CN103451300B - Deaf sick tumor susceptibility gene GJB2 235delC, 299delAT mutation detection kit - Google Patents
Deaf sick tumor susceptibility gene GJB2 235delC, 299delAT mutation detection kit Download PDFInfo
- Publication number
- CN103451300B CN103451300B CN201310410783.6A CN201310410783A CN103451300B CN 103451300 B CN103451300 B CN 103451300B CN 201310410783 A CN201310410783 A CN 201310410783A CN 103451300 B CN103451300 B CN 103451300B
- Authority
- CN
- China
- Prior art keywords
- probe
- 299delat
- 235delc
- internal reference
- gjb2
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Do you the invention discloses deaf sick tumor susceptibility gene GJB2? 235delC, 299delAT mutation detection kit, this test kit comprises amplifing reagent and series of standards product; Described amplifing reagent comprises: PCR damping fluid, MgCl
2with the reaction mixture of dNTPs, Taq enzyme, ultrapure water, high specific amplification GJB2:235delC, 299delAT; Described series of standards product comprise: 235delC somatotype standard substance, 299delAT somatotype standard substance.The present invention for detected object with above-mentioned 2 deaf sick susceptibility locis, by amplification and the fluorescent quantitation detection of above-mentioned deaf susceptibility loci, with the contrast of genotyping standard product, can filter out the individuality containing above-mentioned site mutation, determine genotype simultaneously.To the detection of deaf sick tumor susceptibility gene, especially significant to the examination of newborn infant's deaf gene.
Description
Technical field
The present invention relates to deaf sick tumor susceptibility gene GJB2235delC, 299delAT mutation detection kit, belong to technical field of biological.
Background technology
Show the paathogenic factor research that hearing and speech impairments person carries out in world wide, about the cause of disease of 60-80% patient is relevant with inherited genetic factors, and wherein the clinical data of developed country shows, hereditary hearing impairment accounts for 80% in deafness patient.Therefore in recent ten years, the pathogenesis of hereditary hearing impairment and the research of molecular epidemiology thereof become one of most important content of deaf disease research.Along with the Human Genome Project completes, the location of deaf ospc gene and clone achieve huge progress, the molecule genetics research of deaf disease and the data of molecular epidemiology make investigators progressively recognize deaf sick susceptibility gene mutation safeguarding that hearing is healthy and find hearing abnormal in importance.
In the deaf-related gene of having located at present and clone, GJB2 is modal tumor susceptibility gene, in congenital severe deafness patient, account for 30-50%.At present, had been found that 100 various mutations types at this gene, be 235delC at the mutant form that China is common, it accounts for 74.14% in all disease cause mutations, and the Chinese non-syndromic hearing loss patient of about 22.2% is relevant with this sudden change.The mutation allele frequency of GJB2299_300delAT is about 3% in addition.
Gene tester conventional at present has: direct Sequencing (directsequencing, DS), Ligase detection reaction (ligasedetectionreaction, LDR), restriction fragment length polymorphism analysis (restrictionfragmentlengthpolymorphism, RFLP), dhplc analysis (denaturinghighperformanceliquidchromotography, DHPLC), gene chip.All there is different defects in these methods, the problem such as such as complex operation, result not easily interpretation, poor repeatability, false negative false positive are many.For the gene type of chromosome mutation, general fluorescence quantitative kit often needs to carry out multitube detection to same sample, could obtain the somatotype information of more than 2.
The present invention for detected object with above-mentioned 2 deaf sick susceptibility locis, by amplification and the fluorescent quantitation detection of above-mentioned deaf susceptibility loci, with the contrast of genotyping standard product, can filter out the individuality containing above-mentioned site mutation, determine genotype simultaneously.To the detection of deaf sick tumor susceptibility gene, especially significant to the examination of newborn infant's deaf gene; The method of four-way/tetra-look dyestuff-fluorescence quantitative PCR detection is utilized to achieve the target of 2 site somatotypes detections first, and containing internal reference with monitoring and detection process.Stopped pipe detects the pollution preventing uncap detection operation and generation, for clinical diagnosis and association area scientific research provide reliable method.
Summary of the invention
The object of the invention is to provide one can detect deaf sick tumor susceptibility gene GJB2235delC, 299delAT sudden change in 1 hour simultaneously, distinguished genotype and contained internal reference with monitoring and detection process.
To achieve these goals, the technical scheme taked: a kind of deaf sick tumor susceptibility gene GJB2235delC, 299delAT mutation detection kit, this test kit comprises amplifing reagent and series of standards product;
Described amplifing reagent comprises: PCR damping fluid, MgCl
2with the reaction mixture of dNTPs, Taq enzyme, ultrapure water, the primer mixture of high specific amplification GJB2:235delC, 299delAT, above-mentioned site is carried out to the probe mixture of specific detection, to the general probe mixture that human gene group DNA detects, internal reference and the primed probe mixture that internal reference is detected;
Described series of standards product comprise: 235delC somatotype standard substance (the 235delC heterozygous mutation DNA sample 1 of 10ng/uL is managed), 299delAT somatotype standard substance (the 299delAT heterozygous mutation DNA sample 1 of 10ng/uL is managed).
The described probe for carrying out specific detection to GJB2:235delC, 299delAT sudden change, to the general probe that human gene group DNA detects, four groups are divided into the probe that internal reference detects, 5 ' the end of the luminophore that employing four kinds is different respectively to each group of probe marks, and the 3 ' quenching group held can for identical or different fluorescence dye.
Described probe four groups of being divided into are: the probe for carrying out specific detection to GJB2:299delAT sudden change adopts same group of luminescence-quenching group; Probe for carrying out specific detection to 235delC sudden change adopts same group of luminescence-quenching group; Same group of luminescence-quenching group is adopted to the general probe that human gene group DNA detects; Probe for carrying out specific detection to internal reference adopts same group of luminescence-quenching group.
Described 5 ' the fluorescence dye holding different luminophores to use can be: ALEXAFluor350, FAM, TET, HEX/JOE/VIC, Cy3, TAMRA, ROX ,/TexasRed, Cy5; 3 ' the fluorescence dye holding identical or different quenching group to use can be: BHQ1, BHQ2, TAMRA, DABCYL.
Described test kit is used to carry out the condition of PCR composite amplification reaction: the pH value of PCR amplification system is 8.0-9.0, magnesium ion concentration is 1.5-3.5mM, the final concentration of 4 kinds of dNTP is respectively 200-300 μM, the consumption of Taq enzyme is 0.1-0.4U/ μ L, and the primer in primed probe mixture, the final concentration of probe are 0.2-0.4 μM.
When using described test kit to carry out pcr amplification, amplification elementary reaction increases GJB2:235delC, 299delAT in a composite amplification reaction system simultaneously, human gene group DNA's target sequence, internal reference target sequence.
The primer detected for GJB2:235delC, 299delAT is:
SEQNO.1：5’-ACGTGTGCTACGATCACTACTTCC-3’；
SEQNO.2：5’-CTCCTCGATGTCCTTAAATTCACTC-3’；
Probe for GJB2:299delAT abrupt climatic change is:
SEQNO.5：5’-CCTTGATGAACTTCCTCTTCTTCTCGTC
C-3’；
Probe for GJB2:235delC abrupt climatic change is:
SEQNO.6：5’-ACATCCGGCTATGGGCCT
C-3’
General probe for detecting human gene group DNA is:
SEQNO.7：5’-ACGCCAGCGCTCCTAGTGGC-3’；
Wherein LNA nucleosides represents with boldface type.
3. test kit according to claim 1 and 2, it is characterized in that: described internal reference be the sequence of one section of synthetic be loaded into pMD18-T plasmid vector on obtain, the sequence (SEQNO.4) of this section of synthetic does not find high relevant homologous region through NCBI website Blast.Extension increasing sequence and be to the primed probe that internal reference detects:
SEQNO.8：CACCAGCATCTCCCTTCATGTTGACTACCGTAGGCTGCCACCATTTCAGAAGAACGATGACCCCTTGCTAGCAGTGGAAGAGTTGCATGAAGGTAATATACTCGATCCGTAATTCCACTATTGAAATGGGTACATGACTGATACAGACCATC
SEQNO.9：5’-CACCAGCATCTCCCTTCATGT-3’
SEQNO.10：5’-GATGGTCTGTATCAGTCATGTACCCA-3’
SEQNO.11：5’-GAACGATGACCCCTTGCTAGCAGTGGAAGAG-3’
The composite amplification in described each site adopts polymerase chain reaction to realize, and adopts quantitative fluorescent PCR to detect in real time, by synchronous amplification and analysis with standard substance, draws somatotype information or the mutant proportion information of institute's mark basis.
Wherein detected human gene group DNA is: use Chelex method, magnetic bead extraction method or phenol/chloroform extraction method to process to source sample the DNA obtained; Described source sample is: derive from the mankind: filter paper blood cake/buccal swab sample, FTA card blood cake/buccal swab sample, buccal swab sample, blood/trace, tissue, amniotic fluid.
When using described test kit to carry out pcr amplification, amplification elementary reaction carries out in the PCR instrument of any model, amplification program: 94-98 DEG C 1-5min; 94-98 DEG C of 5-10s, 55-65 DEG C of 30-50s of 45 circulations.
The band fluorescent mark used also mixes the primer of modification through LNA nucleoside monomers, improve the Tm value of probe, shorten probe length, enhance the insight of probe to point mutation, thus add sensitivity and the specificity of probe, prevent false positive and false-negative appearance.
Accompanying drawing explanation
Fig. 1 is that test kit of the present invention is to the detection collection of illustrative plates in GJB2:235delC somatotype standard substance (under 10ngDNA background 235 heterozygous mutant DNA) difference dilution gradient situation;
Fig. 2 is that test kit of the present invention is to the detection collection of illustrative plates in GJB2:299delAT somatotype standard substance (under 10ngDNA background 299 heterozygous mutant DNA) difference dilution gradient situation;
Fig. 3 is the canonical plotting of making according to Fig. 1, Fig. 2 data;
Fig. 4 is that test kit of the present invention carrys out the detection collection of illustrative plates of source DNA (0.5ng/20uL system) to normal individual blood cake;
Fig. 5 is that test kit of the present invention carrys out the detection collection of illustrative plates of source DNA (0.5ng/20uL system) to the individual blood cake that GJB2:235delC suddenlys change;
Fig. 6 is that test kit of the present invention carrys out the detection collection of illustrative plates of source DNA (1ng/20uL system) to GJB2:299delAT mutated individual blood cake.
Embodiment
Below in conjunction with the drawings and specific embodiments, the invention will be further described, but not as a limitation of the invention.
Embodiment 1 test kit of the present invention detects the DNA sample of sudden change and normal individual
Probe 5 ' for GJB2:235delC abrupt climatic change is held and is adopted FAM fluorochrome label, probe 5 ' for GJB2:299delAT abrupt climatic change is held and is adopted HEX fluorochrome label, employing Cy5 fluorochrome label held by the probe 5 ' detected for human mitochondrial DNA, and the probe 5 ' end detected for internal reference adopts ROX fluorochrome label.
1, sample to be tested 1000 parts, all uses the technological method of " DNA extraction-pcr amplification-order-checking " to carry out order-checking to each site and detects.Wherein, GJB2:235delC suddenlys change 1 part, sample, and GJB2:299delAT suddenlys change 4 parts, sample.
2, the extracting genome DNA of sample
Chelex extraction method: cut 1 ~ 3mm blood cake (sample comes from XX hospital laboratory) and be placed in 1.5mL centrifuge tube, add sdH
2o1mL, vibrates centrifugal, abandons supernatant liquor, and repeating step twice, abandons supernatant liquor, and the rear quick rifle head with cutting that 5%Chelex-100 concussion suspended is drawn 200 μ L and added in centrifuge tube, the vibration several seconds.After 56 DEG C of water bath heat preservation 30min, the vibration several seconds.95 DEG C of boiling water bath 10min, the slight oscillatory several seconds.The centrifugal 5min of 2000rpm, the DNA for extracting in supernatant.
3, the detection analysis of amplification and amplified production
(1) PCR amplification system:
(2) amplification program on ABIStepOnePlus type quantitative real time PCR Instrument: 95C3min; 95C5s, 60C35s (collection fluorescent signal), be 45cycles.
(3) analysis is detected
After 235delC somatotype standard substance (under 10ngDNA background 235 heterozygous mutant DNA) are mixed (10ng/uL) with 299delAT somatotype standard substance (under 10ngDNA background 299 heterozygous mutant DNA) 1:1, and dilution is 5ng/uL, 1ng/uL, 0.5ng/uL, getting 1uL respectively joins in amplification system as template, carry out fluorescent quantitation and collect data obtaining Fig. 1, Fig. 2 (unrisen signal all omits), Ct value according to each concentration and correspondence is figure, obtains the typical curve of Fig. 3.
Fig. 4 is that test kit of the present invention carrys out the detection collection of illustrative plates of source DNA (0.5ng/20uL system) to normal individual blood cake: obtain internal reference probe (ROX) Air conduct measurement to signal and sigmoid curve, Ct value is 23.08, shows that this amplified reaction is effective; Obtain human gene group DNA's probe (Cy5) two Air conduct measurement to signal and sigmoid curve, Ct value is 35.11, shows that the concentration of this DNA sample is about 0.5ng/uL; 235delC probe (FAM) and 299delAT probe (HEX) two sense channels do not have sigmoid curve, show that this sample is the normal individual source that 235 and 299 sites do not exist sudden change.
Fig. 5 is that test kit of the present invention carrys out the detection collection of illustrative plates of source DNA (0.5ng/20uL system) to the individual blood cake that GJB2:235delC suddenlys change: obtain internal reference probe (ROX) Air conduct measurement to signal and sigmoid curve, Ct value is 23.00, shows that this amplified reaction is effective; Obtain human gene group DNA's probe (Cy5) two Air conduct measurement to signal and sigmoid curve, Ct value is 35.07, shows that the concentration of this DNA sample is about 0.5ng/uL.299delAT probe (HEX) sense channel does not have sigmoid curve, shows that this sample 299 site does not exist sudden change; 235delC probe (FAM) Air conduct measurement is to signal and sigmoid curve, and Ct value is 31.19, and contrast Fig. 3 finds the Ct value of 0.5ng human gene group DNA 235delC heterozygous mutant should be 32.09, then show that this sample should be 235delC homozygous mutant.
Fig. 6 is that test kit of the present invention carrys out the detection collection of illustrative plates of source DNA (1ng/20uL system) to GJB2:299delAT mutated individual blood cake: obtain internal reference probe (ROX) Air conduct measurement to signal and sigmoid curve, Ct value is 23.05, shows that this amplified reaction is effective; Obtain human gene group DNA's probe (Cy5) two Air conduct measurement to signal and sigmoid curve, Ct value is 34.02, shows that the concentration of this DNA sample is about 1ng/uL.235delC probe (FAM) sense channel does not have sigmoid curve, shows that this sample 235 site does not exist sudden change; 299delAT probe (HEX) Air conduct measurement is to signal and sigmoid curve, and Ct value is 35.89, and contrast Fig. 3 determines that this sample should be 1ng/uL299delAT heterozygous mutant.
Compared with sequence measurement: be consistent to the homologous genes seat genotyping result of the sample in same source.
10 × PCR damping fluid of different pH used in above embodiment, with the Tris-HCl buffer of different pH value, the Tris-HCl concentration in 1 × PCR damping fluid is 10mM, KCl concentration is 50mM; Taq polysaccharase used in the present invention and other reagent and material are commercially available prod.
Claims (5)
1. deaf sick tumor susceptibility gene GJB2235delC, 299delAT mutation detection kit, is characterized in that comprising amplifing reagent and series of standards product; Described amplifing reagent comprises: PCR damping fluid, MgCl
2with the reaction mixture of dNTPs, Taq enzyme, ultrapure water, high specific amplification GJB2:235delC, 299delAT primer mixture, above-mentioned site is carried out to the probe mixture of specific detection, to the general probe mixture that human gene group DNA detects, internal reference and the primed probe mixture that internal reference is detected;
Described series of standards product comprise: 235delC somatotype standard substance, 299delAT somatotype standard substance;
Wherein, the primer detected for GJB2:235delC, 299delAT is:
SEQNO.1：5’-ACGTGTGCTACGATCACTACTTCC-3’；
SEQNO.2：5’-CTCCTCGATGTCCTTAAATTCACTC-3’；
Probe for GJB2:299delAT abrupt climatic change is:
SEQNO.5：5’-CCTTGATGAACTTCCTCTTCTTCTCGTC
T C-3’；
Probe for GJB2:235delC abrupt climatic change is:
SEQNO.6：5’-ACATCCGGCTATGGGCCT
G C-3’
Wherein LNA nucleosides represents with boldface type;
General probe for detecting human gene group DNA is:
SEQNO.7：5’-ACGCCAGCGCTCCTAGTGGC-3’；
Described internal reference be the sequence of one section of synthetic be loaded into pMD18-T plasmid vector on obtain, the sequence SEQNO.8 of this section of synthetic does not find high relevant homologous region through NCBI website Blast;
Internal reference extension increasing sequence and be to the primed probe that internal reference detects:
Internal reference extension increasing sequence SEQNO.8:
CACCAGCATCTCCCTTCATGTTGACTACCGTAGGCTGCCACCATITCAGAAGAACGATGACCCCTTGCTAGCAGTGGAAGAGTTGCATGAAGGTAATATACTCGATCCGTAATTCCACTATTGAAATGGGTACATGACTGATACAGACCATC
Internal reference primer is:
SEQNO.9：5’-CACCAGCATCTCCCTTCATGT-3’
SEQNO.1O：5’-GATGGTCTGTATCAGTCATGTACCCA-3’
Internal reference probe is:
SEQNO.11：5’-GAACGATGACCCCTTGCTAGCAGTGGAAGAG-3’：
The described probe for GJB2:235delC, 299delAT abrupt climatic change, to the general probe that human gene group DNA detects, internal reference probe, 5 ' end and the 3 ' end of every bar probe all carry out fluorochrome label, and 5 ' end is luminophore and 3 ' end is quenching group.
2. test kit according to claim 1, it is characterized in that: the described probe for GJB2:235delC, 299delAT abrupt climatic change, to the general probe that human gene group DNA detects, internal reference probe is divided into four groups, 5 ' the end of the luminophore that employing four kinds is different respectively to each group of probe marks, and the 3 ' quenching group held is identical or different fluorescence dye.
3. test kit according to claim 2, is characterized in that: probe four groups of being divided into are: the probe for carrying out specific detection to GJB2:299delAT sudden change adopts same group of luminescence-quenching group; Probe for carrying out specific detection to 235delC sudden change adopts same group of luminescence-quenching group; Same group of luminescence-quenching group is adopted to the general probe that human gene group DNA detects; Probe for carrying out specific detection to internal reference adopts same group of luminescence-quenching group.
4. test kit according to claim 3, is characterized in that: the 5 ' fluorescence dye holding different luminophores to use is: ALEXAFluor350, FAM, TET, HEX/JOE/VIC, Cy3, TAMRA, ROX ,/TexasRed, Cy5; 3 ' the fluorescence dye holding identical or different quenching group to use is: BHQ1, BHQ2, TAMRA, DABCYL.
5. test kit according to claim 1, is characterized in that: described series of standards product are: 235delC somatotype standard substance, and the 235delC heterozygous mutation DNA sample 1 comprising 10ng/uL is managed; 299delAT somatotype standard substance, the 299delAT heterozygous mutation DNA sample 1 comprising 10ng/uL is managed.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310410783.6A CN103451300B (en) | 2013-09-11 | 2013-09-11 | Deaf sick tumor susceptibility gene GJB2 235delC, 299delAT mutation detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310410783.6A CN103451300B (en) | 2013-09-11 | 2013-09-11 | Deaf sick tumor susceptibility gene GJB2 235delC, 299delAT mutation detection kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103451300A CN103451300A (en) | 2013-12-18 |
| CN103451300B true CN103451300B (en) | 2016-03-09 |
Family
ID=49734133
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310410783.6A Active CN103451300B (en) | 2013-09-11 | 2013-09-11 | Deaf sick tumor susceptibility gene GJB2 235delC, 299delAT mutation detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103451300B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109554463A (en) * | 2018-12-29 | 2019-04-02 | 中国人民解放军第四军医大学 | A kind of phonosensitive nerve deafness Disease-causing gene GJB2 abrupt climatic change kit |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2448163C2 (en) * | 2010-06-09 | 2012-04-20 | Учреждение Российской академии наук Институт биохимии и генетики Уфимского научного центра РАН | Method for detecting 17 gjb2 and gjb6 gene mutations accompanying nonsyndromic deafness |
| CN102465174A (en) * | 2010-11-09 | 2012-05-23 | 王宝恒 | Method for detecting GJB2 gene mutation by fluorescence quantitative PCR technology, and kit thereof |
| CN102534030A (en) * | 2012-02-14 | 2012-07-04 | 北京科聆金仪生物技术有限公司 | Kit for jointly detecting four deafness predisposing genes and application thereof |
| CN102605052A (en) * | 2012-02-14 | 2012-07-25 | 北京科聆金仪生物技术有限公司 | Fluorescence detection kit for detecting deafness susceptibility gene GJB2 235delC and application of fluorescence detection kit |
| CN102618624A (en) * | 2011-01-26 | 2012-08-01 | 苏州市立医院 | Kit for screening deaf gene of Chinese populations, and use method thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2245185B1 (en) * | 2008-02-19 | 2014-04-30 | Med-El Elektromedizinische Geräte GmbH | A mutation in the regulatory region of gjb2 mediates neonatal hearing loss within dfnb1 |
-
2013
- 2013-09-11 CN CN201310410783.6A patent/CN103451300B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2448163C2 (en) * | 2010-06-09 | 2012-04-20 | Учреждение Российской академии наук Институт биохимии и генетики Уфимского научного центра РАН | Method for detecting 17 gjb2 and gjb6 gene mutations accompanying nonsyndromic deafness |
| CN102465174A (en) * | 2010-11-09 | 2012-05-23 | 王宝恒 | Method for detecting GJB2 gene mutation by fluorescence quantitative PCR technology, and kit thereof |
| CN102618624A (en) * | 2011-01-26 | 2012-08-01 | 苏州市立医院 | Kit for screening deaf gene of Chinese populations, and use method thereof |
| CN102534030A (en) * | 2012-02-14 | 2012-07-04 | 北京科聆金仪生物技术有限公司 | Kit for jointly detecting four deafness predisposing genes and application thereof |
| CN102605052A (en) * | 2012-02-14 | 2012-07-25 | 北京科聆金仪生物技术有限公司 | Fluorescence detection kit for detecting deafness susceptibility gene GJB2 235delC and application of fluorescence detection kit |
Non-Patent Citations (3)
| Title |
|---|
| GJB2 gene mutations in newborns with non-syndromic hearing impairment in Northern China;Gui-zhi Shi et.al.,;《Hearing Research》;20040901;第197卷;第19-23页 * |
| Mutations of Cx26 gene (GJB2) for prelingual deafness in Taiwan;Yi-Chun Wang et.al.,;《European Journal of Human Genetics》;20021231;第10卷;第495-498页 * |
| 常染色体隐性遗传耳聋家系的诊断和产前诊断;项延包等;《中华耳科学杂志》;20121231;第10卷(第3期);第360-363页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103451300A (en) | 2013-12-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102534031B (en) | High-specificity kit for detecting deafness predisposing genes and uses | |
| CN104046700B (en) | The detection kit of a kind of Rapid identification donkey hide, horse skin and mule skin | |
| CN103911452A (en) | Chinese population deaf gene screening kit and application thereof | |
| CN110055312B (en) | Primer, probe and kit for detecting cis-trans mutation of EGFR gene C797S and T790M | |
| CN105177115A (en) | UGT1A1 combined gene locus fluorescence detection kit for guiding irinotecan chemotherapeutic drug individualized treatment | |
| CN106148484B (en) | A kind of kit that diagnosis Y chromosome is micro-deleted | |
| CN103451302A (en) | Deafness susceptible gene mitochondrion 12SrDNA 1555A>G and 1494C>T mutant ratio detection kit | |
| CN107586857A (en) | Nucleic acid, kit and method for the red-black coat color gene of Rapid identification pig | |
| CN102586433B (en) | Deafness predisposing gene 12S rRNA (ribosomal ribonucleic acid) 1494C>T fluorescence detection kit and application thereof | |
| CN107513577A (en) | A kind of method of efficient detection EGFRT790M mutant and probe and kit for detection | |
| CN102286616A (en) | Method and kit for detecting mycobacterium tuberculosis isoniazide drug resistant gene mutation | |
| CN109321651A (en) | A kind of composition, kit, sample treatment and application detecting people CYP2D6 gene pleiomorphism | |
| CN109182493A (en) | The primer and kit and its detection method of people's 16p11.2 microdeletion syndrome detection | |
| CN102534030B (en) | Kit for jointly detecting four deafness predisposing genes and application thereof | |
| CN103451300B (en) | Deaf sick tumor susceptibility gene GJB2 235delC, 299delAT mutation detection kit | |
| CN103451301B (en) | Deaf sick tumor susceptibility gene SLC26A4 2168A > G, IVS7-2A > G mutation detection kit | |
| CN106755530B (en) | MGB probe real-time fluorescence PCR method for detecting HLA-A31: 01 allele and primer probe combination thereof | |
| CN106755422B (en) | Detection method of MEG3 gene SNP related to cattle growth traits and application thereof | |
| CN104593510A (en) | Primer, probe and method for detecting SNP allele variation of peanut FAD2 genes | |
| CN103436625B (en) | 6 deaf sick susceptibility loci somatotype/mutant proportion detection kit | |
| CN102605052B (en) | Fluorescence detection kit for detecting deafness susceptibility gene GJB2 235delC and application of fluorescence detection kit | |
| CN111172248B (en) | General kit for verifying copy number variation based on fragment analysis technology | |
| CN102660636A (en) | A fluorescence detection kit for detecting deafness susceptibility gene 12S rRNA 1555A>G and application thereof | |
| CN110438226B (en) | Kit for detecting cis-trans mutation, sample processing method and judgment method | |
| CN110317869A (en) | Detect the KASP primer set and kit of APOE genotype |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |