WO2022206805A1 - Rna plasmid delivery system for treating lung cancer - Google Patents

Abstract

The present application provides an RNA plasmid delivery system for treating lung cancer. The system comprising a plasmid. The plasmid carries an RNA fragment capable of treating lung cancer. The plasmid can be enriched in organ tissues of a host. In the host organ tissues, the plasmid can endogenously and spontaneously form a composite structure containing the RNA fragment. The composite structure can feed the RNA fragment into the lung to treat lung cancer.

Description

An RNA plasmid delivery system for the treatment of lung cancer technical field

The present application relates to the field of biomedical technology, in particular to an RNA plasmid delivery system for the treatment of lung cancer.

Background technique

Lung cancer is one of the malignant tumors with the fastest growing morbidity and mortality, and the greatest threat to the health and life of the population. Lung cancer is currently mainly treated by the following means: 1. Chemotherapy: Chemotherapy is the main treatment method for lung cancer, and more than 90% of lung cancers need to be treated with chemotherapy. 1% of early-stage small cell lung cancers are cured with chemotherapy. However, chemotherapy inhibits the bone marrow hematopoietic system, mainly the decline of white blood cells and platelets. 2. Radiotherapy: The radiation field of lung cancer radiotherapy should include the primary tumor and the mediastinal area of lymph node metastasis, and should be supplemented by drug therapy. However, there are many complications of radiotherapy, such as radiation pneumonitis, radiation esophagitis, radiation pulmonary fibrosis and radiation myelitis. 3. Surgical treatment: it can completely remove the primary tumor and metastatic lymph nodes of lung cancer to achieve clinical cure; or remove most of the tumor to create favorable conditions for other treatments, that is, cytoreduction surgery; however, surgical treatment has many limitations and cannot large-scale application.

RNA interference (RNAi) therapy has been considered a promising strategy for the treatment of human diseases since its invention, but many problems have been encountered during clinical practice, and the development of this therapy has lagged far behind expectations.

It is generally believed that RNA cannot exist stably outside the cell for a long time, because RNA will be degraded into fragments by RNases rich in extracellular, so it is necessary to find a method that can make RNA stable outside the cell and can enter specific tissues in a targeted manner. Highlight the effect of RNAi therapy.

At present, there are many patents related to siRNA, mainly focusing on the following aspects: 1. Designing siRNA with medical effects. 2. Chemical modification of siRNA to improve the stability of siRNA in vivo and increase the yield. 3. Improve the design of various artificial carriers (such as lipid nanoparticles, cationic polymers and viruses) to improve the efficiency of siRNA delivery in vivo. Among them, there are many patents in the third aspect. The fundamental reason is that researchers have realized that there is currently a lack of suitable siRNA delivery systems to safely, precisely and efficiently deliver siRNA to target tissues. This problem has become the core restricting RNAi therapy. question.

The Chinese Patent Publication No. CN108624590A discloses a siRNA capable of inhibiting the expression of DDR2 gene; the Chinese Patent Publication No. CN108624591A discloses a siRNA capable of silencing the ARPC4 gene, and the siRNA is modified with α-phosphorus-selenium; The Chinese Patent Publication No. CN108546702A discloses a siRNA targeting long-chain non-coding RNA DDX11-AS1. The Chinese Patent Publication No. CN106177990A discloses a siRNA precursor that can be used for various tumor treatments. These patents design specific siRNAs to target certain diseases caused by genetic changes.

Chinese Patent Publication No. CN108250267A discloses a polypeptide, polypeptide-siRNA induced co-assembly, using polypeptide as a carrier of siRNA. The Chinese Patent Publication No. CN108117585A discloses a polypeptide for promoting apoptosis of breast cancer cells through targeted introduction of siRNA, and the polypeptide is also used as the carrier of siRNA. The Chinese Patent Publication No. CN108096583A discloses a nanoparticle carrier, which can be loaded with siRNA with breast cancer curative effect while containing chemotherapeutic drugs. These patents are all inventions and creations in terms of siRNA vectors, but their technical solutions have a common feature, that is, the vectors and siRNA are pre-assembled in vitro and then introduced into the host. In fact, this is the case with most of the delivery technologies currently designed. However, this type of delivery system has a common problem, that is, these synthetic exogenous delivery systems are easily cleared by the host's circulatory system, may also cause immunogenic responses, and may even be toxic to specific cell types and tissues.

The research team of the present invention found that endogenous cells can selectively encapsulate miRNAs into exosomes, and exosomes can deliver miRNAs to recipient cells, which secrete miRNAs at relatively low concentrations , which can effectively block the expression of target genes. Exosomes are biocompatible with the host immune system and possess the innate ability to protect and transport miRNAs across biological barriers in vivo, thus being a potential solution to overcome the problems associated with siRNA delivery. For example, the Chinese Patent Publication No. CN110699382A discloses a method for preparing siRNA-delivering exosomes, and discloses the technology of separating exosomes from plasma and encapsulating siRNA into exosomes by electroporation .

However, such techniques of in vitro isolation or preparation of exosomes often require obtaining a large amount of exosomes through cell culture, coupled with the step of siRNA encapsulation, which makes the clinical cost of large-scale application of this product very high. Patients cannot afford it; more importantly, the complex production/purification process of exosomes makes it almost impossible to comply with GMP standards.

So far, drugs with exosomes as active ingredients have never been approved by the CFDA. The core problem is that the consistency of exosome products cannot be guaranteed, and this problem directly leads to the inability of such products to obtain drug production licenses. If this problem can be solved, it will be of great significance to promote RNAi therapy for lung cancer.

Therefore, the development of a safe, precise and efficient siRNA delivery system is a crucial part of improving the effect of RNAi therapy and advancing RNAi therapy.

SUMMARY OF THE INVENTION

In view of this, the embodiments of the present application provide an RNA plasmid delivery system for treating lung cancer and its application, so as to solve the technical defects existing in the prior art.

An invention of the present application is to provide an RNA plasmid delivery system for treating lung cancer, the system comprising a plasmid carrying an RNA fragment capable of treating lung cancer, and the plasmid can be enriched in the organ tissue of a host, And endogenously and spontaneously form a composite structure containing the RNA fragment in the host organ tissue, and the composite structure can send the RNA fragment into the lungs to treat lung cancer. After the RNA fragments are sent into the lungs, they can inhibit the expression of matching genes, thereby inhibiting the development of lung cancer and realizing the treatment of lung cancer.

Optionally, the RNA fragment comprises one, two or more specific RNA sequences with medical significance, and the RNA sequences are siRNA, shRNA or miRNA with medical significance capable of inhibiting or hindering the development of lung cancer.

Optionally, the plasmid also includes a promoter and a targeting tag, the targeting tag can form the targeting structure of the composite structure in the organ tissue of the host, and the targeting structure is located on the surface of the composite structure, so The complex structure can seek and bind to the target tissue through the targeting structure, and deliver the RNA fragment into the target tissue.

Optionally, the plasmid includes any one of the following circuits or a combination of several circuits: promoter-RNA fragment, promoter-targeting tag, promoter-RNA fragment-targeting tag; in each of the plasmids, at least An RNA fragment and a targeting tag are included, the RNA fragment and targeting tag being in the same circuit or in different circuits.

Optionally, the plasmid also includes a flanking sequence, a compensation sequence and a loop sequence that can fold the circuit into a correct structure and express, and the flanking sequence includes a 5' flanking sequence and a 3' flanking sequence;

The plasmid includes any one of the following lines or a combination of several lines: 5'-promoter-5' flanking sequence-RNA sequence-loop sequence-compensating sequence-3' flanking sequence, 5'-promoter-targeting tag Or 5'-promoter-targeting tag-5'flanking sequence-RNA sequence-loop sequence-compensating sequence-3'flanking sequence.

Optionally, the 5' flanking sequence is ggatcctggaggcttgctgaaggctgtatgctgaattc or a sequence whose homology is greater than 80%;

The loop sequence is gttttggccactgactgac or a sequence whose homology is greater than 80%;

The 3' flanking sequence is accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag or a sequence whose homology is greater than 80%;

The compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-5 bases are deleted. The purpose of deleting bases 1-5 of the reverse complement of the RNA is to make the sequence unexpressed.

Preferably, the compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-3 bases are deleted.

More preferably, the compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-3 consecutive bases are deleted.

Most preferably, the compensation sequence is the reverse complement of the RNA fragment, and the 9th and/or 10th bases are deleted.

Optionally, when there are at least two lines in the plasmid, adjacent lines are connected by a sequence composed of sequences 1-3 (sequence 1-sequence 2-sequence 3);

Wherein, sequence 1 is CAGATC, sequence 2 is a sequence consisting of 5-80 bases, and sequence 3 is TGGATC.

Optionally, when there are at least two lines in the plasmid, adjacent lines are connected by sequence 4 or a sequence with more than 80% homology to sequence 4;

Wherein, sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC.

Optionally, the organ tissue is liver, and the composite structure is exosome.

Optionally, the targeting tag is selected from targeting peptides or targeting proteins with targeting function.

Optionally, the targeting peptides include RVG targeting peptides, GE11 targeting peptides, PTP targeting peptides, TCP-1 targeting peptides, and MSP targeting peptides;

The targeting proteins include RVG-LAMP2B fusion protein, GE11-LAMP2B fusion protein, PTP-LAMP2B fusion protein, TCP-1-LAMP2B fusion protein, and MSP-LAMP2B fusion protein.

Optionally, the RNA sequence is 15-25 nucleotides in length. For example, the length of the RNA sequence can be 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 nucleotides. Preferably, the RNA sequence is 18-22 nucleotides in length.

Optionally, the RNA capable of treating lung cancer is selected from any one or more of the following RNAs: siRNA of EGFR gene, siRNA of KRAS gene, or an RNA sequence with more than 80% homology to the above sequence, or encoding Nucleic acid molecules of the above RNAs. It should be noted that the RNA sequences in the "nucleic acid molecules encoding the above RNA sequences" here also include RNA sequences with a homology of more than 80% of each RNA.

Optionally, the siRNA of the EGFR gene includes UGUUGCUUCUCUUAAUUCCU, AAAUGAUCUUCAAAAGUGCCC, UCUUUAAGAAGGAAAGAUCAU, AAUAUUCGUAGCAUUUAUGGA, UAAAAAUCCUCACAUAUACUU, other sequences that inhibit the expression of the EGFR gene, and sequences that are more than 80% homologous to the above sequences.

The siRNA of KRAS gene includes UGAUUUAGUAUUAUUUAUGGC, AAUUUGUUCUCUAUAAUGGUG, UAAUUUGUUCUCUAUAAUGGU, UUAUGUUUUCGAAUUUCUCGA, UGUAUUUUACAUAAUUACACAC, other sequences that inhibit KRAS gene expression, and sequences with more than 80% homology to the above sequences.

It should be noted that the above-mentioned "sequences with more than 80% homology" may be 85%, 88%, 90%, 95%, 98%, etc. homology.

Optionally, the RNA fragment includes an RNA sequence ontology and a modified RNA sequence obtained by modifying the RNA sequence ontology with ribose sugar. That is, the RNA fragment can be composed of only at least one RNA sequence ontology, or only at least one modified RNA sequence, and can also be composed of RNA sequence ontology and modified RNA sequence.

In the present invention, the isolated nucleic acid also includes its variants and derivatives. The nucleic acid can be modified by one of ordinary skill in the art using general methods. Modification methods include (but are not limited to): methylation modification, hydrocarbyl modification, glycosylation modification (such as 2-methoxy-glycosyl modification, hydrocarbyl-glycosyl modification, sugar ring modification, etc.), nucleic acid modification, peptide modification Segment modification, lipid modification, halogen modification, nucleic acid modification (such as "TT" modification) and the like. In one of the embodiments of the present invention, the modification is an internucleotide linkage, for example selected from: phosphorothioate, 2'-O methoxyethyl (MOE), 2'-fluoro, phosphine Acid alkyl esters, phosphorodithioates, alkyl phosphorothioates, phosphoramidates, carbamates, carbonates, phosphoric triesters, acetamidates, carboxymethyl esters, and combinations thereof. In one of the embodiments of the present invention, the modification is a modification of nucleotides, such as selected from: peptide nucleic acid (PNA), locked nucleic acid (LNA), arabinose-nucleic acid (FANA), analogs, derivatives objects and their combinations. Preferably, the modification is a 2' fluoropyrimidine modification. 2'Fluoropyrimidine modification is to replace the 2'-OH of pyrimidine nucleotides on RNA with 2'-F. 2'-F can make RNA not easily recognized by RNase in vivo, thereby increasing the stability of RNA fragment transmission in vivo. sex.

Optionally, the delivery system is a delivery system for use in mammals, including humans.

The present application also provides an application of the RNA delivery system for treating lung cancer in medicine.

Optionally, the drug is a drug for the treatment of lung cancer and related diseases, and the related diseases here refer to the associated diseases or complications, sequelae, etc. that occur in the formation or development of the above-mentioned lung cancer, or have a certain correlation with lung cancer. of other diseases.

Optionally, the medicament is a medicament for the treatment of lung cancer and related diseases, and the administration modes of the medicament include oral, inhalation, subcutaneous injection, intramuscular injection, and intravenous injection.

The dosage forms of the drug can be tablets, capsules, powders, granules, pills, suppositories, ointments, solutions, suspensions, lotions, gels, pastes and the like.

Optionally, the modes of administration of the drug include oral, inhalation, subcutaneous injection, intramuscular injection, and intravenous injection. Intravenous injection is preferred.

The technical effects of this application are:

The RNA delivery system for the treatment of lung cancer provided by this application uses a plasmid as a carrier and the plasmid as a mature injectable substance. Its safety and reliability have been fully verified, and the drugability is very good. The final effective RNA sequence is packaged and delivered by endogenous exosomes, and there is no immune response, so there is no need to verify the safety of the exosomes. The delivery system can deliver all kinds of small molecule RNAs, and has strong versatility. And the preparation of plasmids is much cheaper and more economical than the preparation of exosomes or proteins, polypeptides and other substances. The RNA delivery system for the treatment of lung cancer provided in this application can be tightly combined with AGO ₂ and enriched into a composite structure (exosome) after self-assembly in vivo, which can not only prevent its premature degradation, but also maintain its stability in circulation It is also beneficial to receptor cell uptake, intracytoplasmic release and lysosomal escape, and the required dose is low.

The application of the RNA delivery system for the treatment of lung cancer provided in this application to medicines provides a drug delivery platform, which can greatly improve the therapeutic effect of lung cancer, and can also form the basis for the research and development of more RNA-based drugs through this platform. Drug research and development and use have a great impetus.

Description of drawings

Fig. 1 is a comparison diagram of plasmid distribution and metabolism in mice provided by an embodiment of the present application;

Fig. 2 is a comparison diagram of protein expression levels in mice provided by an embodiment of the present application;

FIG. 3 is a comparison diagram of related siRNA levels in mice provided by an embodiment of the present application;

FIG. 4 is a comparison diagram of absolute siRNA levels in various tissues of mice provided in an embodiment of the present application;

Figure 5 is a comparison diagram of the effect of plasmid doses on mouse siRNA levels provided by an embodiment of the present application;

Fig. 6 is the metabolic situation comparison diagram of the precursor and the mature body in the mouse liver after injecting the plasmid provided by an embodiment of the present application;

7 is a comparison diagram of siRNA kinetics and distribution in different tissues of mice provided by an embodiment of the present application;

Figure 8 is a comparison diagram of the influence of different promoters on siRNA provided by an embodiment of the present application;

FIG. 9 is a comparison diagram of the fluorescence intensity of eGFP in different tissues of mice provided by an embodiment of the present application;

Figure 10 is a comparison diagram of mouse alanine aminotransferase, aspartate aminotransferase, total bilirubin, blood urea nitrogen, serum alkaline phosphatase, creatinine content, and thymus gland weight, spleen weight, and peripheral blood cell percentage provided by an embodiment of the present application;

Figure 11 is a comparison diagram of the therapeutic effect of mouse EGFR mutant lung cancer tumor provided by an embodiment of the present application;

Figure 12 is a mouse HE staining chart, an immunohistochemical staining chart and a coloring statistics chart provided by an embodiment of the present application;

13 is a comparison diagram of the therapeutic effect of mouse KRAS mutant lung cancer tumor provided by an embodiment of the present application;

FIG. 14 is a mouse HE staining chart, an immunohistochemical staining chart, and a staining statistics chart provided in an embodiment of the present application.

Figure 15 is the fluorescence signal statistics of 6 different RNA plasmids provided in an embodiment of the present application after treatment of lung cancer, A in the figure is the fluorescence detection results of CMV-siR ^E and Albumin-siR ^E , B is CMV-siR ^T and Albumin - Fluorescence detection results of ^siRT , C is the fluorescence detection results of CMV-miR7 and Albumin-miR7, D is the fluorescence detection results of CMV-shRE and Albumin- ^shRE , ^E is the fluorescence detection results of CMV- ^shRT and Albumin- ^shRT Fluorescence detection results, F is the fluorescence detection results of CMV-miR133b and Albumin-miR133b.

Figure 16 is the fluorescence signal statistics of 4 groups of plasmids composed of any 2 RNA sequences among the 6 RNA sequences provided in an embodiment of the present application after the treatment of lung cancer, all of which are connected with CMV or Albumin RNA, and A in the figure is ^siRNA + ^shRT The fluorescence detection results of , B is the fluorescence detection results of shR ^E +miR133b, C is the fluorescence detection results of ^siRT +miR7, and D is the fluorescence detection results of ^shRT +miR133b.

Figure 17 is the fluorescence signal statistics of 3 groups of plasmids composed of any 3 RNA sequences among the 6 RNA sequences provided in an embodiment of the present application after the treatment of lung cancer, all of which are connected with CMV or Albumin RNA, and A in the figure is ^siRNA + ^shRT +miR7 fluorescence detection results, B is the fluorescence detection results of ^siRT + ^shRE +miR7, C is the fluorescence detection results of ^shRE + ^siRT +miR133b.

Figure 18 shows the enrichment results of siRNA in liver, lung, plasma, and exosomes after intravenous injection of plasmid CMV-siR ^E and plasmid CMV-GE11-siRE ^E , respectively, provided in an example of the present application. EGFR siRNA content in liver and lung without targeting peptide GE11, B is EGFR siRNA content in plasma and exosomes with/without targeting peptide GE11.

Figure 19 shows the detection results of EGFR protein and mRNA expression after intravenous injection of plasmid CMV-siR ^E and plasmid CMV-GE11-siR ^E , respectively, provided in an example of the present application, and A in the figure is the case with/without targeting peptide GE11 The protein content of EGFR was detected under the condition of B, and the mRNA content of EGFR was detected in the presence or absence of the targeting peptide GE11.

Figure 20 shows the lung enrichment effect and therapeutic effect of a plasmid containing a sequence with a 5' flanking sequence homology greater than 80% provided by an embodiment of the present application. In the figure, A is the case with/without targeting tag RVG 2 The EGFR siRNA content of the 5' flanking homologous sequence, B is the fluorescence signal detection result of one 5' flanking homologous sequence with/without targeting tag RVG, C is the case with/without targeting tag RVG Fluorescence signal detection result of another 5' flanking homologous sequence.

Figure 21 shows the lung enrichment effect and therapeutic effect of a plasmid containing a sequence with a loop sequence homology greater than 80% provided by an embodiment of the present application, and A in the figure shows 2 loops with or without targeting tag RVG The EGFR siRNA content of the homologous sequence, B is the fluorescence signal detection result of one loop homologous sequence with/without targeting tag RVG, C is the other loop homology with/without targeting tag RVG Sequence fluorescence signal detection results.

Figure 22 is the lung enrichment effect and therapeutic effect of a plasmid containing a sequence with a 3' flanking sequence homology greater than 80% provided by an embodiment of the present application, and A in the figure is with/without targeting tag RVG 2 EGFR siRNA content of the 3' flanking homologous sequence, B is the fluorescence signal detection result of one 3' flanking homologous sequence with/without targeting tag RVG, C is the case with/without targeting tag RVG Fluorescence signal detection result of another 3' flanking homologous sequence.

Figure 23 shows the detection of EGFR siRNA content in lung tissue 9 hours after intravenous injection of plasmids containing sequence 4 and two sequences 4-1 and 4-2 with more than 80% homology to sequence 4 provided by an example of the present application As a result, RNA is siRNA/ ^siRT , A in the figure is the detection result of EGFR siRNA content of sequence 4, ^B is the detection result of EGFR siRNA content of sequence 4-1, and C is the detection result of EGFR siRNA content of sequence 4-2.

Figure 24 is the detection of EGFR expression after intravenous injection of three plasmids containing RNA sequences with lengths of 18, 20, and 22, respectively, provided in an embodiment of the present application. In the figure, A is the detection result of the protein content of EGFR, and B is the mRNA of EGFR Content test results.

Detailed ways

The specific embodiments of the present application will be described below with reference to the accompanying drawings.

First, technical terms, test methods, etc. related to the present invention are explained.

Hematoxylin-eosin staining, referred to as HE staining. HE staining is one of the most basic and widely used technical methods in histology and pathology teaching and research.

The hematoxylin staining solution is alkaline and can stain the basophilic structure of the tissue (such as ribosome, nucleus and ribonucleic acid in the cytoplasm) into blue-violet; eosin is an acid dye, which can stain the eosinophilic structure of the tissue ( Such as intracellular and intercellular proteins, including Lewy bodies, alcohol bodies, and most of the cytoplasm) stained pink, making the morphology of the entire cell organization clearly visible.

The specific steps of HE staining include: sample tissue fixation and sectioning; tissue sample dewaxing; tissue sample hydration; tissue section hematoxylin staining, differentiation and anti-blue; tissue section eosin staining and dehydration; tissue sample section air-drying and sealing; Observe and photograph under the microscope.

Masson staining renders collagen fibers blue (stained by aniline blue) or green (stained by bright green) and muscle fibers red (stained by acid fuchsin and Ponceau), which is consistent with the size and organization of the anionic dye molecules of permeability. The fixed tissue is stained sequentially or mixed with a series of anionic water-soluble dyes. It can be found that red blood cells are stained with the smallest molecular anionic dyes, muscle fibers and cytoplasm are stained with medium-sized anionic dyes, and collagen fibers are stained with macromolecular anionic dyes. Dyeing with anionic dyes. This shows that red blood cells have the least permeability to anionic dyes, followed by muscle fibers and cytoplasm, and collagen fibers have the largest permeability. Type I and III collagens are green (GBM, TBM, mesangial matrix and renal interstitium are green), and erythropoietin, tubular cytoplasm, and erythrocytes are red.

The specific steps of Masson staining include:

Tissues were fixed in Bouin's solution, rinsed with running water overnight, and embedded in conventional dehydration; sections were deparaffinized to water (deparaffinized in xylene for 10 min × 3 times, and the liquid was blotted dry with absorbent paper; 100% ethanol 5 min × 2 times, with water absorption Dry the liquid with paper; 95% ethanol for 5min × 2 times, blot the liquid with absorbent paper; run water for 2min, blot dry with absorbent paper); Weiger's iron hematoxylin staining for 5-10min; ; Rinse with running water for 3min; Stain with Ponceau red acid fuchsin solution for 8min; Rinse slightly with distilled water; Treat with 1% phosphomolybdic acid aqueous solution for about 5min; Do not wash with water, directly counterstain with aniline blue solution or bright green solution for 5min; Treat with 1% glacial acetic acid 1min; dehydrated in 95% ethanol for 5min×2 times, and blotted dry with absorbent paper; 100% ethanol 5min×2 times, blotted with absorbent paper; transparent in xylene for 5min×2 times, blotted with absorbent paper; Sexual gum seals.

Western blot (Western Blot) is to transfer the protein to the membrane, and then use the antibody for detection. For the known expressed protein, the corresponding antibody can be used as the primary antibody for detection, and the expression product of the new gene can be detected by the fusion part of the antibody. .

Western Blot uses polyacrylamide gel electrophoresis, the detected object is protein, the "probe" is an antibody, and the "color development" is a labeled secondary antibody. The protein sample separated by PAGE is transferred to a solid phase carrier (such as nitrocellulose membrane), and the solid phase carrier adsorbs proteins in the form of non-covalent bonds, and can keep the types of polypeptides separated by electrophoresis and their biological activities unchanged. The protein or polypeptide on the solid phase carrier is used as an antigen, which reacts with the corresponding antibody, and then reacts with the enzyme or isotope-labeled secondary antibody to detect the specific target gene separated by electrophoresis through substrate color development or autoradiography. expressed protein components. The steps mainly include: protein extraction, protein quantification, gel preparation and electrophoresis, membrane transfer, immunolabeling and development.

Immunohistochemistry, using antigen-antibody reaction, that is, the principle of specific binding of antigen and antibody, determines the antigen (polypeptide) in tissue cells by developing the color of the chromogenic reagent (fluorescein, enzyme, metal ion, isotope) labeled antibody through chemical reaction. and protein), the localization, qualitative and relative quantitative research, called immunohistochemistry (immunohistochemistry) or immunocytochemistry (immunocytochemistry).

The main steps of immunohistochemistry include: section soaking, overnight drying, xylene dewaxing, gradient alcohol dewaxing (100%, 95%, 90%, 80%, 75%, 70%, 50%, 3min each time) , double-distilled water, dropwise addition of 3% hydrogen peroxide solution to remove catalase, water washing, antigen retrieval, dropwise addition of 5% BSA, blocking for 1 h, dilution of primary antibody, washing with PBS buffer, incubation with secondary antibody, washing with PBS buffer , color developing solution, washing with water, hematoxylin staining, dehydration with gradient ethanol, and sealing with neutral gum.

The detection of the siRNA level, the protein content and the mRNA content involved in the present invention is to establish the mouse stem cell in vitro model by injecting the RNA delivery system into the mouse. The expression levels of mRNA and siRNA in cells and tissues were detected by qRT-PCR. Absolute quantification of siRNA was determined by plotting a standard curve using the standards. The expression level of each siRNA or mRNA relative to the internal control can be represented by 2-ΔCT, where ΔCT=C sample-C internal control. When amplifying siRNA, the internal reference gene is U6snRNA (in tissue) or miR-16 (in serum, exosomes), and when amplifying mRNA, the gene is GAPDH or 18s RNA. Western blotting was used to detect protein expression levels in cells and tissues, and ImageJ software was used for protein quantitative analysis.

In the present invention, unless otherwise specified, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. In addition, the reagents, materials and operation steps used herein are the reagents, materials and conventional steps widely used in the corresponding fields.

Example 1

This embodiment provides an RNA plasmid delivery system for the treatment of lung cancer. The system includes a plasmid that carries an RNA fragment capable of treating lung cancer, the plasmid can be enriched in the organ tissue of the host, and is A complex structure containing the RNA fragment is formed endogenously and spontaneously in the host organ tissue, and the complex structure can deliver the RNA fragment into the lung for the treatment of lung cancer.

In this example, the plasmid also includes a promoter and a targeting tag. The plasmid includes any one of the following circuits or a combination of several circuits: promoter-RNA sequence, promoter-targeting tag, promoter-RNA sequence-targeting tag, and each of the plasmids includes at least one RNA fragment and a targeting tag, the RNA fragment and targeting tag are located in the same line or in different lines. In other words, the plasmid can include only a promoter-RNA sequence-targeting tag, or a combination of a promoter-RNA sequence, a promoter-targeting tag, or a promoter-targeting tag, a promoter- A combination of RNA-seq-targeting tags.

Further, the plasmid can also include a flanking sequence, a compensation sequence and a loop sequence that can make the circuit fold into a correct structure and express, and the flanking sequence includes a 5' flanking sequence and a 3' flanking sequence; the plasmid includes the following Any one line or combination of several lines: 5'-promoter-5' flanking sequence-RNA sequence-loop sequence-compensating sequence-3' flanking sequence, 5'-promoter-targeting tag, 5'-promoting sub-targeting tag-5' flanking sequence-RNA sequence-loop sequence-compensating sequence-3'flanking sequence.

See Figure 18-19, 5'-promoter-5' flanking sequence-RNA sequence-loop sequence-compensation sequence-3' flanking sequence corresponds to the plasmid name CMV- ^siRNA , 5'-promoter-targeting tag-5 'Flanking sequence-RNA sequence-loop sequence-compensation sequence-3' flanking corresponding plasmid name is CMV-GE11- ^siRE , Figure 18 shows the enrichment results of siRNA in liver, lung, plasma and exosomes after intravenous injection, Figure 19 shows the detection results of the expression levels of EGFR protein and mRNA after intravenous injection of the above plasmids.

Wherein, the 5' flanking sequence is preferably ggatcctggaggcttgctgaaggctgtatgctgaattc or a sequence with a homology greater than 80%, including a sequence with 85%, 90%, 92%, 95%, 98%, 99% homology with ggatcctggaggcttgctgaaggctgtatgctgaattc, etc.

The loop sequence is preferably gttttggccactgactgac or a sequence with more than 80% homology thereto, including sequences with 85%, 90%, 92%, 95%, 98%, 99% homology with gttttggccactgactgac, and the like.

The 3' flanking sequence is preferably accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag or a sequence with a homology greater than 80%, including a sequence with 85%, 90%, 92%, 95%, 98%, 99% homology with accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag, etc.

The compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-5 bases are deleted. When the RNA fragment contains only one RNA sequence, the compensation sequence can be the reverse complementary sequence of the RNA sequence by deleting any 1-5 bases therein.

Preferably, the compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-3 bases are deleted. When the RNA fragment contains only one RNA sequence, the compensation sequence can be the reverse complementary sequence of the RNA sequence by deleting any 1-3 bases therein.

More preferably, the compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-3 consecutive bases are deleted. When the RNA fragment contains only one RNA sequence, the compensation sequence may be the reverse complementary sequence of the RNA sequence by deleting any 1-3 consecutively arranged bases.

Most preferably, the compensation sequence is the reverse complement of the RNA fragment, and the 9th and/or 10th bases are deleted. When the RNA fragment contains only one RNA sequence, the compensation sequence may be the reverse complementary sequence of the 9th position and/or the 10th position in the deletion of the RNA sequence. Deleting bases 9 and 10 works best.

It should be noted that the above-mentioned flanking sequences, compensation sequences and loop sequences are not randomly selected, but are determined based on a large number of theoretical studies and experiments. increase the expression rate of RNA fragments.

See Figures 20-22, Figure 20 shows the lung enrichment effect and therapeutic effect of plasmids containing sequences with 5' flanking sequence homology greater than 80%, and Figure 21 shows plasmids containing loop sequence homology greater than 80% Enrichment effect and therapeutic effect in lungs, Figure 22 shows the enrichment effect and therapeutic effect of plasmids containing sequences with 3' flanking sequence homology greater than 80% in lungs.

The optional two 5' flanking homologous sequences, two loop homologous sequences and two 3' flanking homologous sequences given in Figures 20-22 are specifically shown in Table 1 below.

name	sequence
5flank1	ggataatggaggcttgctgcaggctgtatgctgaattc
5flank2	ggatactggacgcttgcttaaggctgtatggtgaattc
Loop1	gacttggccactgactgac
Loop2	gttttggccactggctgtc
3flank1	agccgtcaggacatgaggcctgttactagcactcacgtggctcaaatggcagagatctggctacactccag
3flank2	actggtcacgacacaaggcctattactagcagtcacattgaacaaatggccaagatctcgccgcactgtag

In the case that the plasmid carries two or more lines, the adjacent lines can be connected by sequence 1-sequence 2-sequence 3; wherein, sequence 1 is preferably CAGATC, and sequence 2 can be composed of 5-80 bases Sequences of composition, such as 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75 bases Any sequence may be used, preferably a sequence consisting of 10-50 bases, more preferably a sequence consisting of 20-40 bases, and sequence 3 is preferably TGGATC.

Sequence 2 is specifically shown in Table 2 below.

More preferably, when the plasmid carries two or more lines, adjacent lines are connected by sequence 4 or a sequence with a homology greater than 80% to sequence 4; wherein, sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC.

See Figure 23, which shows the detection results of EGFR siRNA content in lung tissue after 9 hours of intravenous injection of sequence 4 and two sequences 4-1 and 4-2 with more than 80% homology to sequence 4.

Sequence 4 is specifically shown in Table 3 below.

name	sequence
sequence 4	CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC
Sequence 4-1	CAGAAGATGCCGCACTCGAGGTAGTCCTTCGACCAGTGGATC
Sequence 4-2	CAGATCCCGCCGCACTCAATGAAGTGAGTCGACCAGTGGATC

The above-mentioned RNA fragments comprise one, two or more specific RNA sequences of medical significance, the RNA sequences can be expressed in the target receptor, and the compensatory sequence cannot be expressed in the target receptor. The RNA sequence can be an siRNA sequence, a shRNA sequence or a miRNA sequence, preferably an siRNA sequence.

The length of an RNA sequence is 15-25 nucleotides (nt), preferably 18-22nt, such as 18nt, 19nt, 20nt, 21nt, and 22nt. This range of sequence lengths was not chosen arbitrarily, but was determined through trial and error. A large number of experiments have proved that when the length of the RNA sequence is less than 18nt, especially less than 15nt, the RNA sequence is mostly invalid and will not play a role. The cost of the line is greatly increased, and the effect is not better than the RNA sequence with a length of 18-22nt, and the economic benefit is poor. Therefore, when the length of the RNA sequence is 15-25nt, especially 18-22nt, the cost and the effect can be taken into account, and the effect is the best.

See Figure 24, the plasmids with RNA sequence lengths of 18, 20, and 22 correspond to CMV- ^siRE (18), CMV- ^siRE (20), and CMV- ^siRE (22), respectively, and Figure 24 shows the above-mentioned three plasmid veins Detection of EGFR expression after injection.

Sequences of different lengths are specifically shown in Table 4 below.

name	sequence
siRE(18)	ACCTATTCCGTTACACACT
siRE(20)	ATACCTATTCCGTTACACAC
siRE(22)	ATACCTATTCCGTTACACACTT

The RNA capable of treating lung cancer is selected from any one or more of the following RNAs: EGFR gene siRNA, KRAS gene siRNA or nucleic acid molecules encoding the above RNAs.

The number of RNA effective sequences capable of treating lung cancer is one, two or more. For example, EGFR gene siRNA and KRAS gene siRNA can be used in combination on the same plasmid vector, or EGFR gene siRNA or KRAS gene siRNA can be used alone.

Taking the combined use of "siRNA1" and "siRNA2" on the same plasmid vector as an example, the functional structural region of the plasmid vector can be expressed as: (promoter-siRNA1)-connector sequence-(promoter-siRNA2)-connector sequence- (promoter-targeting tag), or (promoter-targeting tag-siRNA1)-linker-(promoter-targeting tag-siRNA2), or (promoter-siRNA1)-linker-(promoter- Targeting tag-siRNA2) etc.

More specifically, the functional structural region of the plasmid vector can be expressed as: (5'-promoter-5'flanking sequence-siRNA1-loop sequence-compensating sequence-3'flanking sequence)-connecting sequence-(5'-promoter - 5' flanking sequence - siRNA2-loop sequence - compensation sequence - 3' flanking sequence) - linking sequence - (5'-promoter-targeting tag), or (5'-promoter-targeting tag-5' flanking sequence-siRNA1-loop sequence-compensation sequence-3' flanking sequence)-linker sequence-(5'-promoter-targeting tag-5'flanking sequence-siRNA2-loop sequence-compensating sequence-3'flanking sequence), or (5'-promoter-5'flanking sequence-siRNA1-loop sequence-compensating sequence-3'flanking sequence)-linking sequence-(5'-promoter-targeting tag-5'flanking sequence-siRNA2-loop sequence- Compensation sequence-3'flanking sequence), (5'-promoter-targeting tag-5'flanking sequence-siRNA1-siRNA2-loop sequence-compensating sequence-3'flanking sequence), etc. Other situations can be deduced by analogy, and details are not repeated here. The above connecting sequence can be "sequence 1-sequence 2-sequence 3" or "sequence 4", and a bracket indicates a complete circuit.

Preferably, the above RNA can also be obtained by ribose modification of the RNA sequence (siRNA, shRNA or miRNA) therein, preferably 2' fluoropyrimidine modification. 2'Fluoropyrimidine modification is to replace the 2'-OH of pyrimidine nucleotides on siRNA, shRNA or miRNA with 2'-F. 2'-F can make it difficult for RNase in the human body to recognize siRNA, shRNA or miRNA, so it can Increases the stability of RNA transport in vivo.

Specifically, the liver will phagocytose exogenous plasmids, and up to 99% of the exogenous plasmids will enter the liver. Therefore, when plasmids are used as vectors, they can be enriched in liver tissue without specific design. The plasmid is opened to release RNA molecules (siRNA, shRNA, or miRNA), and liver tissue spontaneously wraps the above RNA molecules into exosomes, and these exosomes become RNA delivery mechanisms.

Preferably, in order to make the RNA delivery mechanism (exosome) have the ability of "precision guidance", we design a targeting tag in the plasmid injected into the body, and the targeting tag will also be assembled into exosomes by liver tissue , especially when certain specific targeting tags are selected, the targeting tags can be inserted into the surface of exosomes to become targeting structures that can guide exosomes, which greatly improves the RNA delivery mechanism of the present invention On the one hand, the amount of exogenous plasmids that need to be introduced can be greatly reduced, and on the other hand, the efficiency of potential drug delivery can be greatly improved.

The targeting tag is selected from one of the peptides, proteins or antibodies with targeting function. The selection of the targeting tag is a process that requires creative work. On the one hand, it is necessary to select the available targeting tags according to the target tissue. It is ensured that the targeting label can stably appear on the surface of exosomes, so as to achieve the targeting function. Targeting peptides that have been screened so far include but are not limited to RVG targeting peptide (nucleotide sequence shown in SEQ ID No: 1), GE11 targeting peptide (nucleotide sequence shown in SEQ ID No: 2), PTP targeting peptide (nucleotide sequence shown in SEQ ID No: 3), TCP-1 targeting peptide (nucleotide sequence shown in SEQ ID No: 4), MSP targeting peptide (nucleotide sequence shown in SEQ ID No: 4) SEQ ID No: 5); targeting proteins include but are not limited to RVG-LAMP2B fusion protein (nucleotide sequence shown in SEQ ID No: 6), GE11-LAMP2B fusion protein (nucleotide sequence shown in SEQ ID No: 6) : 7), PTP-LAMP2B fusion protein (nucleotide sequence shown in SEQ ID No: 8), TCP-1-LAMP2B fusion protein (nucleotide sequence shown in SEQ ID No: 9), MSP- LAMP2B fusion protein (nucleotide sequence is shown in SEQ ID No: 10). Preferably, GE11 targeting peptide, GE11-LAMP2B fusion protein is used.

In addition, in order to achieve the purpose of precise delivery, we experimented with a variety of plasmid vector loading schemes, and came up with another optimized scheme: the plasmid vector can also be composed of multiple plasmids with different structures, one of which contains a promoter promoter and targeting tags, other plasmids contain promoters and RNA fragments. Loading the targeting tag and RNA fragment into different plasmid vectors, and injecting the two plasmid vectors into the body, the targeting effect is no worse than the targeting effect produced by loading the same targeting tag and RNA fragment into one plasmid vector .

More preferably, when two different plasmid vectors are injected into the host, the plasmid vector containing the RNA sequence can be injected first, and then the plasmid vector containing the targeting tag can be injected after 1-2 hours, so that a better target can be achieved. to the effect.

The delivery systems described above can all be used in mammals, including humans.

As shown in Figure 1A, in order to understand the distribution of plasmids in the body, we carried out a plate test on mice. 720h) sampling, using the plasmid extracted by spectinomycin for transformation, observing the number of clones in liver, plasma, lung, brain, kidney, spleen, the results are shown in Figure 1B, Figure 1C, Figure 1D, it can be seen that the plasmid It is most distributed in the liver of mice, and reaches the peak at about 3 hours after injection, and is basically metabolized at 12 hours after injection.

The CMV eGFP siRE circuit co-expressing eGFP protein and EGFR siRNA was injected intravenously into C57BL/6J mice. The results are shown in Figure 2. The eGFP fluorescence in the mouse liver gradually increased over time, reaching a peak at about 12 hours. 48 After hours, it dropped to the background level, and no obvious eGFP signal was seen in other tissues.

The control plasmid (CMV-scrR) and the plasmid expressing EGFR siRNA (CMV-siR ^E ) were injected into mice respectively, and the mouse liver cell model was established in vitro, and the mouse liver cells injected with CMV-scrR and CMV-siR ^E were detected respectively. The related siRNA levels in exosomes, the results are shown in Figure 3A, it can be seen that there is siRNA expression in the ^exosomes of mouse hepatocytes injected with CMV-siRNA.

We generally believe that binding to Ago2 protein is a necessary condition for siRNA to function, that is, siRNA in exosomes can bind to Ago2 protein, so we performed Ago2 immunoprecipitation experiments, and the results are shown in Figure 3B and Figure 3C. Among them, Input represents the sample in which the exosomes were directly lysed and detected without immunoprecipitation, representing the positive control.

After intravenous injection of plasmids into mice, the distribution of mature siRNA in different tissues is shown in Figure 4. It can be seen from Figure 4A that the levels of EGFR-siRNA in plasma, exosomes, and exosome-free plasma show time-dependent changes; from Figure 4B, it can be seen that mouse EGFR-siRNAs in the liver, lung, pancreas, and spleen , The accumulation in the kidney is time-dependent.

The mice were injected with control plasmid (CMV-scrR), 0.05mg/kg CMV-siR ^E plasmid, 0.5mg/kg CMV-siR ^E plasmid, 5mg/kg CMV-siR ^E plasmid, and detected the liver, Absolute siRNA (EGFR siRNA) levels in spleen, heart, lung, kidney, pancreas, brain, skeletal muscle, CD4 ⁺ cells, the results are shown in Figure 5A, it can be seen that there is no siRNA expression in the tissues of mice injected with the control plasmid , in each tissue of mice injected with CMV-siR ^E plasmid, the level of siRNA expression was positively correlated with the concentration of CMV-siR ^E plasmid. As shown in Figure 5B, fluorescence in situ hybridization assay (FISH) also confirmed that the level of siRNA expression was positively correlated with the concentration of CMV-siR ^E plasmid, that is, the tissue distribution of EGFR siRNA was dose-dependent.

After the plasmid enters the body, it will express the precursor (Precursor) and then process it into the mature body (siRNA), so we tested the metabolism of the precursor (Precursor) and the mature body (siRNA) in the liver after the plasmid was injected into mice. , the results are shown in Figure 6. It can be seen that the expression levels of precursor (Precursor) and mature body (siRNA) in the mouse liver reached a peak at the time point of 6 hours after the injection of the plasmid. Metabolism of the precursor (siRNA) was complete, and the metabolism of the precursor (Precursor) in the mouse liver was complete 48 hours after the injection of the plasmid.

After injection of exogenous siRNA into the common bile duct of mice, the absolute levels of siRNA in exosome-free plasma (exosome-free), exosome (exosome) and plasma were detected respectively, and the results are shown in Figure 7A. After injection of exogenous siRNA into the common bile duct of mice, the levels of siRNA in the spleen, heart, lung, kidney, pancreas, brain, skeletal muscle, and CD4 ⁺ cells of the mice were detected, and the results are shown in Figure 7B. These two figures reflect that the kinetics of siRNA in different tissues are almost the same, and the distribution of siRNA in different tissues is significantly different.

siRNA with albumin ALB as the promoter, siRNA with CMV as the promoter, and siRNA without any promoter were injected into mice intravenously. The absolute siRNA levels in the mice were detected at 48 h, and the results are shown in Figure 8. It can be seen that the level of siRNA with CMV as the promoter in mice is the highest, that is, the effect of CMV as the promoter is the best.

We observed the inhibition of eGFP levels in mice by self-assembled eGFP siRNA by fluorescence assay. The process is as follows: eGFP transgenic mice were intravenously injected with PBS or 5 mg/kg CMV-siR ^G or CMV-RVG-siR ^G plasmid, and treated for 24 hours After the mice were sacrificed, their eGFP fluorescence levels were detected in cryosections. Figure 9A shows a representative fluorescence microscope image, in which green indicates positive eGFP signal, blue indicates DAPI-stained nuclei, scale bar: 100 μm, CMV is visible - RVG-siR ^G plasmid has a more obvious inhibitory effect on mouse eGFP; eGFP transgenic mice were intravenously injected with PBS or CMV-scrR or CMV-siR ^E plasmid, and the mice were sacrificed after 24 hours of treatment, and they were detected in frozen sections. The fluorescence level of eGFP, Figure 9B is a bar graph of the fluorescence intensity (Fluorescence intensity) of the mouse heart, lung, kidney, pancreas, brain, and skeletal muscle injected with PBS, CMV- ^siRE , and CMV-RVG- ^siRE . It can be seen that, The contrast of fluorescence intensity in liver, spleen, lung and kidney of mice was more obvious.

For the mice injected with PBS, CMV-scrR, and CMV-siR ^E , their alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bilirubin (TBIL), blood urea nitrogen (BUN), serum alkaline phosphatase (ALP), creatinine (CREA) content, thymus weight, spleen weight, and percentage of peripheral blood cells were detected. Comparison of the contents of alanine aminotransferase, aspartate aminotransferase, total bilirubin, blood urea nitrogen, serum alkaline phosphatase, and creatinine in CMV-siR ^E. Figure 10G is a comparison chart of mouse liver, lung, spleen, and kidney tissue, and Figure 10H -I is a comparison chart of mouse thymus and spleen tissue, and FIG. 10J is a comparison chart of percentage in peripheral blood cells of mice.

The results showed that the contents of ALT and AST, as well as the weight of thymus, spleen, and peripheral blood cells of the mice injected with PBS, CMV- ^scrR , and CMV-siRE were almost the same. The mice injected with CMV- ^siRE were similar to those injected with PBS. In contrast, the liver, lung, spleen, and kidney also had no tissue damage.

The above tests are enough to show that the RNA delivery system for the treatment of lung cancer provided in this example uses a plasmid as a carrier and the plasmid as a mature injection. Its safety and reliability have been fully verified, and the drugability is very good. The final effective RNA sequence is packaged and delivered by endogenous exosomes, and there is no immune response, so there is no need to verify the safety of the exosomes. The delivery system can deliver all kinds of small molecule RNAs, and has strong versatility. And the preparation of plasmids is much cheaper and more economical than the preparation of exosomes or proteins, polypeptides and other substances. The RNA delivery system for the treatment of lung cancer provided in this example can be tightly combined with AGO ₂ and enriched into a composite structure (exosome) after self-assembly in vivo, which can not only prevent its premature degradation, but also maintain its circulation in the circulation. It is stable, and facilitates uptake by recipient cells, intracytoplasmic release and lysosomal escape, and requires a low dose.

Example 2

On the basis of Embodiment 1, this embodiment provides a medicine. The medicament comprises a plasmid carrying an RNA capable of treating lung cancer, the plasmid being capable of enriching in the organ tissue of a host, and endogenously and spontaneously forming a plasmid containing the RNA capable of treating lung cancer in the organ tissue of the host. A composite structure with a targeting structure, the composite structure can be used to deliver the RNA capable of treating lung cancer into the lung through the targeting structure, so as to treat the lung cancer.

Further, the RNA capable of treating lung cancer is one or more of siRNA, shRNA and miRNA having medical significance and capable of inhibiting or hindering the development of lung cancer.

See Figure 15-17, Figure 15 is the fluorescence signal statistics after the provided 6 different RNA plasmids treat lung cancer, the 6 RNAs are: siRNA (target gene is EGFR), siRNA ^{T (} target gene is TNC), shR ^E (target gene is EGFR), ^shRT (target gene is TNC), miR-7 (target gene is EGFR), miR-133b (target gene is EGFR); Figure 16 is any 2 of the 6 RNAs provided above Fluorescence signal statistics of 4 groups of plasmids composed of RNA sequences after treatment of lung cancer; Figure 17 is the fluorescence signal statistics of 3 groups of plasmids composed of any 3 RNA sequences of the 6 RNA sequences provided above after treatment of lung cancer.

The specific sequences (precursors) are shown in Table 5 below.

Further, the plasmid includes a promoter sequence and an RNA sequence to be delivered.

Further, the plasmid also includes a targeting tag, and the targeting tag forms the targeting structure of the composite structure in the organ tissue of the host.

Further, the functional structural regions of the plasmid are arranged in any of the following sequences: 5'-promoter-5' flanking sequence-RNA sequence-loop sequence-compensating sequence-3' flanking sequence, 5'-promoter -targeting tag or 5'-promoter-targeting tag-5'flanking sequence-RNA sequence-loop sequence-compensating sequence-3'flanking sequence;

The RNA sequence includes one, two or more specific RNA sequences with medical significance, the RNA sequence can be expressed in the target receptor, and the compensation sequence cannot be expressed in the target receptor.

Further, the plasmid is composed of multiple plasmids with different structures, wherein one plasmid contains a promoter and a targeting tag, and the other plasmids contain a promoter and an RNA sequence.

Further, the organ tissue is liver.

Further, the composite structure is an exosome.

Further, the targeting tag is selected from one of peptides, proteins or antibodies with targeting function, and the targeting structure is located on the surface of the composite structure.

Further, the targeting tag is RVG-LAMP2B fusion protein, or GE11-LAMP2B fusion protein.

Further, the number of RNA effective sequences capable of treating lung cancer is one, two or more.

Further, the delivery system can be used in mammals including humans.

Further, the RNA capable of treating lung cancer is selected from any one or more of the following RNAs: EGFR gene siRNA, KRAS gene siRNA or nucleic acid molecules encoding the above RNAs.

After the drug can be administered orally, inhaled, subcutaneously injected, intramuscularly injected or intravenously injected into the human body, it can be delivered to the target tissue through the RNA delivery system described in Example 1 to exert a therapeutic effect.

The drug can also be used in combination with other lung cancer drugs to enhance the effect of treatment. Such as gefitinib, erlotinib, icotinib, afatinib, etc.

The medicine of this embodiment may also include a pharmaceutically acceptable carrier, which includes but is not limited to diluents, buffers, emulsions, encapsulation agents, excipients, fillers, adhesives, sprays, transdermal absorption Agents, wetting agents, disintegrating agents, absorption enhancers, surfactants, colorants, flavoring agents, adjuvants, desiccants, adsorption carriers, etc.

The dosage forms of the medicine provided in this embodiment can be tablets, capsules, powders, granules, pills, suppositories, ointments, solutions, suspensions, lotions, gels, pastes, and the like.

The medicine provided in this example uses the plasmid as the carrier and the plasmid as the mature injection, and its safety and reliability have been fully verified, and the drugability is very good. The RNA sequence that finally exerts the effect is packaged and delivered by endogenous exosomes, and there is no immune response, so there is no need to verify the safety of the exosomes. The drug can deliver various kinds of small molecule RNAs and has strong versatility. And the preparation of plasmids is much cheaper and more economical than the preparation of exosomes or proteins, polypeptides and other substances. The drug provided by this application can be closely combined with AGO ₂ and enriched into a composite structure (exosome) after self-assembly in vivo, which can not only prevent its premature degradation and maintain its stability in circulation, but also benefit the receptor. Cellular uptake, intracytoplasmic release and lysosomal escape require low doses.

Example 3

On the basis of Embodiment 1 or 2, this embodiment provides an application of an RNA delivery system for treating lung cancer in medicine. Here, it will be specifically explained by the following test.

As shown in Figure 11A, mice were selected, and mice were injected with mouse lung cancer cells (LLC cells), and then the mice were injected with PBS buffer/CMV-scrR/gefitinib/CMV-siR ^E every two days. For treatment, mice were subjected to survival analysis and tumor assessment, respectively, starting on day 30 and ending on day 44.

As shown in FIG. 11B , the horizontal axis represents time, and the vertical axis represents survival rate, and it can be seen from this figure that the survival rate of mice injected with CMV- ^siRE is the highest.

As shown in Figure 11C, the figure shows the 3D modeling of mouse lung tissue based on CT images before and after treatment in mice injected with PBS buffer/CMV-scrR/gefitinib/CMV-siR ^E , As can be seen, the tumors of mice injected with CMV- ^siRE were significantly reduced.

As shown in FIG. 11D , which is a comparison chart of the tumor volume (mm ³ ) of mice injected with PBS buffer/CMV-scrR/gefitinib/CMV- ^siRE before and after treatment, it can be seen that, The tumor volume of mice injected with CMV- ^siRE was significantly reduced. The tumor volume of mice injected with PBS buffer/CMV-scrR/gefitinib not only did not decrease, but also increased to varying degrees.

As shown in Figure 11E, this figure is a western blot comparison of normal mice and mice injected with PBS buffer/CMV-scrR/gefitinib/CMV-siRE. It can be seen that PBS buffer/CMV-scrR/gefitinib was injected Nontinib-treated mice had significantly higher levels of the EGFR gene.

As shown in Figure 11F, the figure is a comparison chart of EGFR miRNA levels in normal mice and mice injected with PBS buffer/CMV-scrR/gefitinib/CMV-siR ^E. It can be seen that PBS buffer/CMV-scrR/ Gefitinib-treated mice had relatively higher levels of EGFR miRNAs.

In conclusion, CMV-siR ^E has a significant therapeutic effect on EGFR-mutated lung cancer.

HE staining and immunohistochemical staining were performed on mice injected with PBS buffer/CMV-scrR/gefitinib/CMV-siR ^E , respectively. The results are shown in Figure 12A-Figure 12B. scrR/gefitinib mice have more expression. The staining areas of EGFR and PCNA in mice were counted. The results are shown in Figure 12C-Figure 12D. It can be seen that the staining areas of EGFR and PCNA in mice injected with CMV- ^siRE are the least, which proves its therapeutic effect on EGFR-mutated lung cancer tumors. most.

As shown in Figure 13A, KRAS ^G12D p53 ^-/- mice were selected, and from the 50th day to the 64th day after inhalation of Adv-Cre, the mice were injected with PBS buffer/CMV-scrR/Gefi every two days The mice were treated with tinib/CMV- ^siRE , and the mice were subjected to survival analysis and tumor assessment, respectively.

As shown in Figure 13B, the horizontal axis represents the time after infection, and the vertical axis represents the survival rate, and it can be seen from this figure that the mice injected with CMV-siR ^K have a higher survival rate.

As shown in Figure 13C, the figure shows the 3D modeling of mouse lung tissue before and after treatment in mice injected with CMV-scrR/CMV-siR ^K. It can be seen that the injection of CMV-siR ^K Can significantly inhibit the growth of lung cancer tumors.

As shown in Figure 13D, which is a comparison of the number of tumors in mice injected with CMV-scrR/CMV-siR ^K before and after treatment, it can be seen that the number of tumors in mice injected with CMV-siR ^K increased significantly more few.

As shown in Figure 13E, the figure is a comparison of the number of tumors (mm ³ ) in mice injected with CMV-scrR/CMV-siR ^K before and after treatment. It can be seen that the tumors in mice injected with CMV-siR ^K Volume growth is slow. The tumor volume of mice injected with CMV-scrR increased significantly.

As shown in Figure 13F, which is a western blot comparison of mice injected with CMV-scrR/CMV-siR ^K , it can be seen that the KRAS gene content of mice injected with CMV-scrR is significantly higher.

As shown in FIG. 13G , which is a comparison of the related KRAS mRNA levels in mice injected with CMV-scrR/CMV-siR ^K , it can be seen that the related KRAS mRNA levels in mice injected with CMV-scrR are relatively high.

In conclusion, CMV-siR ^K has a significant therapeutic effect on KRAS-mutated lung cancer tumors.

HE staining and immunohistochemical staining were performed on mice injected with CMV-scrR/CMV-siR ^K respectively. The results are shown in Figure 14A, Figure 14D, and Figure 14E. It can be seen that KRAS and p-AKT in CMV-scrR-injected mice , p-ERK has more expression and higher percentage of staining. Western blot was used to detect the expression levels of related proteins in mice. The results were shown in Figure 14B and Figure 14C, and the related proteins were more expressed in CMV-scrR-injected mice. This also shows that CMV-siR ^K has a significant inhibitory effect on KRAS-mutated lung cancer tumors.

In this document, "upper", "lower", "front", "rear", "left", "right", etc. are only used to indicate the relative positional relationship between related parts, rather than limit the absolute positions of these related parts .

In this document, "first", "second", etc. are only used to distinguish each other, but do not indicate the degree of importance and order, and the premise of mutual existence.

In this paper, "equal", "same" and the like are not limitations in strict mathematical and/or geometric senses, and also include errors that can be understood by those skilled in the art and allowed by manufacturing or use.

Unless otherwise indicated, numerical ranges herein include not only the entire range between its two endpoints, but also several subranges subsumed therein.

The preferred specific embodiments and embodiments of the present application have been described in detail above in conjunction with the accompanying drawings, but the present application is not limited to the above-mentioned embodiments and embodiments. Various changes are made under the premise of the application concept.

Claims (17)

1. An RNA plasmid delivery system for the treatment of lung cancer, characterized in that the system comprises a plasmid, the plasmid carries an RNA fragment capable of treating lung cancer, the plasmid can be enriched in the organ tissue of the host, and is A complex structure containing the RNA fragment is formed endogenously and spontaneously in the host organ tissue, and the complex structure can deliver the RNA fragment into the lung for the treatment of lung cancer.
2. The RNA plasmid delivery system for treating lung cancer according to claim 1, wherein the RNA fragment comprises one, two or more specific RNA sequences with medical significance, and the RNA sequences are of medical significance siRNA, shRNA or miRNA that can inhibit or hinder the development of lung cancer.
3. The RNA plasmid delivery system for treating lung cancer according to claim 2, wherein the plasmid further comprises a promoter and a targeting tag, and the targeting tag can form the composite structure in the organ tissue of the host The targeting structure is located on the surface of the composite structure, and the composite structure can find and bind to the target tissue through the targeting structure, and deliver the RNA fragment into the target tissue.
4. The RNA plasmid delivery system for the treatment of lung cancer according to claim 3, wherein the plasmid comprises any one of the following lines or a combination of several lines: promoter-RNA fragment, promoter-targeting tag, Promoter-RNA fragment-targeting tag; each of the plasmids includes at least one RNA fragment and one targeting tag, and the RNA fragment and targeting tag are located in the same line or in different lines.
5. The RNA plasmid delivery system for the treatment of lung cancer according to claim 4, wherein the plasmid further comprises a flanking sequence, a compensation sequence and a loop sequence that can make the circuit fold into a correct structure and express, and the flanking sequence Sequences include 5' flanking sequences and 3' flanking sequences;

   The plasmid includes any one of the following lines or a combination of several lines: 5'-promoter-5' flanking sequence-RNA sequence-loop sequence-compensating sequence-3' flanking sequence, 5'-promoter-targeting tag Or 5'-promoter-targeting tag-5'flanking sequence-RNA sequence-loop sequence-compensating sequence-3'flanking sequence.
6. The RNA plasmid delivery system for the treatment of lung cancer according to claim 5, wherein the 5' flanking sequence is ggatcctggaggcttgctgaaggctgtatgctgaattc or a sequence whose homology is greater than 80%;

   The loop sequence is gttttggccactgactgac or a sequence whose homology is greater than 80%;

   The 3' flanking sequence is accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag or a sequence whose homology is greater than 80%;

   The compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-5 bases are deleted.
7. The RNA plasmid delivery system for treating lung cancer according to claim 4, characterized in that, when there are at least two lines in the plasmid, adjacent lines are connected by sequences consisting of sequences 1-3;

   Wherein, sequence 1 is CAGATC, sequence 2 is a sequence consisting of 5-80 bases, and sequence 3 is TGGATC.
8. The RNA plasmid delivery system for treating lung cancer according to claim 7, characterized in that, when there are at least two lines in the plasmid, adjacent lines pass through sequence 4 or have a homology with sequence 4 greater than 80% of the sequences are connected;

   Wherein, sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC.
9. The RNA plasmid delivery system for treating lung cancer according to claim 1, wherein the organ tissue is liver, and the composite structure is exosome.
10. The RNA plasmid delivery system for treating lung cancer according to claim 3, wherein the targeting tag is selected from targeting peptides or targeting proteins with targeting function.
11. The RNA plasmid delivery system for treating lung cancer according to claim 10, wherein the targeting peptide comprises RVG targeting peptide, GE11 targeting peptide, PTP targeting peptide, TCP-1 targeting peptide, MSP targeting peptide targeting peptide;

    The targeting proteins include RVG-LAMP2B fusion protein, GE11-LAMP2B fusion protein, PTP-LAMP2B fusion protein, TCP-1-LAMP2B fusion protein, and MSP-LAMP2B fusion protein.
12. The RNA plasmid delivery system for treating lung cancer according to claim 2, wherein the length of the RNA sequence is 15-25 nucleotides.
13. The RNA plasmid delivery system for treating lung cancer according to claim 12, wherein the RNA capable of treating lung cancer is selected from any one or more of the following RNAs: EGFR gene siRNA, KRAS gene siRNA , or an RNA sequence with more than 80% homology to the above sequence, or a nucleic acid molecule encoding the above RNA.
14. The RNA plasmid delivery system for treating lung cancer according to claim 13, wherein,

    EGFR gene siRNA includes UGUUGCUUCUCUUAAUUCCU, AAAUGAUCUUCAAAAGUGGCC, UCUUUAAGAAGGAAAGAUCAU, AAUAUUCGUAGCAUUUAUGGA, UAAAAAUCCUCACAUAUACUU, other sequences that inhibit EGFR gene expression and sequences with more than 80% homology to the above sequences.

    The siRNA of KRAS gene includes UGAUUUAGUAUUAUUUAUGGC, AAUUUGUUCUCUAUAAUGGUG, UAAUUUGUUCUCUAUAAUGGU, UUAUGUUUUCGAAUUUCUCGA, UGUAUUUUACAUAAUUACACAC, other sequences with inhibiting KRAS gene expression and sequences with more than 80% homology to the above sequences.
15. The RNA plasmid delivery system for treating lung cancer of claim 14, wherein the delivery system is a delivery system for mammals including humans.
16. A use of the RNA delivery system for treating lung cancer according to any one of claims 1-15 in medicine.
17. The application according to claim 16, wherein the medicine is a medicine for treating lung cancer and related diseases, and the administration modes of the medicine include oral, inhalation, subcutaneous injection, intramuscular injection, and intravenous injection.

Images