CN115137739A

CN115137739A - RNA delivery system for treating lung cancer

Info

Publication number: CN115137739A
Application number: CN202210328724.3A
Authority: CN
Inventors: 张辰宇; 陈熹; 付正; 李菁; 张翔; 周心妍; 张丽; 余梦超; 郭宏源
Original assignee: Nanjing University
Current assignee: Nanjing University
Priority date: 2021-03-30
Filing date: 2022-03-30
Publication date: 2022-10-04
Also published as: WO2022206809A1

Abstract

The present application provides an RNA delivery system for treating lung cancer. The application provides an RNA delivery system for treating lung cancer, which comprises a viral vector, wherein the viral vector carries an RNA segment capable of treating lung cancer, the viral vector can be enriched in organ tissues of a host, and endogenously and spontaneously forms a composite structure containing the RNA in the organ tissues of the host, and the composite structure can deliver the RNA segment to the lung to realize the treatment of the lung cancer. The safety and reliability of the RNA delivery system for treating lung cancer are fully verified, and the RNA delivery system has the advantages of very good druggability, strong universality, very good economic benefit and excellent application prospect.

Description

RNA delivery system for treating lung cancer

Technical Field

The application relates to the technical field of biomedicine, in particular to an RNA delivery system for treating lung cancer.

Background

Lung cancer is one of the most rapidly growing malignancies that threaten human health and life. Lung cancer is currently treated mainly by the following means: 1. chemotherapy: chemotherapy is the main treatment method for lung cancer, more than 90% of lung cancer needs to be treated by chemotherapy, the curative effect of chemotherapy on small cell lung cancer is more certain no matter in early stage or late stage, and even about 1% of early stage small cell lung cancer is cured by chemotherapy. Chemotherapy, however, inhibits the bone marrow hematopoietic system, mainly the decline of leukocytes and platelets. 2. Radiotherapy: the radiation field for lung cancer radiotherapy comprises the primary focus and mediastinal area of lymph node metastasis, and is treated by medicine. However, the complications of radiotherapy are more, such as radiation pneumonitis, radiation esophagitis, radiation pulmonary fibrosis, radiation myelitis and the like. 3. Surgical treatment: it can completely remove primary focus and metastatic lymph node of lung cancer, and achieve clinical cure; or most of the tumor is removed, and favorable conditions are created for other treatments, namely tumor reduction surgery; however, surgical treatment is limited and cannot be applied on a large scale.

RNA interference (RNAi) therapy has been considered a promising strategy for the treatment of human diseases since its invention, but many problems have been encountered during clinical practice, and the progress of the therapy is far behind expectations.

It is generally considered that RNA cannot exist stably for a long period outside cells because RNA is degraded into fragments by RNase which is abundant outside cells, and therefore, a method for stably existing RNA outside cells and allowing targeted entry into a specific tissue must be found to highlight the effect of RNAi therapy.

Many patents related to siRNA are focused on the following aspects: 1. siRNA with medical effect is designed. 2. The siRNA is chemically modified, so that the stability of the siRNA in organisms is improved, and the yield is improved. 3. Various artificial carriers (such as lipid nanoparticles, cationic polymers and viruses) are designed to improve the efficiency of siRNA delivery in vivo. Among them, the patent of the 3 rd aspect is many, and the root cause thereof is that researchers have recognized that there is a lack of suitable siRNA delivery system for delivering siRNA to target tissues safely, accurately and efficiently, which has become a core problem that restricts RNAi therapy.

A virus (Biological virus) is a noncellular organism that is small in size, simple in structure, contains only one nucleic acid (DNA or RNA), and must be parasitic in living cells and proliferated in a replicative manner. Viral vectors can bring genetic material into cells, and the principle is that viruses have a molecular mechanism for transmitting their genomes into other cells for infection, can occur in whole living organisms (in vivo) or in cell culture (in vitro), and are mainly applied to basic research, gene therapy or vaccines. However, there are currently few studies related to the use of viruses as vectors for the delivery of RNA, in particular siRNA, using specific self-assembly mechanisms.

Chinese patent publication No. CN108624590A discloses an siRNA capable of inhibiting DDR2 gene expression; chinese patent with publication number CN108624591A discloses a siRNA capable of silencing ARPC4 gene, and the siRNA is modified by alpha-phosphorus-selenium; chinese patent with publication number CN108546702A discloses siRNA of targeting long-chain non-coding RNA DDX11-AS 1. Chinese patent publication No. CN106177990A discloses a siRNA precursor that can be used for various tumor treatments. These patents have designed specific sirnas and are directed to certain diseases caused by genetic changes.

Chinese patent publication No. CN108250267A discloses a polypeptide, polypeptide-siRNA induced co-assembly, using polypeptide as carrier of siRNA. Chinese patent publication No. CN108117585A discloses a polypeptide for promoting breast cancer cell apoptosis by targeted introduction of siRNA, and the polypeptide is also used as a carrier of siRNA. Chinese patent publication No. CN108096583A discloses a nanoparticle carrier, which contains chemotherapeutic drugs and also can be loaded with siRNA with breast cancer therapeutic effect. These patents are all inventions in the aspect of siRNA vector, but the technical scheme has a common feature that the vector and siRNA are pre-assembled in vitro and then introduced into the host. In fact, most of the current designs for delivery technology do so. However, such delivery systems have a common problem in that these artificially synthesized exogenous delivery systems are easily cleared by the host's circulatory system, may elicit an immunogenic response, and may even be toxic to specific cell types and tissues.

The research team of the invention finds that endogenous cells can selectively encapsulate miRNAs into exosomes (exosomes), the exosomes can transfer miRNA into receptor cells, and the secreted miRNA can powerfully block the expression of target genes at relatively low concentration. Exosomes are biocompatible with the host immune system and have the innate ability to protect and transport miRNA across biological barriers in vivo, thus becoming a potential solution to overcome problems associated with siRNA delivery. For example, chinese patent publication No. CN110699382A discloses a method for preparing exosomes for delivering siRNA, and discloses a technique for isolating exosomes from plasma and encapsulating siRNA into exosomes by electroporation.

However, such technologies for in vitro separation or preparation of exosomes usually require a large amount of exosomes obtained by cell culture and a step of siRNA encapsulation, which makes the clinical cost of large-scale application of the product very high and cannot be borne by general patients; more importantly, the complex production/purification process of exosomes makes it almost impossible to comply with GMP standards.

So far, the medicine taking exosome as an active ingredient has never been approved by CFDA, and the core problem is that the consistency of exosome products cannot be ensured, and the problem directly causes that the products cannot obtain the medicine production license. If the problem can be solved, the method is of great significance for promoting RNAi therapy to treat lung cancer.

Therefore, the development of a safe, accurate and efficient siRNA delivery system is a loop essential for improving the effect of RNAi therapy and promoting RNAi therapy.

Disclosure of Invention

In view of the above, the embodiments of the present application provide an RNA delivery system for treating lung cancer and applications thereof, so as to solve the technical defects existing in the prior art.

One aspect of the present invention is to provide an RNA delivery system for treating lung cancer, which comprises a viral vector carrying RNA fragments capable of treating lung cancer, wherein the viral vector is capable of enriching in organ tissues of a host and endogenously and spontaneously forming a complex structure containing the RNA in the organ tissues of the host, and the complex structure is capable of delivering the RNA fragments into the lung to treat lung cancer.

Further, the viral vector is an adeno-associated virus.

Further, the adenovirus-associated virus is adenovirus-associated virus type 5, adenovirus-associated virus type 8 or adenovirus-associated virus type 9.

Further, the RNA fragment comprises 1, two or more specific RNA sequences of medical significance, which are siRNA, shRNA or miRNA of medical significance.

Further, the viral vector comprises a promoter sequence and a targeting tag, wherein the targeting tag is capable of forming a targeting structure of the complex structure in an organ tissue of a host, the targeting structure is located on the surface of the complex structure, and the complex structure is capable of searching for and binding to a target tissue through the targeting structure to deliver the RNA fragment into the target tissue.

Further, the virus vector comprises any one line or combination of lines of the following: promoter-RNA fragment, promoter-targeting tag, promoter-RNA fragment-targeting tag; each viral vector comprises at least one RNA segment and one targeting label, wherein the RNA segment and the targeting label are positioned in the same line or different lines.

Further, the viral vector also comprises a flanking sequence, a compensation sequence and a loop sequence which can enable the line to be folded into a correct structure and expressed, wherein the flanking sequence comprises a 5 'flanking sequence and a 3' flanking sequence;

the virus vector comprises any one line or combination of several lines: 5 '-promoter-5' flanking sequence-RNA fragment-loop sequence-compensating sequence-3 'flanking sequence, 5' -promoter-targeting label-5 'flanking sequence-RNA fragment-loop sequence-compensating sequence-3' flanking sequence.

Further, the 5' flanking sequence is ggatcctggaggcttgctgaaggctgtatgctgaattc or a sequence having more than 80% homology thereto;

the loop sequence is gtttggccactgactgac or a sequence with homology more than 80 percent;

<xnotran> 3' accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag 80% ; </xnotran>

The compensation sequence is a reverse complementary sequence of the RNA segment, and any 1-5 bases in the RNA segment are deleted. The base at position 1 to 5 of the reverse complement sequence of RNA is deleted in order to prevent the sequence from being expressed.

Preferably, the complementing sequence is the reverse complement of the RNA fragment, and any 1-3 bases in the RNA fragment are deleted.

More preferably, the complementary sequence is the reverse complement of the RNA fragment, and any 1-3 consecutive bases in the complementary sequence are deleted.

Most preferably, the complementing sequence is the reverse complement of the RNA fragment, and the 9 th and/or 10 th base is deleted.

Further, in the case where at least two kinds of strands are present in the viral vector, adjacent strands are connected to each other via a sequence consisting of sequences 1 to 3 (sequence 1-sequence 2-sequence 3);

wherein, the sequence 1 is CAGATC, the sequence 2 is a sequence consisting of 5-80 bases, and the sequence 3 is TGGATC.

Further, in the case where at least two kinds of lanes are present in the viral vector, adjacent lanes are connected to each other through sequence 4 or a sequence having a homology of more than 80% to sequence 4;

wherein the sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACGACCAGTGGAC.

Further, the organ tissue is a liver, and the composite structure is an exosome.

Further, the targeting label is selected from targeting peptides or targeting proteins with targeting function.

Further, the targeting peptides include RVG targeting peptide, GE11 targeting peptide, PTP targeting peptide, TCP-1 targeting peptide, MSP targeting peptide;

the target protein comprises RVG-LAMP2B fusion protein, GE11-LAMP2B fusion protein, PTP-LAMP2B fusion protein, TCP-1-LAMP2B fusion protein and MSP-LAMP2B fusion protein.

Further, the RNA sequence is 15-25 nucleotides in length. For example, the RNA sequence can be 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 nucleotides in length. Preferably, the RNA sequence is 18-22 nucleotides in length.

Further, the RNA sequence capable of treating lung cancer is selected from any one or more of the following RNAs: siRNA of EGFR gene, siRNA of KRAS gene or nucleic acid molecule encoding the above RNA.

siRNA of EGFR gene comprises UGUUGCUUCUUAAUUCU, AAAUGAUCUUCAAAGUGCCC, UCUUAAGAAGGAAAGAUCAU, AAUAUUCGUCGUAGCAUUUAGGA, UAAAUCCUCACAAUACUU, other sequences capable of inhibiting EGFR gene expression and sequences with homology of more than 80 percent with the sequences.

The siRNA of the KRAS gene comprises UGAUUUAAGUAUUAUUAUUAUUAUGC, AAUUGUUCCUCUAUAAUGGUG, UAAUUUGUUCUCUAAUUGU, UUUGUUGUUCGAAUUUCCUCGA, UGUAUUAUACAUAUACACACACC, other sequences which can inhibit the expression of the KRAS gene and sequences with homology of more than 80 percent with the sequences.

The "sequence having a homology of more than 80" may be 85%, 88%, 90%, 95%, 98%, or the like.

Optionally, the RNA fragment comprises an RNA sequence body and a modified RNA sequence obtained by ribose modification of the RNA sequence body. That is, the RNA fragment may consist of only at least one RNA sequence entity, only at least one modified RNA sequence, or both the RNA sequence entity and the modified RNA sequence.

In the present invention, the isolated nucleic acids also include variants and derivatives thereof. The nucleic acids can be modified by one of ordinary skill in the art using conventional methods. Modifications include (but are not limited to): methylation modification, alkyl modification, glycosylation modification (such as 2-methoxy-glycosyl modification, alkyl-glycosyl modification, sugar ring modification and the like), nucleic acid modification, peptide segment modification, lipid modification, halogen modification, nucleic acid modification (such as 'TT' modification) and the like. In one embodiment of the invention, the modification is an internucleotide linkage, for example selected from: thiophosphate, 2'-O Methoxyethyl (MOE), 2' -fluoro, alkyl phosphonate, dithiophosphate, alkyl thiophosphonate, phosphoramidate, carbamate, carbonate, phosphotriester, acetamide ester, carboxymethyl ester, and combinations thereof. In one embodiment of the invention, the modification is a modification to a nucleotide, for example selected from: peptide Nucleic Acids (PNA), locked Nucleic Acids (LNA), arabinose-nucleic acids (FANA), analogs, derivatives, and combinations thereof. Preferably, the modification is a 2' fluoropyrimidine modification. The 2 '-fluoropyrimidine modification is to replace 2' -OH of pyrimidine nucleotide on RNA with 2'-F, and the 2' -F can make RNA not be easily recognized by RNase in vivo, thereby increasing the stability of RNA fragment in vivo delivery.

Further, the delivery system is a delivery system for use in mammals including humans.

Another aspect of the present application is to provide a use of the RNA delivery system for treating lung cancer as described above in medicine.

Further, the administration mode of the medicine comprises oral administration, inhalation, subcutaneous injection, intramuscular injection and intravenous injection.

The dosage form of the medicine can be tablets, capsules, powder, granules, pills, suppositories, ointments, solutions, suspensions, lotions, gels, pastes and the like.

The technical effects of this application do:

the RNA delivery system for treating lung cancer provided by the application takes the virus as a carrier, and the virus carrier as a mature injectant, so that the safety and reliability of the RNA delivery system are fully verified, and the RNA delivery system is very good in drug property. The RNA sequence which finally exerts the effect is encapsulated and conveyed by the endogenous exosome, no immune reaction exists, and the safety of the exosome does not need to be verified. The delivery system can deliver various small-molecule RNAs and has strong universality. Moreover, the preparation of viral vectors is much cheaper than that of exosomes or substances such as proteins and polypeptides, and is economical. The RNA delivery systems provided herein for the treatment of lung cancer are capable of self-assembling with an AGO in vivo ₂ Tightly combined and enriched into a composite structure (exosome), not only can prevent the exosome from being degraded prematurely and maintain the stability of the exosome in circulation, but also is beneficial to the absorption of receptor cells, the intracytoplasmic release and the escape of lysosomes, and the required dosage is low.

The RNA delivery system for treating lung cancer provided by the application is applied to medicines, namely a medicine delivery platform is provided, the lung cancer treatment effect can be greatly improved, the research and development basis of more RNA medicines can be formed through the platform, and the RNA medicine research and development and use are greatly promoted.

Drawings

FIG. 1 is a graph of KRAS siRNA-based lung cancer treatment in a mouse as provided in an embodiment of the present application;

FIG. 2 is a graph of EGFR siRNA based lung cancer treatment in mice provided by an embodiment of the present application;

FIG. 3 is a graph comparing the levels of various enzymes in mice provided in an example of the present application.

Fig. 4 is a graph showing the enrichment effect of lentiviral vectors in liver, lung, plasma, and exosome and the detection of EGFR gene expression level, provided in an embodiment of the present application, where a is the EGFR siRNA enrichment effect in liver and lung after intravenous injection of lentiviral vectors, B is the EGFR siRNA enrichment effect in plasma and exosome after intravenous injection of lentiviral vectors, C is the EGFR protein expression effect after intravenous injection of lentiviral vectors, and D is the EGFR mRNA expression effect after intravenous injection of lentiviral vectors.

Fig. 5 is a graph showing the enrichment effect of the adenovirus vector in liver, lung, plasma, exosome and the detection of EGFR gene expression level, provided in an embodiment of the present application, where a is the EGFR siRNA enrichment effect in liver and lung after intravenous injection of the adenovirus vector, B is the EGFR siRNA enrichment effect in plasma and exosome after intravenous injection of the adenovirus vector, C is the EGFR protein expression effect after intravenous injection of the adenovirus vector, and D is the EGFR mRNA expression effect after intravenous injection of the adenovirus vector.

FIG. 6 shows fluorescence signal statistics of lung cancer treated by constructing 6 different RNAs into adeno-associated viral vectors according to an embodiment of the present application, in which A is siR ^E The statistics of fluorescence signals after the lung cancer is treated by constructing adeno-associated virus vectors, B is siR ^T The fluorescence signal statistics after the lung cancer is treated by constructing the adeno-associated virus vector, C is the fluorescence signal statistics after the lung cancer is treated by constructing the adeno-associated virus vector by using miR-7, and D is shR ^E The statistics of fluorescence signals after the lung cancer is treated by constructing the adeno-associated virus vector, wherein E is shR ^T And F is fluorescence signal statistics of miR-133b after the adeno-associated virus vector is constructed to treat lung cancer.

FIG. 7 shows fluorescence signals of 4 groups of RNA fragments consisting of 2 RNA sequences of any 6 different RNAs constructed by the present application into adeno-associated virus vector for lung cancer treatmentIn the figure, A is siR ^E +shR ^T Constructing fluorescence signal statistics after adeno-associated virus vector treatment of lung cancer, wherein B is siR ^T + miR-7 fluorescence signal statistics after construction of adeno-associated virus vector for treating lung cancer, wherein C is shR ^E + miR-133b construction into adeno-associated virus vector for fluorescence signal statistics after lung cancer treatment, and D is shR ^T + miR-133b is constructed into fluorescence signal statistics after adeno-associated virus vector treatment of lung cancer.

FIG. 8 shows fluorescence signal statistics of 3 groups of RNA fragments consisting of 3 RNA sequences of 6 different RNAs respectively constructed into adeno-associated virus vectors for treating lung cancer, wherein A is siR ^E +shR ^T + miR-7 construction into adeno-associated virus vector for fluorescence signal statistics after lung cancer treatment, and B is siR ^T +shR ^E + miR-7 fluorescence signal statistics after construction of adeno-associated virus vector for treating lung cancer, wherein C is shR ^E +siR ^T + miR-133b is constructed into fluorescence signal statistics after adeno-associated virus vector treatment of lung cancer.

FIG. 9 shows the result of siRNA enrichment in liver, lung, plasma, exosome species and the result of detecting the expression levels of EGFR protein and mRNA after intravenous injection, where A is AAV-siR ^E And AAV-GE11-siR ^E The result of enrichment in liver and lung, B is AAV-siR ^E And AAV-GE11-siR ^E The result of enrichment in plasma and exosome is that C is AAV-siR ^E And AAV-GE11-siR ^E D is AAV-siR ^E And AAV-GE11-siR ^E The expression level of EGFR mRNA of (1).

FIG. 10 shows lung enrichment and therapeutic effects of 2 sequences with homology greater than 80% to 5' flanking sequence provided in an example of the present application after construction into AAV vector, wherein A is the result of lung enrichment shown by EGFR siRNA content, B is the therapeutic effect of 1 of the sequences, and C is the therapeutic effect of the other sequence.

FIG. 11 shows the lung enrichment effect and therapeutic effect of AAV vector constructed with a sequence having more than 80% loop sequence homology, wherein A is the lung enrichment result shown by EGFR siRNA content, B is the therapeutic effect of 1 sequence, and C is the therapeutic effect of the other sequence.

FIG. 12 shows the lung enrichment effect and therapeutic effect of AAV vector constructed with sequences having homology greater than 80% with 3' flanking sequence provided in one embodiment of the present application, wherein A is the lung enrichment result shown by EGFR siRNA content, B is the therapeutic effect of 1 of the sequences, and C is the therapeutic effect of the other sequence.

FIG. 13 shows the results of detecting the EGFR siRNA content in lung tissue after 9 hours of intravenous injection of AAV vector constructed with sequence 4 and 2 sequences 4-1 and 4-2 having a homology of more than 80% with sequence 4 provided in an example of the present application, in which A is the detection result of sequence 4, B is the detection result of sequence 4-1, and C is the detection result of sequence 4-2.

FIG. 14 shows the EGFR expression level measurement after the gene loop containing 3 RNA sequences of different lengths is injected intravenously, where A is the result of EGFR protein content and B is the result of EGFR mRNA content.

Detailed Description

The following description of specific embodiments of the present application refers to the accompanying drawings.

First, terms, test methods, and the like according to the present invention will be explained.

The Western immunoblotting (Western Blot) is carried out by transferring the protein to a membrane and detecting the protein with an antibody.

Western Blot was performed by polyacrylamide gel electrophoresis, and the test substance was a protein, "probe" was an antibody, "and" secondary antibody for color development "was labeled. Transferring the protein sample separated by PAGE to a solid phase carrier (such as nitrocellulose film), adsorbing the protein by the solid phase carrier in a non-covalent bond form, keeping the type and biological activity of the electrophoretically separated polypeptide unchanged, taking the protein or polypeptide on the solid phase carrier as an antigen, carrying out immunoreaction with a corresponding antibody, then reacting with an enzyme or isotope labeled second antibody, and carrying out substrate chromogenic or autoradiography to detect the protein component expressed by the specific target gene separated by electrophoresis. The method mainly comprises the following steps: protein extraction, protein quantification, glue preparation and electrophoresis, membrane transfer, immune labeling and development.

The detection of siRNA level, protein content and mRNA content in the invention is realized by injecting RNA delivery system into mouse body to establish mouse stem cell in vitro model. mRNA and siRNA expression levels in cells and tissues were detected by qRT-PCR. The absolute quantification of siRNA was determined by plotting a standard curve against the standard. The expression amount of each siRNA or mRNA relative to the internal reference can be expressed as 2- Δ CT, where Δ CT = C sample-C internal reference. The internal reference gene is U6 snRNA (in tissues) or miR-16 (in serum and exosomes) molecules when siRNA is amplified, and the time base of mRNA is GAPDH or 18s RNA. Western blotting experiment is used for detecting the expression level of protein in cells and tissues, and ImageJ software is used for carrying out quantitative analysis on the protein.

In the illustrations provided herein, "+" indicates P <0.05, "+" indicates P <0.01, and "+" P indicates <0.005.

In the present invention, unless otherwise specified, scientific and technical terms used herein have the meanings that are commonly understood by those skilled in the art. Also, the reagents, materials and procedures used herein are those widely used in the corresponding field.

Example 1

The present embodiment provides an RNA delivery system for treating lung cancer, which comprises a viral vector carrying RNA fragments capable of treating lung cancer, wherein the viral vector is capable of enriching in organ tissues of a host and spontaneously forming a complex structure containing the RNA endogenously in the organ tissues of the host, and the complex structure is capable of delivering the RNA fragments into lung to treat lung cancer.

Referring to FIGS. 4-5, FIG. 4 shows the enrichment effect of lentivirus vectors in liver, lung, plasma and exosome and the detection of EGFR gene expression level, and FIG. 5 shows the enrichment effect of adeno-associated virus in liver, lung, plasma and exosome and the detection of EGFR gene expression level.

In this embodiment, the viral vector further comprises a promoter and a targeting tag. The virus vector comprises any one line or combination of lines of: the virus vector comprises a promoter-RNA sequence, a promoter-targeting label and a promoter-RNA sequence-targeting label, wherein each virus vector at least comprises an RNA segment and a targeting label, and the RNA segment and the targeting label are positioned in the same line or different lines. In other words, the viral vector may include only the promoter-RNA sequence-targeting tag, or may include a combination of the promoter-RNA sequence, the promoter-targeting tag, or a combination of the promoter-targeting tag and the promoter-RNA sequence-targeting tag.

See FIG. 9,5' -promoter-5 ' flanking sequence-RNA sequence-loop sequence-compensating sequence-3 ' flanking sequence corresponding to the name AAV-siR delivery System ^E 5' -promoter-targeting tag-5 ' flanking sequence-RNA sequence-loop sequence-compensating sequence-3 ' flanking corresponding delivery System named AAV-GE11-siR ^E FIG. 9 shows the results of siRNA enrichment in liver, lung, plasma and exosome after intravenous injection and the results of expression level measurement of EGFR protein and mRNA.

Further, the viral vector may further comprise flanking sequences, including 5 'flanking sequences and 3' flanking sequences, which enable the lines to be folded into the correct structure and expressed, compensating sequences and loop sequences; the virus vector comprises any one line or combination of lines of: 5 '-promoter-5' flanking sequence-RNA fragment-loop sequence-compensating sequence-3 'flanking sequence, 5' -promoter-targeting label-5 'flanking sequence-RNA fragment-loop sequence-compensating sequence-3' flanking sequence.

Wherein, the 5' flanking sequence is preferably ggatcctggaggcttgctgagaggctgtatgctgactgaattc or a sequence with homology of more than 80 percent with the ggatcctggaggcttgctgagagctgctgtatgctgaattc, including a sequence with homology of 85 percent, 90 percent, 92 percent, 95 percent, 98 percent, 99 percent with the ggatcctggaggctgaattc, and the like.

The loop sequence is preferably gttttgggccactgactgac or a sequence with homology of more than 80 percent, and comprises sequences with homology of 85 percent, 90 percent, 92 percent, 95 percent, 98 percent and 99 percent with gttttgggccactgactgac and the like.

<xnotran> 3' accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag 80% , accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag 85%, 90%, 92%, 95%, 98%, 99% . </xnotran>

The sequences are specifically shown in Table 1 below.

Name(s)	Sequence of
		5' flanking sequence-1	CTGGAGGCTTGCTGAAGGCTGTATGCTGAATTCG
5' flanking sequence-2	CTGGAGGCTTGCTGAAGGCTGGCAGCTGAATTCG
		loop-1	GTTTTGGCCACTGACTGAC
loop-2	GTTTTGGTAACTGACTGAC
		3' flanking sequence-1	CACCGGTCAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCC
3' flanking sequence-2	CACCGGTCTGAACACAAGGCCTGTTACTAGCACGTCCATGGAACAAATGGCC

The compensation sequence is a reverse complementary sequence of the RNA segment, and any 1-5 bases in the RNA segment are deleted. When the RNA fragment contains only one RNA sequence, the complementary sequence may be a reverse complement of the RNA sequence from which any 1-5 bases are deleted.

Preferably, the complementing sequence is the reverse complement of the RNA fragment, and any 1-3 bases in the RNA fragment are deleted. When the RNA fragment contains only one RNA sequence, the complementary sequence may be a reverse complement of the RNA sequence from which any 1-3 bases are deleted.

More preferably, the complementary sequence is the reverse complement of the RNA fragment, and any 1-3 consecutive bases in the complementary sequence are deleted. When the RNA fragment contains only one RNA sequence, the complementary sequence may be a reverse complement of the RNA sequence from which any of the bases arranged consecutively at positions 1 to 3 are deleted.

Most preferably, the complementing sequence is the reverse complement of the RNA fragment, and the 9 th and/or 10 th base is deleted. When the RNA fragment contains only one RNA sequence, the complementary sequence may be a reverse complement of the RNA sequence in which position 9 and/or position 10 is deleted. The deletion of the 9 th and 10 th bases is most effective.

The flanking sequence, the compensating sequence and the loop sequence are not randomly selected, but are determined based on a large amount of theoretical research and experiments, and the expression rate of the RNA fragment can be improved to the maximum extent under the coordination of the specific flanking sequence, the compensating sequence and the loop sequence.

See fig. 10-12, fig. 10 shows the lung enrichment effect and therapeutic effect of the AAV vector constructed with the sequence having more than 80% homology in 5 'flanking sequence, fig. 11 shows the lung enrichment effect and therapeutic effect of the AAV vector constructed with the sequence having more than 80% homology in loop sequence, and fig. 12 shows the lung enrichment effect and therapeutic effect of the AAV vector constructed with the sequence having more than 80% homology in 3' flanking sequence.

In the case of viral vectors carrying two or more strands, adjacent strands may be connected by sequence 1-sequence 2-sequence 3; among them, the sequence 1 is preferably CAGATC, the sequence 2 may be a sequence consisting of 5 to 80 bases, such as 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75 bases, preferably a sequence consisting of 10 to 50 bases, more preferably a sequence consisting of 20 to 40 bases, and the sequence 3 is preferably TGGATC.

More preferably, in the case where the viral vector carries two or more strands, adjacent strands are connected to each other via sequence 4 or a sequence having a homology of more than 80% to sequence 4; wherein the sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGAC.

See figure 13, which shows the results of detecting the EGFR siRNA content in lung tissue 9 hours after the intravenous injection of AAV vector constructed with sequence 4 and 2 sequences 4-1 and 4-2 with homology of more than 80% to sequence 4.

The sequences are specifically shown in Table 2 below.

The RNA fragments described above comprise 1, two or more specific RNA sequences of medical interest, which are capable of being expressed in the target receptor and the complementing sequences are not capable of being expressed in the target receptor. The RNA sequence can be an siRNA sequence, an shRNA sequence or an miRNA sequence, and is preferably an siRNA sequence.

An RNA sequence is 15-25 nucleotides (nt), preferably 18-22nt, such as 18nt, 19nt, 20nt, 21nt, 22 nt. The range of the sequence length is not arbitrarily selected, but determined by trial and error. A large number of experiments prove that under the condition that the length of the RNA sequence is less than 18nt, particularly less than 15nt, the RNA sequence is mostly ineffective and cannot play a role, and under the condition that the length of the RNA sequence is more than 22nt, particularly more than 25nt, the cost of a line is greatly improved, the effect is not better than that of the RNA sequence with the length of 18-22nt, and the economic benefit is poor. Therefore, when the length of the RNA sequence is 15 to 25nt, particularly 18 to 22nt, both cost and action can be achieved, and the effect is the best. Taking the combined use of "siRNA1" and "siRNA2" on the same viral vector as an example, the functional structural region of the viral vector can be represented as: (promoter-siRNA 1) -linker- (promoter-siRNA 2) -linker- (promoter-targeting tag), or (promoter-targeting tag-siRNA 1) -linker- (promoter-targeting tag-siRNA 2), or (promoter-siRNA 1) -linker- (promoter-targeting tag-siRNA 2), etc.

See FIG. 14, where the vector systems with RNA sequence lengths of 18, 20, and 22 correspond to AAV-siR, respectively ^E (18)、AAV-siR ^E (20)、AAV-siR ^E (22) FIG. 14 shows the detection of EGFR expression level after intravenous injection in the 3 gene circuits described above.

The specific sequences are shown in Table 3 below.

Name (R)	Sequence of
		siRE(18)	ACCTATTCCGTTACACACT
siRE(20)	ATACCTATTCCGTTACACAC
		siRE(22)	ATACCTATTCCGTTACACACTT

The RNA described above comprises 1, two or more specific RNA sequences of medical interest, which are capable of being expressed in the target receptor, and the complementing sequence is not capable of being expressed in the target receptor.

The RNA capable of treating lung cancer is selected from any one or more of the following RNAs: siRNA of EGFR gene, siRNA of KRAS gene or nucleic acid molecule encoding the above RNAs.

The number of effective sequences of RNA for treating lung cancer is 1, 2 or more. For example, the siRNA of EGFR gene and the siRNA of KRAS gene may be used in combination on the same viral vector, or the siRNA of EGFR gene or the siRNA of KRAS gene may be used alone.

More specifically, the functional domains of the viral vector can be represented as: (5 ' -promoter-5 ' flanking sequence-siRNA 1-loop sequence-compensating sequence-3 ' flanking sequence) -linking sequence- (5 ' -promoter-5 ' flanking sequence-siRNA 2-loop sequence-compensating sequence-3 ' flanking sequence) -linking sequence- (5 ' -promoter-targeting tag) -5' flanking sequence-siRNA 1-loop sequence-compensating sequence-3 ' flanking sequence) -linking sequence- (5 ' -promoter-targeting tag-5 ' flanking sequence-siRNA 2-loop sequence-compensating sequence-3 ' flanking sequence), or (5 ' -promoter-5 ' flanking sequence-siRNA 1-loop sequence-compensating sequence-3 ' flanking sequence) -linking sequence- (5 ' -promoter-targeting tag-5 ' flanking sequence-siRNA 2-loop sequence-compensating sequence-3 ' flanking sequence), (5 ' -promoter-targeting tag-5 ' flanking sequence-1-siRNA 2-loop sequence-compensating sequence-3 ' flanking sequence), etc. In other cases, the same can be analogized, and the description is omitted here. The above linker sequence may be "seq. No. 1-seq. No. 2-seq. No. 3" or "seq. No. 4", and a bracket indicates a complete circuit (circuit).

Preferably, the RNA may also be obtained by modifying the RNA sequence (siRNA, shRNA or miRNA) in RNA, preferably 2' fluoropyrimidine. The 2 '-fluoropyrimidine modification is to replace 2' -OH of pyrimidine nucleotide on siRNA, shRNA or miRNA with 2'-F, wherein the 2' -F can make RNA enzyme in human body not easily recognize the siRNA, shRNA or miRNA, so that the stability of RNA in vivo transmission can be increased.

Specifically, the liver phagocytoses exogenous viruses, up to 99% of the exogenous viruses enter the liver, so that when the viruses are used as vectors, the viruses can be enriched in liver tissues without specific design, then the viral vectors are opened to release RNA molecules (siRNA, shRNA or miRNA), the liver tissues spontaneously wrap the RNA molecules into exosomes, and the exosomes become RNA delivery mechanisms.

Preferably, in order to make the RNA delivery mechanism (exosome) have the ability of "precise targeting", we design a targeting tag in the virus injected into the body, and the targeting tag will also be assembled into exosome by liver tissue, especially when selecting some specific targeting tags, the targeting tag can be inserted into the exosome surface, thereby becoming a targeting structure capable of guiding exosome, which greatly improves the accuracy of the RNA delivery mechanism of the present invention, on one hand, can greatly reduce the amount of virus vector to be introduced, and on the other hand, greatly improves the efficiency of potential drug delivery.

The targeting label is selected from one of peptides, proteins or antibodies with targeting functions, the selection of the targeting label is a process requiring creative labor, on one hand, an available targeting label needs to be selected according to target tissues, and on the other hand, the targeting label is ensured to be stably present on the surface of exosomes, so that the targeting function is achieved. The target peptide, the target protein and the antibody which are screened at present. Wherein, the targeting peptide includes but is not limited to RVG targeting peptide (the nucleotide sequence is shown in SEQ ID No. 1), GE11 targeting peptide (the nucleotide sequence is shown in SEQ ID No. 2), PTP targeting peptide (the nucleotide sequence is shown in SEQ ID No. 3), TCP-1 targeting peptide (the nucleotide sequence is shown in SEQ ID No. 4), MSP targeting peptide (the nucleotide sequence is shown in SEQ ID No. 5); the target protein includes, but is not limited to RVG-LAMP2B fusion protein (nucleotide sequence is shown in SEQ ID No. 6), GE11-LAMP2B fusion protein (nucleotide sequence is shown in SEQ ID No. 7), PTP-LAMP2B fusion protein (nucleotide sequence is shown in SEQ ID No. 8), TCP-1-LAMP2B fusion protein (nucleotide sequence is shown in SEQ ID No. 9), and MSP-LAMP2B fusion protein (nucleotide sequence is shown in SEQ ID No. 10). Preferably, a GE11 targeting peptide, GE11-LAMP2B fusion protein, is used.

Furthermore, for the purpose of precise delivery, we tested various viral vector-loading schemes, and derived another optimized scheme: the viral vector may also be composed of multiple viruses with different structures, one virus containing a promoter and a targeting tag, and the other virus containing a promoter and an RNA fragment. The targeting effect of the two viral vectors is not inferior to that generated by loading the same targeting tag and RNA segment in one viral vector.

More preferably, when two different viral vectors are injected into a host, the viral vector with the RNA sequence can be injected first, and then the viral vector containing the targeting tag is injected after 1-2 hours, so that a better targeting effect can be achieved.

The above described delivery systems may be used in mammals including humans.

The RNA delivery system for treating lung cancer provided by the embodiment takes the virus as the vector and the virus vector as a mature injectant, the safety and reliability of the RNA delivery system are fully verified, and the RNA delivery system has very good druggability. The RNA sequence which finally exerts the effect is encapsulated and conveyed by the endogenous exosome, no immune reaction exists, and the safety of the exosome does not need to be verified. The delivery system can deliver various small-molecule RNAs and has strong universality. Moreover, the preparation of viral vectors is much cheaper than that of exosomes or substances such as proteins and polypeptides, and is economical. The RNA delivery system for treating lung cancer provided in this example is capable of self-assembling with AGO in vivo ₂ Tightly combined and enriched into a composite structure (exosome), not only can prevent the exosome from being degraded prematurely and maintain the stability of the exosome in circulation, but also is beneficial to the absorption of receptor cells, the intracytoplasmic release and the escape of lysosomes, and the required dosage is low.

Example 2

On the basis of example 1, this example provides a drug. An RNA delivery system for treating lung cancer, the system comprising a viral vector carrying RNA fragments capable of treating lung cancer, the viral vector being capable of enriching in the host organ tissue and spontaneously forming endogenously in the host organ tissue a complex structure comprising the RNA, the complex structure being capable of delivering the RNA fragments to the lung for lung cancer treatment.

Referring to fig. 6-8, fig. 6 is a fluorescence signal statistic of 6 different RNAs constructed into adeno-associated virus vector for treating lung cancer, wherein 6 RNAs are: siR ^E (target gene is EGFR), siR ^T (the target gene is TNC), shR ^E (target gene is EGFR), shR ^T (the target gene is TNC), miR-7 (the target gene is EGFR), miR-133b (the target gene is EGFR); FIG. 7 is a statistic of fluorescence signals after lung cancer treatment for 4 groups consisting of any 2 RNA sequences of the 6 RNAs provided above; FIG. 8 is a statistic of fluorescence signals after lung cancer treatment for 3 groups consisting of any 3 of the 6 RNAs provided above.

The specific sequences (precursors) are shown in Table 4 below.

Further, the viral vector comprises a promoter sequence and a targeting tag, wherein the targeting tag is capable of forming a targeting structure of the complex structure in an organ tissue of a host, the targeting structure is positioned on the surface of the complex structure, and the complex structure is capable of searching for and binding to a target tissue through the targeting structure to deliver the RNA segment into the target tissue.

For the explanation of the above viral vectors, RNA fragments, targeting tags, etc. in this example, reference can be made to example 1, which is not repeated herein.

The drug can be delivered to the target tissue lung cancer by the RNA delivery system described in example 1 after entering the human body by oral administration, inhalation, subcutaneous injection, intramuscular injection or intravenous injection, and then can play a therapeutic role.

The medicine can also be used in combination with other medicines for treating lung cancer to enhance therapeutic effect. Such as gefitinib, erlotinib, afatinib, and the like.

The medicament of this embodiment may further comprise a pharmaceutically acceptable carrier including, but not limited to, diluents, buffers, emulsions, encapsulants, excipients, fillers, adhesives, sprays, transdermal absorbents, humectants, disintegrants, absorption enhancers, surfactants, colorants, flavorants, adjuvants, desiccants, adsorbent carriers, and the like.

The dosage form of the medicine provided by the embodiment can be tablets, capsules, powder, granules, pills, suppositories, ointments, solutions, suspensions, lotions, gels, pastes and the like.

The drug provided by the embodiment takes the virus as a carrier and the virus carrier as a mature injectant, the safety and reliability of the drug are fully verified, and the drug performance is very good. The RNA sequence which finally exerts the effect is encapsulated and conveyed by the endogenous exosome, no immune reaction exists, and the safety of the exosome does not need to be verified. The medicine can deliver various small molecular RNAs and has strong universality. And the preparation of the virus vector is cheaper than that of exosome or substances such as protein, polypeptide and the like, and the economy is good. The drugs provided herein are capable of self-assembling with an AGO in vivo ₂ Tightly combined and enriched into a composite structure (exosome), not only can prevent the exosome from being degraded prematurely and maintain the stability of the exosome in circulation, but also is beneficial to the absorption of receptor cells, the release in cytoplasm and the escape of lysosomes, and the required dosage is low.

Example 3

Based on example 1 or 2, the present example provides the use of an RNA delivery system for the treatment of lung cancer in medicine. The following tests are specifically described herein.

In the first experiment, we encapsulated EGFR siRNA system (AAV-CMV-EGFR siRNA) and KRAS siRNA system (AAV-CMV-KRAS siRNA) with liver high affinity AAV-5 type adeno-associated virus, and injected into tail vein with 100. Mu.L titer of 10 ¹² AAV solution at v.g/ml into mice. In vivo AAV expression was monitored by small animal living body, and after 3 weeks, in vivo AAV expression was observedAnd especially liver, stable expression.

In the second test, 1 test group and 2 control groups were set, wherein the test group was AAV-CMV-KRAS-siRNA group, and the control group was PBS group and AAV-CMV-scrR group.

The same number of mice are selected for each group, mouse lung cancer cells (LLC cells) are injected into the mice, and the progress of mouse model construction is observed by adopting a CT scanning technology. And (3) after 30 days, the mice successfully constructed are administrated, the administration is carried out once in two days, namely PBS buffer solution/AAV-CMV-scrR/AAV-CMV-KRAS siRNA is injected into the PBS group/AAV-CMV-scrR group/AAV-CMV-KRAS siRNA group mice once every two days for treatment, the mice are respectively subjected to survival analysis and tumor evaluation, and the treatment is stopped 7 times after the administration.

The survival rate of mice in each group within 100 days after treatment is counted, and the result is shown in FIG. 1A, and it can be seen that the survival rate of mice in the PBS group and the AAV-CMV-scrR group is almost the same, while the survival rate of mice in the AAV-CMV-KRAS siRNA group is the highest.

CT scanning is respectively carried out on each group of mice before and after administration, 3D modeling is carried out on lung tissues of the mice according to CT images, and the size of the tumor volume is calculated, and the result is shown in figure 1B. In fig. 1B, "PBS pre" indicates the PBS group before administration, and "PBS post" indicates the PBS group after administration; "AAV-CMV-scrR pre" means AAV-CMV-scrR group before administration, "AAV-CMV-scrR post" means AAV-CMV-scrR group after administration; the term "AAV-CMV-KRAS-siRNA pre" refers to the AAV-CMV-KRAS siRNA group before administration, and the term "AAV-CMV-KRAS-siRNA post" refers to the AAV-CMV-KRAS siRNA group after administration. It can be seen that the mice in the AAV-CMV-KRAS siRNA group showed a significant decrease in tumor volume after administration, whereas the mice in the PBS group and AAV-CMV-scrR group showed not only no decrease but also an increase in tumor volume to various degrees after administration.

The KRAS protein and mRNA expression levels in the lungs of each group of mice were detected by RT-qPCR and Western blotting, respectively, and the results are shown in FIG. 1C and FIG. 1D. The results showed that the mouse lung KRAS protein and mRNA expression levels of AAV-CMV-KRAS siRNA group were reduced compared to the control group.

The tests show that AAV-CMV-KRAS siRNA has obvious therapeutic effect on mouse lung cancer tumor.

In the third experiment, 1 test group and 2 control groups are set, wherein the test group is AAV-CMV-EGFR siRNA group, and the control group is PBS group and AAV-CMV-scrR group.

Constructing an EGFR-DEL19 mouse model, feeding doxycycline feed to induce tumor generation, administering the successfully constructed mouse 30 days later, administering once every two days, namely injecting PBS buffer solution/AAV-CMV-scrR/AAV-CMV-EGFR siRNA once every two days into the PBS group/AAV-CMV-scrR group/AAV-CMV-EGFR siRNA group mouse to treat, respectively performing survival analysis and tumor evaluation on the mouse, and stopping treatment 7 times after administration.

The survival of mice in each group within 100 days after treatment was counted, and the results are shown in FIG. 2A, and it can be seen that the survival rate of mice in the PBS group and AAV-CMV-scrR group is almost the same, while the survival rate of mice in the AAV-CMV-EGFR siRNA group is the highest.

CT scans were performed on each group of mice before and after the administration, and the results are shown in fig. 2E, and 3D modeling was performed on the lung tissue of the mice based on the CT images of fig. 2E, and the tumor volume was calculated, and the results are shown in fig. 2B. In fig. 2B, "PBS pre" indicates the PBS group before administration, and "PBS post" indicates the PBS group after administration; "AAV-CMV-scrR pre" means AAV-CMV-scrR group before administration, "AAV-CMV-scrR post" means AAV-CMV-scrR group after administration; "AAV-CMV-EGFR siRNA pre" indicates the AAV-CMV-EGFR siRNA group before administration, and "AAV-CMV-EGFR siRNA post" indicates the AAV-CMV-EGFR siRNA group after administration. It can be seen that the tumor volume of the mice in the AAV-CMV-EGFR siRNA group is significantly reduced after administration, while the mice in the PBS group and AAV-CMV-scrR group showed not only no decrease in tumor volume but also different increases in tumor volume after administration.

The lung EGFR protein and mRNA expression levels of each group of mice were detected by RT-qPCR and Western blotting, respectively, and the results are shown in FIG. 2C and FIG. 2D. The results show that the lung EGFR protein and mRNA expression of the mice in the AAV-CMV-EGFR siRNA group is reduced compared with the lung EGFR protein and mRNA expression of the mice in the control group.

The tests show that AAV-CMV-EGFR siRNA has obvious therapeutic effect on EGFR mutant mouse lung cancer tumor.

In the fourth experiment, 2 test groups and 2 control groups are set, wherein the test groups are an AAV-CMV-KRAS siRNA group and an AAV-CMV-EGFR siRNA group, and the control groups are a PBS group and an AAV-CMV-scrR group.

An EGFR-DEL19 mouse model is constructed, doxycycline feed is fed to induce tumor generation, the successfully constructed mice are administrated 30 days later, and the administration is carried out once every two days, namely PBS buffer solution/AAV-CMV-scrR/AAV-CMV-EGFR siRNA/AAV-CMV-KRAS siRNA group mice are injected once every two days for treatment.

The contents of glutamic-pyruvic transaminase (ALT), glutamic-oxalacetic transaminase (AST), total Bilirubin (TBIL), serum alkaline phosphatase (ALP), creatinine (CREA) and Blood Urea Nitrogen (BUN) in each group of mice were measured after the treatment, and the results are shown in FIGS. 3A to 3F, which shows that the contents of the above enzymes in the mice in the PBS group, the AAV-CMV-scrR group, the AAV-CMV-EGFR siRNA group and the AAV-CMV-KRAS siRNA group are almost the same.

The tests can show that the encapsulation of the EGFR siRNA system (AAV-CMV-EGFR siRNA) and the KRAS siRNA system (AAV-CMV-KRAS siRNA) by the AAV-5 type adeno-associated virus with high liver affinity has good safety and high reliability, does not generate negative effects, and is suitable for large-scale popularization and application.

In this document, "upper", "lower", "front", "rear", "left", "right", and the like are used only to indicate relative positional relationships between relevant portions, and do not limit absolute positions of the relevant portions.

In this document, "first", "second", and the like are used only for distinguishing one from another, and do not indicate the degree and order of importance, the premise that each other exists, and the like.

In this context, "equal", "same", etc. are not strictly mathematical and/or geometric limitations, but also include tolerances as would be understood by a person skilled in the art and allowed for manufacturing or use, etc.

Unless otherwise indicated, the numerical ranges herein include not only the entire range within its two endpoints, but also several sub-ranges subsumed therein.

The preferred embodiments and examples of the present application have been described in detail with reference to the accompanying drawings, but the present application is not limited to the embodiments and examples described above, and various changes can be made within the knowledge of those skilled in the art without departing from the concept of the present application.

Claims

1. An RNA delivery system for treating lung cancer, comprising a viral vector carrying an RNA fragment capable of treating lung cancer, said viral vector being capable of being enriched in an organ tissue of a host and of spontaneously forming a complex structure containing said RNA endogenously in said organ tissue of said host, said complex structure being capable of delivering said RNA fragment into the lung for lung cancer treatment.

2. The RNA delivery system of claim 1, wherein the viral vector is an adeno-associated virus.

3. The RNA delivery system of claim 2, wherein the adeno-associated virus is adeno-associated virus type 5, adeno-associated virus type 8, or adeno-associated virus type 9.

4. The RNA delivery system of claim 1, wherein the RNA segment comprises 1, two or more specific RNA sequences of medical interest, the RNA sequences being sirnas, shrnas or mirnas of medical interest.

5. The RNA delivery system of claim 1, wherein the viral vector comprises a promoter sequence and a targeting tag, wherein the targeting tag is capable of forming a targeting moiety of the complex in an organ tissue of the host, wherein the targeting moiety is located on a surface of the complex, and wherein the complex is capable of targeting and binding a target tissue via the targeting moiety to deliver the RNA fragment into the target tissue.

6. The RNA delivery system according to claim 5, wherein the viral vector comprises any one or a combination of the following lines: promoter-RNA fragment, promoter-targeting tag, promoter-RNA fragment-targeting tag; each viral vector comprises at least one RNA segment and one targeting label, wherein the RNA segment and the targeting label are positioned in the same line or different lines.

7. The RNA delivery system of claim 5, wherein the viral vector further comprises flanking sequences comprising a 5 'flanking sequence and a 3' flanking sequence, a complementing sequence and a loop sequence that enable the lines to fold into the correct structure and to be expressed;

8. The RNA delivery system for treating lung cancer of claim 7, wherein the 5' flanking sequence is ggatcctggaggcttgctgaaggctgtatgctgaattc or a sequence having more than 80% homology thereto;

The compensation sequence is a reverse complementary sequence of the RNA segment, and any 1-5 bases in the RNA segment are deleted.

9. The RNA delivery system of claim 6, wherein, in the presence of at least two strands in the viral vector, adjacent strands are connected by a sequence consisting of sequences 1-3;

10. The RNA delivery system of claim 9, wherein in the presence of at least two lines in the viral vector, adjacent lines are connected by sequence 4 or a sequence having greater than 80% homology to sequence 4;

wherein the sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACGACCAGTGGAC.

11. The RNA delivery system of claim 1, wherein the organ tissue is liver and the complex structure is an exosome.

12. The RNA delivery system of claim 11, wherein the targeting tag is selected from a targeting peptide or a targeting protein with a targeting function.

13. The RNA delivery system of claim 12, wherein the targeting peptide comprises an RVG targeting peptide, a GE11 targeting peptide, a PTP targeting peptide, a TCP-1 targeting peptide, an MSP targeting peptide;

14. The RNA delivery system of claim 13 for the treatment of lung cancer, wherein the targeting tag is a GE11 targeting peptide or a GE11-LAMP2B fusion protein.

15. The RNA delivery system of claim 5, wherein the RNA sequence is 15-25 nucleotides in length.

16. The RNA delivery system according to claim 15, wherein the RNA sequence capable of treating lung cancer is selected from any one or more of the following RNAs: siRNA of EGFR gene, siRNA of KRAS gene or nucleic acid molecule encoding the above RNA.

17. The RNA delivery system of claim 16 for treating lung cancer,

siRNA of EGFR gene comprises UGUUGCUUCUUCUAAUUCU, AAAUGAUCUUCAAAGUGCCC, UCUUAAGAAGGAAAGAUCAU, AAUAUUCCGUAGCAUUUAGGA, UAAAUCCUCACAAUACUU, other sequences with EGFR gene expression inhibition and sequences with homology more than 80 percent with the sequences;

18. The RNA delivery system of claim 1 for use in the treatment of lung cancer in a mammal, including a human.

19. Use of an RNA delivery system according to any of claims 1 to 18 in medicine for the treatment of lung cancer.

20. The use of claim 19, wherein the medicament is administered orally, by inhalation, subcutaneously, intramuscularly or intravenously.