CN113278693A

CN113278693A - DNA methylation marker for early colorectal cancer and adenoma, method for detecting same and application thereof

Info

Publication number: CN113278693A
Application number: CN202010745610.XA
Authority: CN
Inventors: 何逖; 吴帅来; 姚浩
Original assignee: Shanghai Jikai Medical Laboratory Co ltd
Current assignee: Shanghai Jikai Medical Laboratory Co ltd
Priority date: 2020-07-29
Filing date: 2020-07-29
Publication date: 2021-08-20
Also published as: CN113699237A; WO2022022386A1

Abstract

The invention provides a DNA methylation marker for diagnosing, screening and predicting risk of early colorectal cancer and adenoma, wherein the marker is that CpG sites in NDRG4 gene are methylated at least at 2 sites of 38 th site, 47 th site, 50 th site and 52 th site in SEQ ID NO.1 simultaneously. The invention also provides a method, a primer pair, a probe and a kit for detecting the DNA methylation marker. The method disclosed by the invention has the advantages of good specificity, high sensitivity, low detection cost and simplicity in operation on early colorectal cancer and adenoma, and is beneficial to wide application of early colorectal cancer screening.

Description

DNA methylation marker for early colorectal cancer and adenoma, method for detecting same and application thereof

Technical Field

The invention relates to the field of gene detection, in particular to a methylation marker of early colorectal cancer and adenoma, a method for detecting the methylation marker and application of the methylation marker.

Background

In china, the incidence of colorectal cancer ranks 4 th among all malignancies. The insufficient screening of the colorectal cancer in China is a main reason for the low five-year survival time of the colorectal cancer in China. Recent studies have shown that feces contain trace amounts of nucleic acids derived from human intestinal exfoliated cells, and that multi-target detection of these nucleic acids can be an effective predictor of malignant changes, e.g., multi-target detection of fecal DNA can be used to screen for intestinal cancer, although sensitivity to high-grade adenomas is low. Fecal DNA multi-target detection technology was approved by the FDA for bowel cancer screening in 2014 and is incorporated into NCCN bowel cancer screening guidelines and the us cancer prevention program.

The intestinal cancer needs a growth cycle of 5-10 years from the initial polyp to the adenocarcinoma, and the treatment cost at this stage is low and the effect is good; however, once this stage is broken through, the disease course becomes longer, the speed of the disease becomes faster, the treatment cost becomes high, and the effect is extremely poor. Therefore, early diagnosis and treatment are the best way to deal with colorectal cancer.

Most colorectal cancers begin with the growth of the lining of the colon or rectum, called polyps. As the course of disease extends, certain types of polyps can progress to cancer. Common polyp types are hyperplastic polyps, and colorectal adenomatous polyps; the latter has a probability of developing cancer, and thus, adenomas are referred to as precancerous diseases. Intestinal adenomas can be screened by an endoscope, but the technical requirements on inspectors are higher, and the omission rate of the endoscope screening existing clinically is higher. Therefore, genetic screening for adenomas is of great significance for early colorectal cancer diagnosis and screening.

There is a great need in the art for a DNA marker for early colorectal cancer and adenoma for use in early colorectal cancer diagnosis and screening.

Disclosure of Invention

The invention aims to provide a DNA methylation marker of early colorectal cancer and adenoma, a method for detecting the marker and application of the marker.

In a first aspect of the present invention, there is provided a DNA methylation marker for diagnosis, screening and risk prediction of early colorectal cancer and adenoma, the marker being a DNA methylation marker in which CpG sites in the NDRG4 gene are simultaneously methylated at least 2 of positions 38, 47, 50 and 52 in the sequence shown in SEQ ID No.1, wherein the sequence numbering is based on the sequence shown in SEQ ID No. 1:AAGCGGCAGGAGCAGCTCACAGCCAGGAGCGCTCTCCCGCCCCCAACGCCGCGCTCCCCCCTCCAAAACGGTTTAAAAAAATCCACCAATTGCATGGCC (SEQ ID No.: 1). Specifically, the marker is that CpG sites in the NDRG4 gene are methylated at the following sites in the sequence shown in SEQ ID NO.1 at the same time:

(1) position 38 and position 47; or

(2) 38 th and 50 th bits; or

(3) 38 th and 52 th bits; or

(4) 47 th and 50 th bits; or

(5) 47 th and 52 th bits; or

(6) 50 th and 52 th bits; or

(7) 38 th, 47 th and 50 th bits; or

(8) 38 th, 47 th and 52 th bits; or

(9) 47 th, 50 th and 52 th bits; or

(10) 38 th, 47 th, 50 th and 52 th bits.

In another embodiment, the present invention also provides a DNA methylation marker for diagnosis, screening and risk prediction of early colorectal cancer and adenoma, wherein the marker is a DNA methylation marker in which CpG sites in the NDRG4 gene are simultaneously methylated at least 2 of the positions 38, 47 and 50 in the sequence shown in SEQ ID No.1, and specifically comprises the following sites in the sequence shown in SEQ ID No. 1:

(1) position 38 and position 47; or

(2) 38 th and 50 th bits; or

(3) 47 th and 50 th bits; or

(4) 38 th, 47 th and 50 th bits.

In a second aspect of the invention, there is provided a primer pair for amplifying a DNA methylation marker according to the first aspect of the invention. In one embodiment, the primer pair is used for amplifying the nucleotide segment shown in SEQ ID No. 1.

In one embodiment, the primer pair comprises: an upstream primer NDRG4-F1: 5'-AAGCGGTAGGAGTAGTTTATAGTTAGGAG-3' (SEQ ID No.: 3); and/or a downstream primer NDRG4-R1: 5'-GACCATACAATTAATAAATTTTTTTAAACC-3' (SEQ ID No.: 4).

In a third aspect of the invention, there is provided a probe targeting a DNA methylation marker according to the first aspect of the invention.

In one embodiment, the probe has a sequence as shown in SEQ ID No. 7: AACGCGACGTTAAAAACGA (SEQ ID No.: 7).

In a fourth aspect of the present invention, there is provided a method for detecting a DNA methylation marker according to the first aspect of the present invention, comprising the steps of:

1) extracting genomic DNA from a sample;

2) carrying out conversion treatment on the DNA obtained in the step 1) by using sulfite to obtain a conversion product;

3) amplifying the transformation product obtained in the step 2) by using the primer pair of the second aspect of the invention to obtain an amplification product; and

4) detecting methylation of the DNA methylation marker of the first aspect of the invention in the amplified sequence obtained in step 3).

In one embodiment, the sample is selected from the group consisting of: feces, blood, colorectal pathologies and combinations thereof; preferably faeces.

In a particular embodiment, the method of the fourth aspect of the invention further comprises the step of preserving the sample prior to step 1). The step of preserving the sample comprises placing the sample in a sample preservation solution. The sample preservation solution at least comprises: sodium acetate 0.1M, sodium chloride 0.5M, EDTA50mM, SDS 1.4% and a proper amount of acetic acid, wherein the acetic acid is used for adjusting the pH of the sample preservation solution to 5.5.

In a specific embodiment, the DNA methylation marker of the first aspect of the invention has the sequence shown in SEQ ID No. 1. Under the action of the DNA methylation modification conversion reagent, the sequence of the DNA methylation marker is converted into a sequence shown as SEQ ID No. 2: AAGCGGTAGGAGTAGTTTATAGTTAGGAGCGTTTTTTCGTTTTTAACGTCGCGTTTTTTTTTTTAAAACGGTTTAAAAAAATTTATTAATTGTATGGTC (SEQ ID No.:2), wherein the underlined bases are the exact sites of the DNA methylation markers. The sequence of the amplification product in the step 3) is shown as SEQ ID No. 2.

In a specific embodiment, the detection in step 4) employs at least one method selected from the group consisting of: TaqMan-PCR detection, Methylation specific PCR MSP, sequencing after sulfite treatment BSP, pyrosequencing, high resolution melting curve analysis HRM, mass spectrometry-fluorescence resonance energy transfer MS-FRET, Methylation specific enzyme restriction enzyme, nucleic acid mass spectrometry MassArray, Sanger sequencing, sequencing by second generation gene NGS, amplified fragment length polymorphism analysis AFLP, restriction fragment length polymorphism analysis RFLP, LUMA (Luminometric Methylation Assay), ELISA, Long Interspersed repeat (Long Interspersed Nuclear Elements) and Cold-PCR. Preferably, the detection in step 4) adopts a TaqMan-PCR detection method. Preferably, the detection in the step 4) adopts a MS-HRM detection method. More preferably, the detection in step 4) is performed by a locked nucleic acid-MS-HRM detection method, wherein the amplification primers used in step 3) are locked nucleic acid modified primers.

In one embodiment, step 3) and step 4) are performed simultaneously or sequentially.

In a fifth aspect of the present invention, there is provided a kit for detecting the DNA methylation marker of the first aspect of the present invention, which comprises a sample DNA extraction reagent, a DNA methylation modification conversion reagent, and a PCR amplification reagent for the DNA methylation marker of the first aspect of the present invention.

In a specific embodiment, the PCR amplification reagents comprise a primer pair according to the second aspect of the invention, and optionally a probe according to the third aspect of the invention. In one embodiment, the kit further comprises a fluorescent quantitative PCR reagent.

In a sixth aspect of the present invention, there is provided a method for the diagnosis, screening and risk prediction of early colorectal cancer and adenoma, comprising the steps of:

a) detecting methylation of a DNA methylation marker according to the first aspect of the invention in a sample;

and b) correlating the methylation profile detected in step a) with the diagnosis, screening and risk prediction of early colorectal cancer and adenoma.

In a specific embodiment, the methylation status of said DNA methylation marker in the sample in step a) is detected using the method according to the fourth aspect of the invention.

In a seventh aspect of the invention, there is provided a use of the DNA methylation marker of the first aspect of the invention in the preparation of a kit for diagnosis, screening and risk prediction of early colorectal cancer and adenoma.

In one embodiment, the use of the seventh aspect, the diagnosis, screening and risk prediction of early colorectal cancer and adenoma comprises the steps of:

a) detecting methylation of the DNA methylation marker of the first aspect in the sample; and

b) correlating the detected methylation status of step a) with the diagnosis, screening and risk prediction of early colorectal cancer and adenoma.

In an eighth aspect of the invention, there is provided a use of the reagent for detecting the DNA methylation marker of the first aspect of the invention in the preparation of a kit for diagnosis, screening and risk prediction of early colorectal cancer and adenoma.

In a specific embodiment, the reagent is selected from the group consisting of a primer pair according to the second aspect of the invention, a probe according to the third aspect of the invention, and a combination thereof.

In a specific embodiment, the diagnosis, screening and risk prediction of early colorectal cancer and adenoma comprises early diagnosis, screening and risk prediction of colorectal cancer stage I, colorectal cancer stage II and/or colon cancer-associated adenoma, and distinguishing colon cancer-associated adenoma from polyps, benign lesions.

Drawings

FIG. 1 shows the positive rate of the DNA methylation marker in the NDRG4 gene according to the method of example 1.

FIG. 2 shows the specificity of the test probe NDRG4-1 using the specific reference plasmid T1-T7.

FIG. 3 shows a ROC curve plotted from the results of detection of DNA methylation markers in the NDRG4 gene according to the method of example 1.

FIG. 4 shows the melting curve of DNA methylation markers in NDRG4 gene according to the method of example 2.

FIG. 5 shows the melting curve of a pathological tissue sample of patient No.1 in which DNA methylation markers in NDRG4 gene were detected by the method of example 2.

FIG. 6 shows the melting curve of the DNA methylation marker of NDRG4 gene detected from the pathological tissue sample of patient No. 2 by the method of example 2.

FIG. 7 shows the melting curve of NDRG4 gene DNA methylation marker in pathological tissue samples of patient No. 4, which was examined by the method of example 2.

FIG. 8 shows the melting curve of NDRG4 gene DNA methylation marker in pathological tissue samples of patient No. 18, which was examined by the method of example 2.

FIG. 9 shows melting curves of 5 reference samples for detecting DNA methylation markers in the NDRG4 gene by the method of example 2, wherein each reference sample consists of completely methylated DNA, HCT116DNA, and unmethylated DNA, gDNA, in different ratios.

Detailed Description

The disclosure may be understood more readily by reference to the following detailed description of preferred embodiments of the application and the examples included therein.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. In case of conflict, the present specification, including definitions, will control.

The term "prepared from …" as used herein is synonymous with "comprising". The terms "comprises," "comprising," "includes," "including," "has," "having," "contains," "containing," or any other variation thereof, as used herein, are intended to cover a non-exclusive inclusion.

The conjunction "consisting of …" excludes any unspecified elements, steps or components. If used in a claim, the phrase is intended to claim as closed, meaning that it does not contain materials other than those described, except for the conventional impurities associated therewith. When the phrase "consisting of …" appears in a clause of the subject matter of the claims rather than immediately after the subject matter, it defines only the elements described in the clause; other elements are not excluded from the claims as a whole.

When an amount, concentration, or other value or parameter is expressed as a range, preferred range, or as a range of upper preferable values and lower preferable values, this is to be understood as specifically disclosing all ranges formed from any pair of any upper range limit or preferred value and any lower range limit or preferred value, regardless of whether ranges are separately disclosed. For example, when a range of "1 to 5" is disclosed, the described range should be interpreted to include the ranges "1 to 4," "1 to 3," "1-2 and 4-5," "1-3 and 5," and the like. When a range of values is described herein, unless otherwise stated, the range is intended to include the endpoints thereof and all integers and fractions within the range.

In order to realize the diagnosis, screening and risk prediction of early colorectal cancer and adenoma, the inventor finds that the methylation site in the NDRG4 gene is closely related to early colorectal cancer and adenocarcinoma through a large number of experiments. Specifically, the inventors found a group of DNA methylation CpG sites in the NDRG4 gene, and designed a primer pair, a probe and a detection method aiming at the group of CpG sites. Furthermore, clinical sample examination finds that the sensitivity of the method for detecting adenoma is up to more than 65% and the sensitivity of the method for detecting early colorectal cancer is up to more than 75% while specificity is ensured. Therefore, the DNA methylation site in the NDRG4 gene can be used as a DNA methylation marker for diagnosis, screening and risk prediction of early colorectal cancer and adenocarcinoma.

Methylation markers

The invention provides a DNA methylation marker for diagnosing, screening and predicting risk of early colorectal cancer and adenoma, wherein the marker is the CpG sites in NDRG4 gene at the 38 th position and the 38 th position in the sequence shown in SEQ ID NO.1At least 2 of positions 47, 50 and 52 are simultaneously methylated, wherein the sequence numbering is based on the sequence shown in SEQ ID NO. 1: AAGCGGCAGGAGCAGCTCACAGCCAGGAGCGCTCTCCCGCCCCCAACGCCGCGCTCCCCCCTCCAAAACGGTTTAAAAAAATCCACCAATTGCATGGCC (SEQ ID No.: 1). Specifically, the marker is that CpG sites in the NDRG4 gene are methylated at the following sites in the sequence shown in SEQ ID NO.1 at the same time:

(1) position 38 and position 47; or

(2) 38 th and 50 th bits; or

(3) 38 th and 52 th bits; or

(4) 47 th and 50 th bits; or

(5) 47 th and 52 th bits; or

(6) 50 th and 52 th bits; or

(7) 38 th, 47 th and 50 th bits; or

(8) 38 th, 47 th and 52 th bits; or

(9) 47 th, 50 th and 52 th bits; or

(10) 38 th, 47 th, 50 th and 52 th bits.

(1) position 38 and position 47; or

(2) 38 th and 50 th bits; or

(3) 47 th and 50 th bits; or

(4) 38 th, 47 th and 50 th bits.

The "NDRG 4 gene" in this application is a member of the N-myc gene down-regulated gene family belonging to the alpha/beta hydrolase family. Located on chromosome 16 NC-000016.10

(58463704-. In the invention, sequences between 4445-6444 th sites of the NDRG4 gene (NG-041803.1) are selected, and particularly three sequences of 4782-4911 th site, 5065-5200 th site and 5574-5672 th site are selected to search methylation sites related to early colorectal cancer and adenocarcinoma. The inventors found that a plurality of methylation sites in the sequences between positions 5574-5672 in the three sequences are associated with early colorectal cancer and adenocarcinoma when at least two of the 3 sites are methylated simultaneously.

"methylation" in this application refers to the catalytic transfer of a methyl group from an active methyl compound (e.g., S-adenosylmethionine) to another compound. Methylation is an important modification of proteins and nucleic acids, regulates the expression and shutdown of genes, and is closely related to many diseases such as cancer and aging. The most common methylation modifications are DNA methylation and histone methylation, and the present invention relates to DNA methylation of the NDRG4 gene. DNA methylation in vertebrates generally occurs at CpG sites (cytosine-phosphate-guanine sites, i.e. sites in the DNA sequence immediately following cytosine to guanine). The conversion of cytosine to 5-methylcytosine (5mC) is catalyzed by DNA Methyltransferase (DMT). Approximately 80% -90% of the CpG sites in a human gene have been methylated, but in certain regions, such as CpG islands rich in cytosine and guanine, are unmethylated. This is associated with promoters in 56% of mammalian genes, including all widely expressed genes. 1% -2% of the human genome is CpG-populations, and CpG methylation is inversely proportional to transcriptional activity. As used herein, "methylation", "DNA methylation", "nucleic acid methylation", "gene methylation", "DNA methylation in the NDRG4 gene", "DNA methylation in the NDRG4 gene" are used interchangeably and refer to methylation modification of CpG sites in the NDRG4 gene.

In a specific embodiment of the present invention, the sequence as set forth in SEQ ID NO.1 is located at position 5574-5672 of the NDRG4 gene (NG _ 041803.1).

In a specific embodiment of the invention, the sequence of SEQ ID No.1 is converted into the sequence of SEQ ID No. 2 under the action of a DNA methylation modification conversion reagentThe sequence is as follows: AAGCGGTAGGAGTAGTTTATAGTTAGGAGCGTTTTTTCGTTTTTAACGTCGCGTTTTTTTTTTTAAAACGGTTTAAAAAAATTTATTAATTGTATGGTC (SEQ ID No.:2), wherein the underlined bases are the exact sites of DNA methylation markers in the NDRG4 gene. Unexpectedly, the inventors found that a combination of at least two of the 4 adjacent CpG sites (positions 38, 47, 50 and 52) has a methylation marker significance and can be used for diagnosis, screening and risk prediction of early colorectal and adenomas.

In the present application, "Colorectal Cancer (Colorectal Cancer)" is a common malignant tumor in the gastrointestinal tract, and has an insignificant early stage symptom, and with the increase of Cancer, it shows symptoms such as a change in defecation habit, hematochezia, diarrhea, alternating diarrhea and constipation, local abdominal pain, and a systemic symptom such as anemia and weight loss in the late stage. The incidence and fatality rate of the cancer are only second to those of gastric cancer, esophageal cancer and primary liver cancer in digestive system malignant tumors. Colorectal cancer grows slowly and has a long incubation period, 93 percent of colorectal cancers are from adenomas (a precancerous lesion), and the development of adenomas to carcinoma takes 5 to 7 years; american studies show that occult blood detection of stool annually can reduce colorectal cancer mortality by 33%. Although colorectal cancer can be prevented and cured, the colorectal cancer is developed to the middle and late stage when more than 80% of patients are diagnosed in China actually, and the early diagnosis rate is only 10-15%; domestic investigation shows that the postoperative survival rate of early colorectal cancer is over 90-95%, while the survival rate of late colorectal cancer is only 5%.

As for the stage of colorectal cancer. The purpose of tumor staging is to provide a prognostic situation and to guide the determination of a treatment regimen by examining the extent of a defined tumor. Colon Cancer can be classified into stages 0, I, II, III, IV according to the TNM (Tumor of Tumor Node, Metastasis) criteria of AJCC (American Joint Committee on Cancer). According to the infiltration depth of the primary tumor, the method is divided into T1: invade the mucosa and submucosa; t2: invasion of the muscle layer; t3: invading the serosa lower layer; t4: invasion of serosal layers or other organ tissues; according to lymph node metastasis, classification is N0: tumors were confined to the intestinal wall, with no regional lymph node metastasis; n1: 1-3 lymph node metastases; n2: more than 4 lymph node metastases; and distant metastasis cases, classified as: m0: no distant metastasis; m1: there is distant metastasis. Grade 0 colon cancer is carcinoma in situ, not exceeding the first layer of the colorectal wall; grade I colon cancer refers to a cancer that has progressed to the second or third layer of the colorectal wall, but the nearby lymph nodes or areas distant from the colorectal are free of cancer; grade II means that the cancer has grown into or beyond the fourth layer of the colorectal wall, and the nearby lymph nodes or areas distant from the colorectal are free of cancer; grade III refers to cancer that has spread from the colorectal to nearby lymph nodes or has tumor deposits (small tumors in the pericolorectal fat); stage IV refers to the cancer having spread to areas distant from the colorectal tract. As used herein, the terms "early stage colorectal cancer", "colorectal cancer (stage I + stage II)", "early stage colorectal cancer" are used interchangeably and refer to colorectal cancer that does not have cancerous lymph nodes and metastases distant from the colorectal region. For the early colorectal cancer, the treatment cost is relatively low, and the effect after recovery is good, so the screening of the early colorectal cancer has important clinical significance.

Primer pair

The invention provides a primer pair for amplifying the DNA methylation marker.

In one embodiment, the primer pair is used for amplifying the nucleotide segment shown in SEQ ID No. 1.

In one embodiment, the primer pair for ACTIN gene amplification as an internal reference gene is: an upstream primer ACTIN-F: 5'-TTTGTTTTTTTGATTAGGTGTTTAAGA-3' (SEQ ID No.: 5); and a downstream primer ACTIN-R: 5'-CACCAACCTCATAACCTTATC-3' (SEQ ID No.: 6).

Probe needle

The invention provides a probe targeting the DNA methylation marker.

In one embodiment, the probe has a sequence as shown in SEQ ID No. 7: 5 'FAM-AACGCGACGTTAAAAACGA-BHQ 3' (SEQ ID No.: 7).

In one embodiment, ACTIN gene targeting probes are also used: 5 'VIC-TAATACCTACACCCACAACAC-BHQ 3' (SEQ ID No.: 8).

Other suitable reference genes may be selected by those skilled in the art, and suitable primer pairs and probes may be designed and selected for known markers, sites and nucleic acid sequences according to the prior art.

Method for detecting DNA methylation marker

The invention provides a method for detecting the DNA methylation marker, which comprises the following steps:

1) extracting genomic DNA from a sample;

2) carrying out conversion treatment on the DNA obtained in the step 1) by using sulfite;

3) amplifying the transformation product obtained in the step 2) by using the primer pair to obtain an amplification product;

and 4) detecting the methylation condition of the DNA methylation marker in the amplification product obtained in the step 3).

Common methods for detecting DNA methylation include: methylation-specific PCR (MSP), sulfite sequencing (BSP), High Resolution Melting curve (HRM), and direct genome sequencing.

MSP method is to treat the genomic DNA with sulfite, all unmethylated cytosines are converted to uracil, while methylated cytosines are unchanged; designing primers for methylated and unmethylated sequences for PCR; detecting MSP amplification products through electrophoresis, and if primers aiming at the treated methylated DNA chain can obtain amplified fragments, indicating that the site is methylated; conversely, the absence of methylation at the detected site is indicated.

In the BSP method, genomic DNA is treated with sulfite, whereby unmethylated cytosine is converted to uracil, while methylated cytosine is not changed. Then BSP primer is designed to carry out PCR, all uracil is converted into thymine in the amplification process, and finally, the PCR product is sequenced to judge whether the CpG locus is methylated or not, so that the BSP-direct sequencing method is called. The PCR product is cloned to a vector and then sequenced, so that the sequencing success rate can be improved, and the method is called as a BSP-cloning sequencing method.

HRM method is to design a pair of primers for bisulfite modified double-stranded DNA at non-CpG island sites, and the middle segment of the pair of primers contains the CpG island of interest. If these CpG islands are methylated, the unmethylated cytosine is converted to thymine by PCR amplification after treatment with sulfite, but the methylated cytosine does not change, and the GC content in the sample changes, resulting in a change in melting temperature.

The direct genome sequencing method is a method for researching DNA methylation which has been used in the past, and is characterized in that genomic DNA is treated by a Maxam-Gilbert chemical lysis method, signal intensity is amplified by ligation-mediated PCR, and then sequence analysis is carried out. This method is based on the fact that 5mC is not cleaved in standard Maxam-Gilbert cytosine chemical cleavage reactions, so that 5mC can be identified by the absence of a band on the sequencing gel corresponding to the cytosine degradation reaction product. If MnO is used₄ ^-The piperidine method, and vice versa, provides complete complementary detection information when detecting 5 mC. After the method is combined with LM-PCR, the required amount of genome DNA (1-2ng) is greatly reduced. When 5mC and C are simultaneously at the same site on different DNA molecules, at least 25% of the site should be N-substituted with 5mC₂H₄Detecting by the method; MnO₄ ^-Falby N₂H₄The method is more sensitive. Because both of these chemical modifications of genomic DNA have the property of inhibiting DNA polymerase extension, methylation analysis can be performed by direct genomic sequencing without the need for piperidine cleavage of DNA.

In a particular embodiment of the invention, the sample is selected from: feces, blood, colorectal pathologies and combinations thereof; preferably faeces.

In one embodiment, the above method further comprises the step of preserving the sample prior to step 1). The step of preserving the sample comprises placing the sample in a sample preservation solution. The sample preservation solution at least comprises: sodium acetate 0.1M, sodium chloride 0.5M, EDTA50mM, SDS 1.4% and a proper amount of acetic acid, wherein the acetic acid is used for adjusting the pH of the sample preservation solution to 5.5.

In a specific embodiment, the DNA methylation marker has a sequence shown in SEQ ID No. 1. Under the action of the DNA methylation modification conversion reagent, the sequence of the DNA methylation marker is converted into a sequence shown as SEQ ID No. 2: AAGCGGTAGGAGTAGTTTATAGTTAGGAGCGTTTTTTCGTTTTTAACGTCGCGTTTTTTTTTTTAAAACGGTTTAAAAAAATTTATTAATTGTATGGTC (SEQ ID No.:2), wherein the underlined bases are the exact sites of the DNA methylation markers. The sequence obtained by amplification in the step 3) is shown as SEQ ID No. 2.

In a specific embodiment, the detection in step 4) employs at least one method selected from the group consisting of: TaqMan-PCR detection, Methylation specific PCR MSP, sequencing after sulfite treatment BSP, pyrosequencing, high resolution melting curve analysis HRM, mass spectrometry-fluorescence resonance energy transfer MS-FRET, Methylation specific enzyme restriction enzyme, nucleic acid mass spectrometry MassArray, Sanger sequencing, sequencing by second generation gene NGS, amplified fragment length polymorphism analysis AFLP, restriction fragment length polymorphism analysis RFLP, LUMA (Luminometric Methylation Assay), ELISA, Long Interspersed repeat (Long Interspersed Nuclear Elements) and Cold-PCR. Preferably, the detection in step 4) adopts a TaqMan-PCR detection method.

In addition to the MS-HRM method, the present invention may also employ a locked nucleic acid-MS-HRM detection method. Locked nucleic acid is an oligonucleotide derivative, and is different from common oligonucleotide molecules in that the structure of the locked nucleic acid contains one or more 2 '-O, 4' -C-methylene-beta-D-ribofuranosyl nucleotide monomers, and the 2 '-O position and the 4' -C position of ribose are connected through a methylene bridge to form a ring. The invention adopts a locked nucleic acid-MS-HRM detection method, namely, at least one locked nucleic acid modification is added into a PCR amplification primer or a probe designed aiming at SEQ ID No.1, and the specific number can be one, two, three, four, five or six. The primer or the probe site is introduced with locked nucleic acid modification, so that on one hand, the TM value of an upstream primer (with higher A/T content and repetition) is increased, and the problem that the TM values of double-ended primers designed according to PCR in the past are not matched is solved; on the other hand, the specificity and the amplification efficiency of the upstream primer or the downstream primer or the probe can be improved simultaneously. Except for the addition of locked nucleic acid, other procedures for detection of locked nucleic acid-MS-HRM were the same as those for MS-HRM. By adjusting the site and number of locked nucleic acid modifications in the amplification primers or probes, even very low abundance methylation exhibits a distinct peak signal. Confirming that the site does have the capability of identifying the characteristics of partial intestinal cancer.

Those skilled in the art can select other suitable detection methods and can design and select suitable detection reagents for the methylation markers in the NDRG4 gene provided by the present invention according to the prior art.

Reagent kit

The invention also provides a kit for detecting the DNA methylation marker, which comprises a sample DNA extraction reagent, a DNA methylation modification conversion reagent and a PCR amplification reagent of the DNA methylation marker.

In one embodiment, the PCR amplification reagents comprise the primer pairs described above, and optionally, the probes described above. In one embodiment, the kit further comprises a fluorescent quantitative PCR reagent.

The invention provides a method for diagnosing, screening and predicting risks of early colorectal cancer and adenoma, which comprises the following steps:

a) detecting the methylation condition of the DNA methylation marker in the sample;

In one embodiment, the methylation of said marker in the sample of step a) is detected using the method described above.

Use of

The invention provides application of the DNA methylation marker in preparing a kit for diagnosing, screening and predicting risks of early colorectal cancer and adenoma.

In a specific embodiment, the diagnosis, screening and risk prediction of early colorectal cancer and adenoma comprises the steps of:

The invention also provides application of the reagent for detecting the DNA methylation marker in preparing a kit for diagnosing, screening and predicting risks of early colorectal cancer and adenoma.

In one embodiment, the reagent is selected from the group consisting of the primer pair, the probe, and a combination thereof.

Under the long-term action of different carcinogenic factors, normal cells of the body show an increase in number, but the cell morphology has not changed yet, and the change is pathologically called as 'simple hyperplasia'. At the same time as the number increases, the cell morphology also changes, called "dysplasia". If the development continues, the difference in cell morphology from the original tissue (also called "atopy") becomes more severe, but the cancer has not yet developed, and this stage belongs to the precursor stage of cancer, and is called "Precancerous Lesion". Although the proliferating cells then have a tendency to transform into cancer cells, not all premalignant lesions will progress to cancer. Most precancerous lesions stay at this stage and are in a long-term stable state, and a part of precancerous lesions are recovered after self-healing or treatment, and only a small part of precancerous lesions continue to develop and finally become cancer. Precancerous lesions refer to certain lesions that continue to develop with the potential for carcinogenesis, such as: leukoplakia of mucous membrane, boundary nevus, chronic atrophic gastritis, cervical erosion, multiple gonadal tumor polyp of colon and rectum, some benign tumors, etc.

The polyps can be classified into two types, non-adenomatous polyps and adenomatous polyps. Non-adenomatous polyps are mainly inflammatory or hyperplastic polyps, almost all benign, rarely become cancerous. Adenomatous polyps are polyps with a high incidence of canceration. Data indicate that 95% of intestinal cancers are due to adenomatous polyps. Adenomatous polyps (Adenomatous polyps) have a greater potential for canceration, but do not necessarily mean that canceration will occur. Generally, the progress from adenomatous polyps to intestinal cancer takes 5-15 years and is influenced by many factors. Herein, "precancerous lesion", "adenoma associated with colorectal cancer", "adenomatous polyp" and "polypoid adenoma" are used interchangeably and refer to adenoma of the colorectal mucosa, which is mostly polypoid, and may be single-or multiple-onset with or without pedicles. As used herein, "polyp," "hyperplastic polyp," "non-adenomatous polyp," and "colorectal polyp" are interchangeable and refer to neoplasms of the colorectal mucosal surface that do not exhibit a significant propensity for malignancy.

Currently, the most common way for screening early colorectal cancer is Fecal Occult Blood Test (FOBT), in which the upper gastrointestinal hemorrhage (stomach, duodenum, etc.) is reliably detected by a chemical method, and the detection of Fecal Occult Blood by an Immunochemical method (FIT) is mainly suitable for the detection of lower gastrointestinal (small intestine, large intestine) hemorrhage. On the premise of early screening of an adenoma sample, over 90% of specificity is guaranteed, and the sensitivity of intestinal adenoma screening by a fecal occult blood test is 24%. In one embodiment of the invention, the sensitivity of the method for detecting the intestinal adenoma is as high as 65%, which is far higher than the result of the fecal occult blood test, and the method is also more advantageous for screening early intestinal cancer.

Another more common screening modality is single-target detection of methylated Septin9 using blood samples, and detection based on the CPG island hypermethylation principle of the SEPT9-v2 promoter region in colorectal cancer. However, the sensitivity of Septin9 in intestinal adenomas is poorly reported, and in early bowel cancer is between 50-60%. In one embodiment of the invention, the sensitivity of early intestinal cancer can reach 75%, and the sensitivity of screening intestinal adenoma and early intestinal cancer (clinical stages I and II) is higher on the premise of ensuring more than 90% of specificity.

There is also currently a combinatorial target detection using next generation sequencing methods. The advantages of the combined target detection using blood samples are extremely high in specificity, but the actual sensitivity in screening early intestinal cancer is only 30-50% of intestinal cancer stage I and 65-70% of intestinal cancer stage II (CGGA data of Grail), and no intestinal adenoma is reported. And the cost of the competitive method is up to $ 2000 or more (whereas the detection cost in one embodiment of the invention is less than 100 dollars), the data analysis method is extremely complex and difficult to be practically used for screening.

Compared with the prior art, the novel DNA methylation marker in the NDRG4 gene provided by the invention is used for diagnosis, screening and risk prediction of early colorectal cancer and adenoma, and shows higher sensitivity and specificity.

Compared with the prior art, the invention has the following advantages:

1. the invention provides a novel DNA methylation marker in NDRG4 gene, and establishes a method for detecting early colorectal cancer aiming at the marker, and the application of the method is combined with TaqMan-PCR technology, and only one pair of primers and probes can be used, so that the adenoma and early colorectal cancer can be detected with high specificity and high sensitivity.

2. The method adopts a detection mode of a single gene and a single primer pair, the targeted nucleic acid fragment is not more than 200bp, the technology is simple, the operation is easy, the detection cost is greatly reduced, and the popularization and the application are easy.

3. The method has high specificity and high sensitivity for colorectal cancer, has more excellent effect of detecting adenomas related to colorectal cancer, and can distinguish adenomas and polyps, so the method has outstanding advantages in early diagnosis and screening of colorectal cancer compared with the prior art.

4. The source of the detection sample used in the method can be a fecal sample, and a reagent for preserving the fecal sample for a long time is provided in a matching way, so that the method is suitable for different environments and backgrounds encountered in actual operation.

5. The method can also be combined with various detection methods, can be freely combined in actual detection, and can also be combined with other clinical detection indexes for analysis.

6. The method has relatively fewer targets, and theoretically, the stability of the method after the sample amount is enlarged is higher than that of other multi-target detection, so that the method is clearer and more representative as a detection index.

Examples

The following detailed description of the preferred embodiments of the present application, taken in conjunction with the accompanying drawings, is intended to be illustrative, and not restrictive, and it is intended that all such modifications and equivalents fall within the scope of the present application.

Example 1TaqMan-PCR method for detecting methylation sites in fecal samples

1.1 extraction and transformation of DNA samples

Human NDRG4 and ACTIN gene fragments were extracted from fecal samples using magnetic beads linked to specific probes, eliminating interference from microorganisms and other human DNA. Wherein, NDRG4 is used as a detection target point, and ACTIN is used as an internal reference.

The sample used in this example is feces, and the sampling is convenient. The prepared sample preserving fluid is used for preserving the fecal sample, the sample can be preserved for 7 days at normal temperature, and the difficulty of sample transportation is reduced. Wherein, the sequence of the specific probe linked on the magnetic bead is as follows:

the formula of the sample preservation solution comprises:

component (A)	Sodium acetate	Sodium chloride	EDTA	SDS
					Concentration of	0.1M	0.5M	50mM	1.4％

The pH was adjusted to 5.5 with acetic acid.

The specific operation of nucleic acid extraction is as follows:

(1) the sample is balanced by an electronic balance, and the weight difference between the sample and the balancing pipe is within plus or minus 0.01 g;

(2) centrifuging: centrifuging at 10000g for 10 min;

(3) and (3) filtering: the supernatant was filtered through a filter screen into a new 50mL centrifuge tube for use.

(4) Taking a 15mL centrifuge tube, adding 5mL of adsorbent into each tube, centrifuging for 10min at 5000g, and then removing the upper layer liquid by using a vacuum pump.

(5) 5mL of sample is added into a 15mL centrifuge tube, vortex and mix evenly, and then centrifuge for 10min at 5000 g.

(6) The supernatant was transferred to a new 15mL centrifuge tube and 1mL detergent and 100. mu.L proteinase K were added to the tube, vortexed for 30s and incubated at 70 ℃ for 15 min.

(7) After the incubation was completed, the centrifuge tube was wiped clean of water and 2mL of 1-bromo-3-chloropropane was added to the tube. Vortex, mix evenly, centrifuge for 10min at 5000 g.

(8) The supernatant was transferred to a new 15mL centrifuge tube and 4mL isopropanol and 80. mu.L magnetic beads were added to the tube (the beads were shaken well before use). Vortex and mix for 30s, and then place on a rotary mixer to mix for 5 min.

(9) And (3) placing the sample tube on a magnetic frame, standing for 2min, and sucking waste liquid by using a vacuum pump after the magnetic beads are adsorbed to the tube wall.

(10) The centrifuge tube was transferred to a tube holder, 5mL of washing solution 1 was added thereto, and the mixture was vortexed for 30 seconds to disperse the magnetic beads as much as possible. Placing the centrifuge tube on a magnetic frame for 2min, and sucking waste liquid by a vacuum pump after the magnetic beads are adsorbed to the tube wall.

(11) And (5) repeating the step (10).

(12) Add 5mL of Wash 2 to the centrifuge tube and vortex for 30 s. Placing the centrifuge tube on a magnetic frame for 2min, and sucking waste liquid by a vacuum pump after the magnetic beads are adsorbed to the tube wall.

(13) The centrifuge tube was transferred to a tube holder, 1mL of washing solution 3 was added thereto, and the beads were dispersed by repeatedly blowing the beads with a pipette, and then all the liquid was transferred to a 1.5mL centrifuge tube. Placing the centrifuge tube on a magnetic frame for 2min, and after the magnetic beads are completely adsorbed, using a vacuum pump to suck waste liquid. The waste liquid is removed to the greatest extent, and the step has great influence on the purity of nucleic acid.

(14) The centrifuge tube and the magnetic rack are transferred to a biological safety cabinet, opened and dried for 10 min.

(15) And (3) elution: adding 80 μ L of eluent into the centrifuge tube, mixing uniformly by vortex, and incubating at 1300rpm of constant temperature metal bath and 65 ℃ for 5 min. After incubation was complete, the sample tube was centrifuged at 13500rpm for 30s and the liquid was collected low. The centrifuge tube was transferred to a magnetic rack and allowed to stand for 5min, the DNA solution was transferred to a new 1.5mL centrifuge tube, and the sample was stored at-20 ℃.

Then, the extracted DNA is transformed by sulfite, and the specific steps are as follows:

(1) to the CT transformation reagent, 900. mu.L of water, 300. mu. L M-dilution buffer and 50. mu.L of lysis buffer were added to prepare a working solution.

(2) The extracted genomic DNA was taken out from the refrigerator and thawed. A200. mu.L PCR tube was used and mixed at a ratio of 20. mu.L DNA plus 130. mu.L CT transformation reagent. The mixed sample was run through the following procedure:

98℃	10 minutes
		64℃	2.5 hours
4℃	The preservation time is within 20 hours

(3) The adsorbed material is placed into a collection tube. Adding 600 mu L M-binding buffer solution into the adsorption medium, transferring all the reaction solution in the step (2) into an adsorption column, reversing the reaction solution from top to bottom for 10 times, and centrifuging 18000g for 30s after uniform mixing;

(4) discarding the waste liquid, adding 100 mu L M-washing buffer solution into the adsorption column, mixing uniformly, and centrifuging for 30s at 18000 g;

(5) discarding the waste liquid, adding 200 mu L M-desulfonation buffer solution into the adsorption column, standing vertically, incubating at room temperature for 20min, and centrifuging at 18000g for 30 s;

(6) discarding the waste liquid, adding 200 mu L M-washing buffer solution into the adsorption column, centrifuging for 30s at 18000g, and discarding the waste liquid;

(7) repeating the step (6);

(8) transferring the adsorbed DNA to a 1.5mL centrifuge tube, adding 50 μ L of elution buffer solution into the adsorption column, and centrifuging for 30s at 18000g to obtain the converted DNA in the centrifuge tube.

Thus, a sulfite-converted DNA sample was obtained.

1.2 TaqMan-PCR method for detecting methylation sites

Designing a specific amplification primer after colorectal cancer gene transformation, wherein the DNA fragment amplified by the primer is not more than 200 bp. In this example, 1 pair of primers between 4445 th and 6444 th of NDRG4(NG _041803.1) were designed, and corresponding probes were designed according to the methylation sites, and the specific primer and probe information were as follows:

the upstream and downstream primers of each pair of primers are mixed in equimolar amounts to obtain a corresponding amplification primer mixture, the final working concentration of each pair of amplification primer mixture being 5. mu.M. The working solution concentration of the probe was 5. mu.M.

Using the sulfite-converted DNA sample obtained in example 1 as a template, PCR amplification reactions were carried out using the above-mentioned amplification primers and probes, respectively. The specific operation steps are as follows:

preparing a detection reaction system, wherein the PCR reaction system comprises the following components:

KAPA PROBE FORCR Universal(KM4301)	10μL
		primer pair	0.1～1.0μmol
Probe needle	0.1～1.0μmol
		Sample DNA template	8.8μL
Ultrapure water to make up the total volume	20μL

The real-time fluorescent PCR amplification reaction conditions are preferably as follows:

the first stage is as follows: 3min at 98 ℃;

and a second stage: 10s at 95 ℃, 30s at 58 ℃ and 50 cycles;

fluorescent signals were collected for each cycle.

1.3 specificity verification of Probe NDRG4-1

To demonstrate the specificity of the probe NDRG4-1 used in this example for detecting the methylation site of NDRG4, a validation experiment using the probe NDRG4-1 for detecting a specific reference was also designed.

Sequence after treatment with sulfite SEQ ID No.:2, designing a reference substance for the template T0, wherein the reference substance T1 is a plasmid simulating methylation of one site; references T2 to T4 are plasmids that mimic methylation at two of the four sites; references T5 to T7 are plasmids that mimic methylation at three of the four sites. Specifically, the sequence information of the reference plasmids used in this example is shown in the following table.

The plasmid T1-T7 was diluted to concentrations of both 10ng/ul and 0.01ng/ul as sulfite-transformed DNA samples, which were then subjected to the procedure described in 1.2The TaqMan-PCR method detects methylation sites.

As a result: the results of comparing the results of using the primers and probes with those of clinical samples were in good match, and the results of detecting methylation of NDRG4 using the primer pair NDRG 41F + NDRG 41R and probe NDRG4-1 were found to be consistent with the pathological typing of clinical samples. The specific details are as follows:

the samples of this example were 176 clinical samples, randomly divided into validation set and test set. Independent double-blind experiments were performed on both the validation set and the test set samples, wherein the test set was positive with a predictive value > 0.5 and negative with a predictive value < 0.5, 1/(1+ EXP- (2.58357-0.05622 NDRG4-actin)), and the specific data of the test set are shown in the following table:

the specific data for the validation set are shown in the following table:

the statistical results of the clinical samples detected by the TaqMan-PCR detection method are shown in FIG. 1.

The detection method of the DNA methylation marker of the NDRG4 gene provided by the invention is used for detecting adenoma, the result is shown in a verification set, 30 cases of detection are carried out, wherein 20 cases of detection results are positive, and the detection positive rate is 66%; in the test set, 22 cases are detected, wherein 14 cases are positive in detection result, and the detection positive rate is 64%; therefore, in the training and testing set, 52 adenoma samples are detected in total, wherein 34 of the adenoma samples are positive, and the positive rate of the detection evaluation is 64%, which is far higher than the current conventional report by 20%.

The detection method of the DNA methylation marker of the NDRG4 gene provided by the invention is used for detecting intestinal cancer (stage I + stage II), the result is shown in a test set, and 0 case is detected, and no false positive result appears; in the verification set, 24 cases are detected, wherein 18 cases have positive detection results, the positive rate of detection is 75%, and the positive rate is higher than that of the conventional report at present.

The method for detecting the DNA methylation marker in the NDRG4 gene provided by the invention is used for detecting hyperplastic polyps, the result is shown in a verification set, and 27 cases are detected, wherein 4 cases are detected to be positive, and the detection positive rate is 14.8%; in the test set, 25 cases are detected, wherein 1 case is positive in detection result, and the detection positive rate is 4%; therefore, in the test and verification set, 52 adenoma samples are detected in total, 5 of the adenoma samples are positive, the positive rate of the test evaluation is 9.6%, and the differentiation of adenoma and polyp is very large.

According to the detection method of the DNA methylation marker in the NDRG4 gene, benign lesions are detected, the result is shown in a verification set, 22 cases of detection are carried out, wherein 2 detection results are positive, and the detection positive rate is 9%; in the test set, 25 cases are detected, wherein 2 cases have positive detection results, and the positive detection rate is 8%; therefore, in the test and verification set, 47 adenoma samples are detected together, 4 of the adenoma samples are positive, the positive rate of the detection evaluation is 8.5%, and the result is lower than the detection result of hyperplastic polyp and is far lower than the positive rate of intestinal cancer (stage I + stage II) and adenoma.

In addition, in this example, 1 familial intestinal cancer sample was also examined, and it was unexpectedly found that the familial intestinal cancer sample also showed positive.

The results of the probe specificity verification experiments show that, as shown in fig. 2, in both cases of high and low concentration of template: in the plasmid with the simulated methylation modification of any more than 2 sites of the 38 th site, the 47 th site, the 50 th site and the 52 th site, a fluorescence signal is collected through a PCR amplification reaction, and in the plasmid with the simulated methylation modification of which none or only one of the four methylation sites is methylated, no fluorescence signal is obtained through the PCR amplification reaction. The pair of probes NDRG4-1 was shown to detect SEQ ID No.:1, and the probe NDRG4-1 can detect the four methylation sites of SEQ ID No.: at least 2 of positions 38, 47, 50 and 52 of 1. Meanwhile, the results of clinical tests using the pair of primers and the probe show that the probe has high specificity in the diagnosis and screening of early colorectal cancer and adenoma. The methylation marker provided by the invention is SEQ ID No.: at least 2 sites of the 38 th site, the 47 th site, the 50 th site and the 52 th site in the gene 1 are methylated, and the methylation has high specificity in the diagnosis and screening for detecting early colorectal cancer and adenoma. Therefore, the methylation marker provided by the invention can be used for diagnosis, screening and risk prediction of early colorectal cancer and adenoma.

In order to analyze and compare the discrimination of the present invention against different pathological phenotypes, the above data were used to further plot a receiver operating characteristic curve ROC, the results of which are shown in FIG. 3. The results show that ROC curve analysis indicates that the AUC value is 0.844, which indicates that the classification method is feasible and the detection result has higher conformity of clinical disease classification.

Example 2 detection of methylation sites in tissue samples by MS-HRM method

Another method for detecting methylation sites in a sample is provided in this example, methylation-sensitive High Resolution Melting analysis (MS-High Resolution measuring Current analysis). The MS-HRM method is a simple and sensitive method for detecting the methylation level of a gene without the subsequent operation of a PCR product. The method is mainly realized by comparing the melting temperature and the peak shape of the curve, and can detect the occurrence of single methylation in a series of CpG sites, and simultaneously analyze the methylation level of the series of CpG sites. Methylation of individual CpG sites and the average level of methylation can have an effect on the shape of the melting curve. Before PCR reaction, primers are designed at sites of non-CpG islands, so that a meaningful methylated CpG island is contained in the pair of primers, once the CpG islands are methylated, cytosine (C) is not changed, and GC content in a sample is changed from unmethylated cytosine (C) to thymine (T), and finally the GC content is converted into the difference between Tm values of a melting curve. Since the relative position of CpG sites within a small amplified fragment also affects the shape of the melting peak, the methylation site and the degree of methylation in a sample can be detected from the Tm value and the shape of the melting peak.

2.1 extraction and transformation of DNA samples

DNA was extracted from tissue samples using the TIANAmp Genomic DNA Kit (Tiangen, Beijing) and the procedure was performed according to the product instructions.

(7) repeating the step (6);

Thus, a sulfite-converted DNA sample was obtained.

2.2 MS-HRM method for detecting methylation sites

PCR amplification reactions were carried out using the positive DNA samples obtained after bisulfite conversion as templates and the amplification primer pairs NDRG 41F and NDRG 41R as described in example 1. The specific operation steps are as follows:

KAPA 2X Master Mix	12.5U
		amplification primer pair (final concentration 200nM)	2U
Syto
	9 dyes	0.5U
Reference material			1U
	Water (W)	9U

The PCR amplification reaction conditions are preferably:

as a result: melting curves of NDRG4 gene DNA methylation markers from samples of cancer tissues and tissues adjacent to the cancer of clinical patients by MS-HRM method are shown in FIGS. 4-8. The general status of the melting curves of NDRG4 gene DNA methylation markers in samples of cancer tissues and tissues adjacent to the cancer in 20 clinical patients tested by the MS-HRM method is shown in FIG. 4. The content of nucleic acid and the melting temperature Tm value of the melting curve of each sample in the MS-HRM detection method are shown in table 1 below.

TABLE 1

Analyzing the methylation of the site in each sample according to the Tm value of the sample: samples derived from para-cancerous tissue are generally considered to be colorectal cancer negative samples, while samples derived from cancerous tissue are colorectal cancer positive samples. For samples derived from tissues adjacent to cancer, the distribution of Tm values (representing unmethylated amplification products) is relatively single, and the distribution is mainly in the interval from 70.62 to 70.7 (Tm1 value). For samples derived from cancerous tissue, the Tm values (including methylated amplification products), which may be Tm1 and Tm2, are slightly larger than the Tm1 value of the corresponding paracancerous tissue; when the difference is 0.1 or more, it represents that the cancer tissue contains a methylation product of the NDRG4 site.

Specifically, as shown in fig. 5, the melting curve of the pathological tissue sample of patient No.1 showed that sample No.1 (cancer tissue) had a sample melting curve that was suspected to be positive compared to sample No. 2 (paracarcinoma tissue), but the peak of methylation of cancer tissue No.1 was not evident, and therefore sample No.1 was judged to be negative. As shown in fig. 6, the melting curve of the pathological tissue sample of patient No. 2 showed that the sample No. 3 (cancer tissue) had a positive sample melting curve compared to the sample No. 4 (paracarcinoma tissue), and the sample No. 3 was judged to be positive because the peak ratio of methylation of cancer tissue No. 3 was low but could be identified, and the pathological tissue sample of patient No. 2 was judged to be a typical low-ratio methylated sample. As shown in fig. 7, the melting curve of the pathological tissue sample of patient No. 4 showed that the sample No. 7 (cancer tissue) had a positive sample melting curve compared to the sample No. 8 (paracarcinoma tissue), and the methylation peak of the cancer tissue No. 7 could be clearly identified, so that the sample No. 7 was judged to be positive, and the pathological tissue sample of patient No. 4 was a typical sample with high methylation ratio. As shown in fig. 8, the melting curve of the pathological tissue sample of patient No. 18 shows that the melting curves of the sample No. 35 (cancer tissue) are substantially coincident and have no methylation peak, compared with the sample No. 36 (paracarcinoma tissue), and therefore, the sample No. 35 is judged to be negative, and the pathological tissue sample of patient No. 18 is typically a negative sample.

The results of DNA methylation analysis of the sites of cancer tissues and paracancerous tissues (40 samples) of 20 patients detected by the MS-HRM method according to the above analysis method are shown in Table 2 below.

Table 2:

the results show that at least 13 of the 20 samples of the intestinal cancer patients can find positive signals of methylation in the MS-HRM analysis method of the new detection site of NDRG4, and the positive rate is 65%. Confirming that the site does have the capability of identifying the characteristics of partial intestinal cancer.

To further prove the validity of the above method, it also relates to the use of a reference to simulate the methylation detection of samples methylated at different ratios. Wherein each group of reference products respectively consists of completely methylated DNA-HCT 116DNA and unmethylated DNA-gDNA with different proportions, and the specific contents are as follows:

numbering	Configuration of
		1	0％HCT116+100％gDNA
2	1％HCT116+99％gDNA
		3	5％HCT116+95％gDNA
4	25％HCT116+75％gDNA
		5	100％HCT116+0％gDNA

FIG. 9 shows the melting curves of the 5 groups of reference products for detecting DNA methylation markers of NDRG genes by MS-HRM method. The Tm values in the melting curves do show distinct methylated and unmethylated peak positions, as described in the analytical methods above, and the peak heights are related to the corresponding DNA content, i.e. the higher the content of methylated DNA (here HCT116 DNA), the higher the peak height corresponding to methylation in the melting curves.

And (4) conclusion: the markers consisting of four methylation sites of the NDRG4 selected by the invention have high correlation with intestinal cancer and adenoma, and can be used as targets for early screening.

The novel methylation marker of the NDRG4 gene, the method for detecting early colorectal cancer by aiming at the marker, and the detection method combining the TaqMan-PCR method, the MS-HRM method and the like can realize the detection of adenoma and early colorectal cancer by using only one pair of primers and probes with high specificity and high sensitivity.

The foregoing examples are merely illustrative and serve to explain some of the features of the present disclosure. The appended claims are intended to claim as broad a scope as is contemplated, and the examples presented herein are merely illustrative of selected implementations in accordance with all possible combinations of examples. Accordingly, it is applicants' intention that the appended claims are not to be limited by the choice of examples illustrating features of the application. As used in the claims, the term "comprising" and its grammatical variants are also logically inclusive of different and varying phrases, such as, but not limited to, "consisting essentially of" or "consisting of. Where desired, numerical ranges are provided and sub-ranges therebetween are included. Variations in these ranges are also self-explanatory to those skilled in the art and should not be considered to be dedicated to the public, but rather should be construed to be covered by the appended claims where possible. And that advances in science and technology will result in possible equivalents or sub-substitutes not currently contemplated for reasons of inaccuracy in language representation, and such changes should also be construed where possible to be covered by the appended claims.

Claims

1. A DNA methylation marker for diagnosis, screening and risk prediction of early colorectal cancer and adenoma, said marker being a CpG site in the NDRG4 gene that is methylated at least 2 of positions 38, 47, 50 and 52 in the sequence shown in SEQ ID No. 1:

wherein the sequence numbering is based on the sequence shown in SEQ ID NO. 1:

AAGCGGCAGGAGCAGCTCACAGCCAGGAGCGCTCTCCCGCCCCCAACGCCGCGCTCCCCCCTCCAAAACGGTTTAAAAAAATCCACCAATTGCATGGCC(SEQ ID No.:1)。

2. a primer pair for amplifying the DNA methylation marker of claim 1.

3. The primer pair as set forth in claim 2, which is used for amplifying the nucleotide segment represented by SEQ ID No. 1.

4. The primer pair of claim 2, comprising:

the upstream primer NDRG4-F1:

5'-AAGCGGTAGGAGTAGTTTATAGTTAGGAG-3' (SEQ ID No.: 3); and/or

The downstream primer NDRG4-R1:

5’-GACCATACAATTAATAAATTTTTTTAAACC-3’(SEQ ID No.:4)。

5. a probe targeting the DNA methylation marker of claim 1.

6. The probe of claim 5, which has the sequence shown in SEQ ID No. 7:

AACGCGACGTTAAAAACGA(SEQ ID No.:7)。

7. a method of detecting the DNA methylation marker of claim 1, comprising the steps of:

1) extracting genomic DNA from a sample;

3) amplifying the transformation product obtained in step 2) by using the primer pair of claim 2 to obtain an amplification product; and

4) detecting the methylation of the DNA methylation marker of claim 1 in the amplification product obtained in step 3).

8. The method of claim 7, wherein the sample is selected from the group consisting of: stool, blood, colorectal pathology, and combinations thereof.

9. The method of claim 8, wherein the sample is stool.

10. The method of claim 7, further comprising the step of preserving the sample prior to step 1).

11. The method of claim 7, wherein the detecting in step 4) is performed by at least one method selected from the group consisting of: TaqMan-PCR detection, methylation specificity PCR MSP, sulfite treatment sequencing BSP, pyrosequencing, high resolution melting curve analysis HRM, mass spectrum-fluorescence resonance energy transfer MS-FRET, methylation specific enzyme restriction enzyme, nucleic acid mass spectrum analysis, Sanger sequencing, next generation gene sequencing NGS, amplified fragment length polymorphism analysis AFLP, restriction fragment length polymorphism analysis RFLP, LUMA method, enzyme-linked immunosorbent assay ELISA, interspersed repeat sequence method and Cold-PCR method.

12. The method of claim 7, wherein the detection in the step 4) adopts a TaqMan-PCR detection method.

13. The method as claimed in claim 7, wherein the detection in step 4) is performed by MS-HRM detection.

14. The method of claim 7, wherein the step 4) comprises detecting nucleic acid-locked MS-HRM.

15. The method of claim 7, wherein step 3) and step 4) are performed simultaneously or sequentially.

16. A kit for detecting the DNA methylation marker of claim 1, which comprises a sample DNA extraction reagent, a DNA methylation modification conversion reagent and a PCR amplification reagent of the DNA methylation marker of claim 1.

17. The kit of claim 16, wherein the PCR amplification reagents comprise the primer pair of claim 2, and optionally the probe of claim 5.

18. The kit of claim 16, further comprising fluorescent quantitative PCR reagents.

19. A method for diagnosis, screening and risk prediction of early colorectal cancer and adenoma comprising the steps of:

a) detecting methylation of the DNA methylation marker of claim 1 in a sample; and

20. The method of claim 19, wherein methylation of the marker in the sample in step a) is detected using the method of claim 7.

21. Use of the DNA methylation marker of claim 1 for the preparation of a kit for the diagnosis, screening and risk prediction of early colorectal and adenomas.

22. The use according to claim 21, wherein the diagnosis, screening and risk prediction of early colorectal cancer and adenoma comprises the steps of:

b) correlating the methylation detected in step a) with early colorectal and adenoma

Diagnosis, screening and risk prediction are associated.

23. Use of a reagent for detecting a DNA methylation marker as claimed in claim 1 for the preparation of a kit for the diagnosis, screening and risk prediction of early colorectal and adenomas.

24. The use of claim 23, wherein the agent is selected from the group consisting of the primer pair of claim 2, the probe of claim 5, and combinations thereof.

25. The use of claim 23, said diagnosis, screening and risk prediction of early colorectal cancer and adenoma comprising early diagnosis, screening and risk prediction of colorectal cancer stage I, colorectal cancer stage II and/or colon cancer-associated adenoma, and distinguishing colon cancer-associated adenoma from polyps, benign lesions.