Pending CN109321651A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811270460.0A CN109321651A (en) 2018-10-29 2018-10-29 A kind of composition, kit, sample treatment and application detecting people CYP2D6 gene pleiomorphism

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811270460.0A CN109321651A (en) 2018-10-29 2018-10-29 A kind of composition, kit, sample treatment and application detecting people CYP2D6 gene pleiomorphism

Publications (1)

Publication Number Publication Date
CN109321651A true CN109321651A (en) 2019-02-12

Family

ID=65259179

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811270460.0A Pending CN109321651A (en) 2018-10-29 2018-10-29 A kind of composition, kit, sample treatment and application detecting people CYP2D6 gene pleiomorphism

Country Status (1)

Country Link
CN (1) CN109321651A (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110184343A (en) * 2019-06-26 2019-08-30 湖南健基生物技术有限公司 Detect composition, kit, method and the application of CYP2C9 and VKORC1 gene pleiomorphism
CN112501265A (en) * 2020-09-24 2021-03-16 杭州百迈生物股份有限公司 Reagent, detection method and kit for detecting CYP2D6 gene
CN114277190A (en) * 2021-12-31 2022-04-05 安徽中盛溯源生物科技有限公司 Specific DNA fragment, primer, kit and detection method for detecting foreign gene residues in hiPSC

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103088156A (en) * 2012-12-26 2013-05-08 杭州三合创新科技有限公司 White spot syndrome virus detection kit and method
CN104894236A (en) * 2015-04-30 2015-09-09 武汉友芝友医疗科技有限公司 Human CYP2D6 and SULT1A1 gene polymorphism detection kit
CN105861703A (en) * 2016-05-16 2016-08-17 钟诗龙 Kit for simultaneously detecting multisite mutation of genes CYP2C19 and CYP2D6
CN106755360A (en) * 2016-12-06 2017-05-31 武汉海吉力生物科技有限公司 Nucleic acid, kit and method for detecting mankind's CYP2D6 gene pleiomorphisms
CN107227361A (en) * 2017-06-29 2017-10-03 庄江兴 Primer, probe and detection kit for detecting CYP2C19 gene pleiomorphisms

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103088156A (en) * 2012-12-26 2013-05-08 杭州三合创新科技有限公司 White spot syndrome virus detection kit and method
CN104894236A (en) * 2015-04-30 2015-09-09 武汉友芝友医疗科技有限公司 Human CYP2D6 and SULT1A1 gene polymorphism detection kit
CN105861703A (en) * 2016-05-16 2016-08-17 钟诗龙 Kit for simultaneously detecting multisite mutation of genes CYP2C19 and CYP2D6
CN106755360A (en) * 2016-12-06 2017-05-31 武汉海吉力生物科技有限公司 Nucleic acid, kit and method for detecting mankind's CYP2D6 gene pleiomorphisms
CN107227361A (en) * 2017-06-29 2017-10-03 庄江兴 Primer, probe and detection kit for detecting CYP2C19 gene pleiomorphisms

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110184343A (en) * 2019-06-26 2019-08-30 湖南健基生物技术有限公司 Detect composition, kit, method and the application of CYP2C9 and VKORC1 gene pleiomorphism
CN112501265A (en) * 2020-09-24 2021-03-16 杭州百迈生物股份有限公司 Reagent, detection method and kit for detecting CYP2D6 gene
CN114277190A (en) * 2021-12-31 2022-04-05 安徽中盛溯源生物科技有限公司 Specific DNA fragment, primer, kit and detection method for detecting foreign gene residues in hiPSC

Similar Documents

Publication Publication Date Title
CN109321651A (en) A kind of composition, kit, sample treatment and application detecting people CYP2D6 gene pleiomorphism
AU2015213570B2 (en) NGS systems control and methods involving the same
CN111235272A (en) Composition for one-time detection of lung cancer multiple gene mutation and application thereof
CN112941210A (en) Kit and method for detecting drug-resistant mutation of mycobacterium tuberculosis rifampicin and isoniazid
CN106939334B (en) Method for detecting fetal DNA content in plasma of pregnant woman
CN109182493B (en) Primer and kit for detecting human 16p11.2 microdeletion syndrome and detection method thereof
CN113502335B (en) Molecular marker related to sheep growth traits and application thereof
CN102286616A (en) Method and kit for detecting mycobacterium tuberculosis isoniazide drug resistant gene mutation
CN109295192A (en) A kind of composition, kit, sample treatment and application detecting people MDR1 gene pleiomorphism
CN108060213A (en) Isothermal duplication method detection SNP site probe and kit based on the recombinase-mediated that probe is oriented to
CN109371113A (en) A kind of composition, kit, sample treatment and application detecting mankind&#39;s APOE and SLCO1B1 gene pleiomorphism
CN110607381A (en) Mycobacterium tuberculosis detection kit and method
CN110272988A (en) Mankind&#39;s mthfr gene polymorphic detection kit
CN114085926B (en) Primer, probe, kit and detection method for SNP locus polymorphism of ABCB1 gene C3435T
CN111593115B (en) Primer and probe combination and kit for multiplex real-time fluorescence PCR detection of beta-thalassemia gene mutation
CN110004215A (en) Mankind&#39;s mthfr gene polymorphic detection kit
CN107177688A (en) The kit of the deaf susceptibility gene mutation of detection and its application
CN107043808A (en) UGT1A1 genetic polymorphism detection primer peptide nucleic acids and its kit
CN110241231A (en) Detect composition, kit, method and the application of CYP2C19 gene pleiomorphism
CN105969842A (en) Glu504lys detection genotyping kit based on AllGlo probe and genotyping method thereof
CN111793676A (en) Method and kit for detecting gene polymorphism and application thereof
CN112029851A (en) Method and kit for detecting gene polymorphism of clopidogrel medication and application of kit
CN103451300B (en) Deaf sick tumor susceptibility gene GJB2 235delC, 299delAT mutation detection kit
CN116024349B (en) Primer probe combination and kit for methylation detection of cervical cancer
CN114703306B (en) Detection method and kit for mycoplasma genitalium parC gene mutation type

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20190212