WO2023138451A1 - Sirna pharmaceutical composition for inhibiting her2 and her3 - Google Patents

Abstract

An siRNA pharmaceutical composition for inhibiting HER2 and HER3, which contains a first siRNA molecule which targets mRNA encoding HER2 and can inhibit the expression of HER2 gene, thereby inhibiting the function of HER2, and a second siRNA molecule which targets mRNA encoding HER3 and can inhibit the expression of HER3 gene, thereby inhibiting the function of HER3. The siRNA pharmaceutical composition can simultaneously inhibit the expressions of HER2 and HER3 genes, thereby inhibiting the proliferation of tumor cells mediated by HER2 and HER3, and inhibiting the growth of various solid tumors such as lung cancer and breast cancer.

Description

siRNA pharmaceutical composition for inhibiting HER2 and HER3 technical field

The invention belongs to the technical field of biomedicine, and in particular relates to an siRNA pharmaceutical composition for inhibiting the activities of HER2 and HER3.

Background technique

According to the latest cancer burden data released by the International Agency for Research on Cancer (IARC) of the World Health Organization, there will be 19.29 million new cases of cancer and 9.96 million deaths in 2020. Among them, lung cancer has the highest mortality rate, with 1.8 million deaths, accounting for 18% of all cancer deaths; the number of breast cancer cases has increased to 2.26 million, accounting for 11.7% of all new cancer patients, officially replacing lung cancer (2.2 million) as the world's largest cancer for the first time, with 680,000 deaths, ranking fifth in the world [Siegel R L, et al. CA: A Cancer Journal for Clinicians 2021; 71:7-33 .].

Lung cancer (lung cancer) is the malignant tumor with the highest morbidity and mortality rate in China, with more than 700,000 new cases each year, accounting for about 17% of all new cancer cases, and about 600,000 deaths, making it the number one cancer killer. Although with the improvement of medical level, surgical methods have been improved, and radiotherapy and chemotherapy drugs and treatment options have increased, the low survival rate of lung cancer patients has not changed. The 5-year survival rate of patients with lung cancer is 21%, which is the lowest among all cancers. Lung cancer can be divided into small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC) according to histopathology. Among them, the incidence rate of NSCLC is relatively high, which can reach 85%. Usually, the disease is diagnosed at an advanced stage, and the case fatality rate is extremely high.

Breast cancer is one of the most common malignant tumors in female cancers, and its incidence rate accounts for 7-10% of all kinds of malignant tumors in the whole body. For women, its incidence rate is second only to uterine cancer, and it has become the main cause of threat to women's health. At present, the cause of breast cancer has not been fully elucidated. In clinical practice, breast cancer can usually be divided into four subtypes: luminal A type, luminal B type, HER2 overexpression type, and triple negative type. For people diagnosed with breast cancer, common treatments include surgery, radiation therapy, chemotherapy, hormone therapy, and targeted therapy. If detected in time, surgery, radiation therapy, chemotherapy and hormone therapy can make breast cancer patients have a high survival rate. However, once the cancer cells metastasize, the survival rate will drop sharply even if the above treatments are implemented. The degree of cancer change determines the treatment effect of breast cancer.

It is well known that the survival and growth of cancer cells depend on some common molecular signaling pathways in cells. Therefore, the treatment of cancer can be achieved by designing corresponding small molecule drugs to block molecular targets that mediate signal transmission.

The human epidermal growth factor receptor (HER/ErbB) family includes four cell surface receptors, EGFR, HER2 (ErbB2), HER3 (ErbB3) and HER4 (ErbB4), all of which are tyrosine kinase receptors (RTKs). r 2011;104:1241-1245.]. Cell signaling is initiated when a ligand (epidermal growth factor, neuregulin, etc.) binds to the extracellular domain. Under normal conditions, these receptors mediate cell division, migration, survival and organ development. When the HER receptor is mutated, the abnormal signal transduction it produces stimulates cell survival and growth, which is related to cancer progression [Paul M D, et al. Chemical Reviews 2019; 119:5881-5921.], and is an important target for tumor therapy.

HER receptors can exist in the form of monomers or dimers, and the main mechanism of its function is to form homologous or heterologous dimers with family members. In the resting state, the HER receptor exists in the form of an inactive monomer, and the structure related to the formation of the dimer is folded inside the monomer molecule to hinder the formation of the dimer; when the receptor binds to the ligand, the receptor is activated after the relevant structural modification, and combines with other receptors to form a homologous or heterodimer. 183].

Among them, HER2 is one of the earliest oncogenes found in human cancer. When HER2 is overexpressed, the autophosphorylation of tyrosine residues in its heterodimer intracellular region leads to the dysregulation of downstream signaling networks, such as the induction of PI3K/Akt, Ras/MAPK, JAK/STAT and other downstream signaling pathways, thereby promoting the growth and survival of tumor cells. HER2 was originally found to be overexpressed in up to 20% of breast cancers [Ménard S, et al. Oncogene 2003; 22:6570-6578.], and has also been found to be overexpressed in subpopulations of many other cancer types, including lung, gastric, esophageal, and colorectal cancers [Cancer G A N. Nature 2012; 487:330-337.].

HER3 is the only HER family member with defective intrinsic activity of tyrosine kinase, and needs to form heterodimers with other HER family receptors, such as HER1 and HER2, to function. Compared with other family members, HER3 is not carcinogenic when overexpressed alone, but HER3 expression has been detected in a variety of cancers, including breast cancer, gastric cancer, lung cancer, pancreatic cancer and skin cancer, etc. High expression of HER3 is also associated with disease progression and/or poor prognosis [Haikala H M, et al. Clinical cancer research 2021,27(13):3528-3539.]. The heterodimer formed by the combination of HER3 and HER2 has the strongest transformation ability among all possible HER receptors. HER3 can synergistically promote HER2-mediated cell transformation and amplify the malignant characteristics of tumors driven by HER2 overexpression. Therefore, HER2/HER3 heterodimer may be the most effective complex for activating downstream pathways [Tzahar E, et al. Molecular and Cellular Biology 1996; 16:5276 -5287.], activate phosphoinositide 3-kinase/protein kinase B (PI3K/Akt) and mitogen-activated protein kinase (MAPK) pathways, and mediate the differentiation, proliferation and migration of cancer cells. Therefore, HER2 and HER3 have become important therapeutic targets for various solid tumors [Vaught DB, et al. Cancer Research 2012; 72:2672.].

HER2 was first targeted by the monoclonal antibody trastuzumab, which binds to the extracellular domain IV of HER2 to prevent the attachment of human epidermal growth factor to HER2, thereby inhibiting downstream signaling. Although trastuzumab can significantly improve survival in HER2-positive breast cancer, many patients develop resistance after receiving trastuzumab for a period of time, mainly because trastuzumab does not block the heterodimerization of HER2 formation. In this context, Pertuzumab was developed as another HER2-specific humanized antibody, which can bind to the extracellular domain II of HER2 and inhibit the formation of heterodimer complexes between HER2 and other receptors, such as HER3, thereby inhibiting multiple HER signaling pathways. At present, the combination of trastuzumab and pertuzumab has been clinically used, which can produce a more comprehensive blockade of the HER2 signaling pathway, thereby blocking the survival of cancer cells. Although the addition of trastuzumab to chemotherapy significantly prolongs the survival of patients with HER2-overexpressing gastric cancer, trastuzumab is very expensive, and taking trastuzumab can seriously affect the patient's heart and reproductive function. After the failure of trastuzumab, lapatinib, pertuzumab, T-DM1 and other drugs were developed and used, but the use of these drugs will cause certain side effects, such as cardiotoxicity and liver toxicity. Therefore, there is an urgent need to develop more effective targeted therapy drugs to meet the current unmet clinical needs.

The development of tumor drugs targeting HER3 alone has not been smooth, with a failure rate as high as 52%. No new drug has been approved for marketing. Because of its low binding force, it is not as good as the intrinsic kinase activity of other family receptor members, and there is no suitable biomarker that reflects the activation of HER3 in patients (effective patient screening cannot be achieved), which brings great difficulties to drug development. Studies on the underlying mechanism of HER3 have shown that EGFR/HER2-TKI resistance caused by HER3 expression is an important reason for the failure of related cancer treatments. Therefore, the exploration of anti-HER3 therapy focuses on combination therapy. Currently, drugs targeting HER3 are used in combination with other drugs. Patritumab is a fully human antibody targeting HER3, which inhibits the binding of HER3 ligands to inhibit downstream signaling. Patritumab combined with trastuzumab (HER2 monoclonal antibody) and paclitaxel has an overall response rate of 39% in patients with HER2-positive breast cancer [Hirofumi Mukai, et al. Cancer Sci. 2016; 107(10): 1465-1470], and NG33, a targeted antibody drug that can induce HER3 degradation, has also been shown to inhibit the growth of HER2-driven cancer cells [Nadège Gaborit, et al. PNAS, 2015;112(3):839-844].

Contents of the invention

The purpose of the present invention is to provide a siRNA pharmaceutical composition that can simultaneously target and silence the mRNA encoding HER2 and the mRNA encoding HER3, achieve the effect of synergistically inhibiting the activity of HER2 and HER3, mediate the inhibition of tumor cell proliferation and promote tumor cell apoptosis, and inhibit the growth of various solid tumors such as lung cancer and breast cancer.

For above-mentioned defective of prior art, the technical scheme that the present invention takes is:

An siRNA pharmaceutical composition for inhibiting HER2 and HER3, comprising a first siRNA molecule targeting HER2-encoding mRNA and capable of inhibiting HER2 gene expression, thereby inhibiting HER2 function (referred to as HER2 siRNA in the present invention), and a second siRNA molecule targeting HER3-encoding mRNA, capable of inhibiting HER3 gene expression, thereby inhibiting HER3 function (referred to as HER3 siRNA in the present invention).

Wherein, the sequence of the first siRNA molecule is:

Sense strand: 5'-AUCCAGGAGUUUGCUGGCUGCAAGA-3',

Antisense strand: 5'-UCUUGCAGCCAGCAAAACUCCUGGAU-3',

The sequence of the second siRNA molecule is:

Sense strand: 5'-GUUUGGGAGUUGAUGACCUUCGGGG-3',

Antisense strand: 5'-CCCCGAAGGUCAUCAACUCCCAAAC-3'.

According to an embodiment of the present invention, the feeding molar ratio of the first siRNA molecule and the second siRNA molecule may be 1:3˜3:1.

Preferably, the molar ratio of the first siRNA molecule to the second siRNA molecule is 1:1.

The second aspect of the present invention provides an siRNA pharmaceutical preparation, which includes the above-mentioned siRNA pharmaceutical composition, and a drug carrier or other pharmaceutically acceptable carrier for delivering the siRNA pharmaceutical composition to a desired lesion site.

According to one embodiment of the present invention, the drug carrier is a histidine-lysine branched polypeptide polymer (HKP).

According to one embodiment of the present invention, the above-mentioned histidine-lysine branched polypeptide polymer is H3K4b or H3K(+H)4b.

According to one embodiment of the present invention, the N/P mass ratio of the above-mentioned histidine-lysine branched polypeptide polymer and the above-mentioned siRNA pharmaceutical composition may be 1.5:1˜6:1.

Preferably, the N/P mass ratio of the histidine-lysine branched polypeptide polymer and the siRNA pharmaceutical composition may be 2:1˜4:1.

According to one embodiment of the present invention, the above-mentioned siRNA drug preparation is nanoparticles.

Preferably, the average particle diameter of the nanoparticles is 50-150 nm.

According to one embodiment of the present invention, the above-mentioned siRNA pharmaceutical preparation is a lyophilized powder preparation.

The third aspect of the present invention provides a method for preparing the above-mentioned siRNA pharmaceutical preparation, comprising mixing the siRNA pharmaceutical composition with the above-mentioned pharmaceutical carrier or other pharmaceutically acceptable carriers to form the above-mentioned siRNA pharmaceutical preparation.

Preferably, the above-mentioned siRNA pharmaceutical preparation can be assembled by vortexing, microfluidic technology or other mixing methods.

Specifically, a microfluidic instrument can be used to drain the above siRNA pharmaceutical composition and the above pharmaceutical carrier or other pharmaceutically acceptable carriers to a micro mixing device for mixing through a flow control system, and then obtain the above siRNA pharmaceutical preparation through a bottling freeze-drying procedure.

Preferably, the pharmaceutical preparation can be freeze-dried powder or injection, which can be administered locally through muscle, subcutaneous, endothelial, intratumoral, microneedle, injection or perfusion, or intravenous injection.

The fourth aspect of the present invention provides the application of the above-mentioned siRNA pharmaceutical composition or the above-mentioned siRNA pharmaceutical preparation in the treatment of solid tumors, wherein the solid tumors include one or more of breast cancer, lung cancer, gastric cancer, esophageal cancer, and colorectal cancer.

Preferably, the above-mentioned siRNA pharmaceutical composition and/or the above-mentioned siRNA pharmaceutical preparation are especially suitable for the treatment of lung cancer and/or breast cancer.

The fifth aspect of the present invention provides a method for treating cancer in a subject, the treatment method comprising administering an effective amount of the siRNA pharmaceutical composition or the siRNA pharmaceutical preparation to the subject.

Preferably, the cancer is breast cancer or lung cancer.

Preferably, the siRNA pharmaceutical composition or the siRNA pharmaceutical preparation is administered locally through muscle, subcutaneous, endothelial, intratumoral, microneedle, injection or perfusion, or intravenous injection.

Preferably, the subject is a mammal.

Further preferably, the subject is human.

Implementation of the present invention has at least the following beneficial effects:

The present invention uses nucleic acid interference technology to provide an siRNA pharmaceutical composition for inhibiting HER2 and HER3. The siRNA pharmaceutical composition can simultaneously inhibit the expression of target genes encoding HER2 and HER3 and produce a synergistic effect, thereby effectively inhibiting tumor cell proliferation and effectively inhibiting the growth of various solid tumors such as lung cancer and breast cancer.

Description of drawings

Figure 1. Molecular composition of the pharmaceutical composition. The composition contains two siRNA molecules, HER2 siRNA and HER3 siRNA, which are designed according to the principle of human and mouse homology.

Figure 2. The first round of screening of effective siRNA molecular sequences against HER2 target genes in the breast cancer MCF-7 cell line. It can be seen that after treatment with HER2 siRNAs of different sequences, the expression levels of the target gene HER2 in MCF-7 cells decreased to varying degrees. Among them, after transfection with siHER2-1 (#1), siHER2-3 (#3), siHER2-4 (#4), siHER2-6 (#6), siHER2-7 (#7), and siHER2-11 (#11), the relative expression levels of HER2 genes were significantly increased. decrease (pointed by the arrow).

Figure 3. A second round of screening of siRNA molecular sequences targeting HER2 target genes in pancreatic cancer BxPC3 cell line (Figure 3-A) and liver cancer HepG2 cell line (Figure 3-B). It can be seen that in BxPC3 cells (Figure 3-A), the inhibitory effect of candidate HER2 siRNA on HER2 gene was not significant; in HepG2 cells (Figure 3-B), the inhibitory effect of siHER2-3 and siHER2-11 among candidate HER2 siRNAs on HER2 gene was significant. Therefore, combining the inhibitory effect of siRNA on HER2 gene in HepG2 cells and MCF-7 cells, it can be seen that siHER2-3 has the best effect of silencing HER2 gene.

Figure 4. The first round of screening for effective siRNA molecular sequences against HER3 target genes in the breast cancer MCF-7 cell line. It can be seen that after MCF-7 cells were transfected with siHER3-1(#1), siHER3-3(#3), siHER3-7(#7), siHER3-8(#8), siHER3-9(#9), siHER3-10(#10), the relative expression level of HER3 gene was significantly decreased (arrows).

Figure 5. A second round of screening of siRNA molecular sequences against HER3 target genes in pancreatic cancer BxPC3 cell line (Figure 5-A) and liver cancer HepG2 cell line (Figure 5-B). It can be seen that in HepG2 cells (Figure 5-B), the inhibitory effect of candidate HER3 siRNA on HER3 gene is not significant; in BxPC3 cells (Figure 5-A), the inhibitory effect of siHER3-1 (#1) and siHER3-8 (#8) among candidate HER3 siRNAs on HER3 gene is significant. Therefore, considering the inhibitory effects of candidate siRNAs on HER3 gene in BxPC3 cells and MCF-7 cells, it can be seen that siHER3-8 (#8) has the best silencing effect on HER3 gene.

Figure 6. In MCF-7 cells, the tumor cell-killing activity of the composition composed of HER2 siRNA (siHER2-3) and HER3 siRNA (siHER3-8) (Figure 6-A), and its inhibitory effect on apoptosis genes (Figure 6-B, Figure 6-C). It can be seen that after siHER2-3&siHER3-8 treatment, the cell viability of MCF-7 cells was inhibited (Figure 6-A), and the relative expression level of the apoptosis marker gene, Bax gene, was significantly increased (Figure 6-B), but the relative expression level of Bcl-2 gene did not change significantly (Figure 6-C).

Figure 7. In NCl-H23 and A549 lung cancer cell lines, HER2 siRNA and HER3 siRNA have certain inhibitory effects on the viability of NCl-H23 and A549 cells when used alone.

Figure 8. Inhibitory effect of HER2 siRNA and HER3 siRNA combined on cell viability and concentration effect in A549 lung cancer cell line. It can be seen that different concentrations of siHER2-3 & siHER3-8 all have significant killing effects on cell A549, indicating that siHER2-3 and siHER3-8 can also effectively kill tumor cells in vitro when used in combination.

Figure 9. The results of the combination of HER2 siRNA and HER3 siRNA inhibiting the invasion and spread of A549 tumor cells in vitro. It can be seen that the HER2 siRNA and HER3 siRNA compositions have the ability to significantly inhibit the invasion and proliferation of lung cancer cells.

Figure 10. The results of the combination of HER2 siRNA and HER3 siRNA inhibiting the invasion and spread of MCF-7 tumor cells in vitro. It can be seen that the HER2 siRNA and HER3 siRNA compositions have the ability to significantly inhibit the invasion and spread of breast cancer cells.

Figure 11. The composition of HER2 siRNA and HER3 siRNA is assembled with histidine-lysine branched polypeptide polymer to form a particle size diagram of nano-preparation. The results show that the average particle size of the nanoparticles is 81.02nm, which meets the expected requirements.

Figure 12. Tumor volume change chart (intratumoral injection administration), showing the average tumor volume (mean ± standard deviation) during the study of the A549 cell xenograft mouse tumor model in the siHER2-3 and siHER3-8 composition groups, the GFP-NC/siNC negative control group and the tumor model group.

Figure 13. Tumor weight change chart (intratumoral injection administration), showing the average tumor weight (mean ± standard deviation) on the 21st day after administration of A549 cells in the siHER2-3 and siHER3-8 composition groups, the GFP-NC/siNC negative control group and the tumor model group in the mouse tumor model.

Figure 14. H&E staining of tumor tissue in animal experiments (intratumoral injection). It can be seen that the HER2 siRNA and HER3 siRNA compositions can promote tumor cell apoptosis and have a better ability to inhibit tumor cells.

Figure 15. Tumor volume change chart (intravenous injection), showing the average tumor volume (mean ± standard deviation) of the siHER2-3 and siHER3-8 composition groups, NC negative control group and tumor model group A549 cell xenograft mouse tumor model study.

Figure 16. Tumor weight change diagram (intravenous injection administration), showing the average tumor weight (mean ± standard deviation) after the administration of A549 cells in the siHER2-3 and siHER3-8 composition groups, NC negative control group and tumor model group in the mouse tumor model after the observation period.

Figure 17. H&E staining of tumor tissue in animal experiments (intravenous injection).

Detailed ways

Specific embodiments of the present invention will be described in detail below in conjunction with the accompanying drawings. It should be understood that the specific embodiments described here are only used to illustrate and explain the present invention, but not to limit the present invention in any way.

Characterization of Nucleic Acid Interference as a Specific Therapeutic Technique

In recent years, nucleic acid interference (RNA interference, RNAi) has been more and more widely used in gene silencing and drug development because of its strong specificity, small side effects, and easy synthesis. RNAi is a biological process in which a small interfering molecule double-stranded RNA (siRNA) silences gene expression by degrading the target gene messenger RNA molecule (mRNA). This siRNA generally has only about 21 nucleotides. After combining with the RNA-induced silencing complex (RISC) in the cytoplasm, the siRNA unwinds into a single strand, and the sense strand in the double strand is removed, leaving the antisense strand. Pairs combine. After RISC binds to mRNA, Argonaute endoribonuclease cleaves mRNA, promotes mRNA degradation, and prevents it from being translated into protein, thereby achieving the inhibition of specific gene expression.

Nucleic acid interference for tumor therapy has the advantages of highly specific gene silencing, wide indications, clear targets, strong drug resistance, short development cycle, and low cost. Oncogenes, tumor suppressor gene mutations, and other genes involved in tumor progression are good targets for nucleic acid interference-based therapies for tumor progression involving multiple gene pathways in various cells. Simultaneous inhibition of multiple genes is an effective approach to treating tumors and may reduce resistance to multiple chemotherapeutic drugs. Nucleic acid interference therapy can be used to target functional carcinogenic molecules, drug resistance caused by anti-tumor chemotherapy and radiotherapy, etc., which facilitates the development of genome-based personalized drugs and more effective control of tumor growth.

The active ingredients of nucleic acid interference drugs are small interfering nucleic acids, which are RNA double-stranded molecules with a length of 25 base pairs. Like other nucleic acid molecules, they behave as negatively charged polyacids in solution (the acidity of the phosphate group exceeds the weak basicity of the base), which can combine with positively charged molecules to form complexes. In addition, the base in the nucleic acid molecule has a conjugated double bond and has a specific absorption peak at 260nm in the ultraviolet spectrum. This feature can be used to determine its content, and the purity of the sample can be determined by calculating the ratio of A260/A280. In addition to changing the chemical stability of nucleic acid molecules due to the action of acid, alkali or organic solvents, the difference from other small molecule chemical drugs is that small interfering nucleic acid molecules are easily degraded by RNases in vivo and in vitro.

Physicochemical Properties of Lysine-Histidine Polypeptide (HKP) and Interaction with Its Active Component Small Interfering Nucleic Acid

A large number of research work and successful clinical application have confirmed that siRNA is becoming a breakthrough new class of drugs. The research results fully show that siRNA can effectively inhibit the expression level of target genes both in vivo and in vitro. But naked siRNAs are easily degraded. The current solution is divided into two aspects: one way is to directly chemically modify the DNA or RNA molecules that mediate RNAi, so that they can resist the degradation of DNase or RNase. Another approach is to use polymer materials to protect nucleic acid molecules, which is the so-called Drug Delivery System (DDS). Different research groups often use certain physical and chemical properties of nucleic acid molecules to select unique materials according to their own technical expertise. Appropriate delivery methods can not only protect nucleic acid molecules from degradation, but also prolong the half-life of drugs in the blood circulation, or target the delivery of drugs to enrich them in local lesions, thereby reducing the dosage of drugs and prolonging the interval of administration.

On the basis of years of scientific research results, the inventor screened out a polypeptide molecule HKP that can effectively carry small interfering nucleic acids in vitro and in vivo, which is formed by condensation of histidine and lysine in a certain order. Through hydrogen bonding and electrostatic attraction, HKP polypeptide molecules and siRNA molecules can automatically combine in aqueous solution to form nanoparticles of a certain size - Polypeptide Nano-Particles (PNP, Polypeptide Nano-Particles), and then effectively complete the delivery task of small interfering nucleic acid molecules in vivo. The relative combination ratio of the two, preparation formulation process, mixing process and lyophilization method will affect the size of the nanoparticles of the complex formed and the Zeta-potential on the surface, which in turn will affect the preparation quality of the complex, the reconstitution efficiency of the lyophilized powder, and the efficiency of entering cells. The existing preclinical and clinical trial data of polypeptide nucleic acid nano (PNP) drugs show that the in vivo introduction technology of PNP has broad clinical application prospects.

The inventors have tested the efficacy of this kind of PNP nano-medicine on various animal models, including various nude mice and human xenograft tumor models for systemic administration; the application of the mouse experimental model of pulmonary and tracheal administration in the prevention and treatment of SARS virus, and the application in the treatment of hepatic and pulmonary fibrosis mouse models; and the data of a series of preliminary pharmacodynamic experiments conducted by the present invention on mouse models further prove that this candidate drug can become a new type of PNP drug for the treatment of solid tumors such as lung cancer and breast cancer.

The pharmaceutical active ingredient siRNA in the composition of the present invention is a double-stranded RNA molecule with a length of 25 base pairs. One of the characteristics of RNA molecules is that they are easily degraded by RNases. Therefore, under the premise of protecting the small interfering nucleic acid molecules from degradation, the use of drug carriers can also make the siRNA reach a medicinal concentration and a clinically feasible half-life in vivo. Through experimental research results, HKP was selected as a carrier for siRNA drug in vivo application. HKP is composed of histidine and lysine, a positively charged branched polypeptide molecule with a molecular weight of 9542KD. HKP and siRNA can spontaneously form complex particles in aqueous solution. The formed particle complex can not only protect the siRNA molecules, but also promote the entry of the siRNA molecules into cells. Another notable feature of the composition is its biodegradability. Both siRNA and HKP are biological macromolecules, and there are extensive biological mechanisms to degrade them in the body. siRNA is easily degraded in vivo into phosphate, pentose sugar and base, etc., which make up RNA molecules, and the final degradation products of HKP will be lysine residues and histidine residues.

Pharmaceutical composition and pharmaceutical preparation for treating solid tumors such as lung cancer and breast cancer

The pharmaceutical composition of the present invention comprises a siRNA inhibiting HER2 activity and an siRNA inhibiting HER3 activity. The siRNA pharmaceutical preparation includes the above pharmaceutical composition, and a cationic polypeptide nano-import carrier or its corresponding preparation auxiliary materials for delivering siRNA molecules to expected lesion sites. The active pharmaceutical ingredient of the pharmaceutical preparation is a small interfering nucleic acid, and its pharmaceutical action mechanism is to knock down the mRNA expression level of a target gene. At the same time, the HKP polypeptide molecule (histidine-lysine copolymer) as a small interfering nucleic acid molecule carrier can form a complex with the small interfering nucleic acid molecule in aqueous solution, thereby protecting the small interfering nucleic acid molecule from nuclease (RNase) degradation and improving the efficiency of the small interfering nucleic acid molecule entering cells. Since the physical and chemical properties of the composition are directly related to the combination ratio of the small interfering nucleic acid molecules and the HKP molecules, it is first necessary to determine the mixing ratio of the small interfering nucleic acid molecules and the HKP molecules. In the present invention, the N/P mass ratio of HKP molecules and siRNA molecules is 1.5:1-6:1, the N/P mass ratio of HKP molecules and siRNA molecules is most preferably 2:1-4:1, and the histidine-lysine branched polypeptide polymer is H3K4b. Secondly, the small interfering nucleic acid molecule in the composition consists of two sequences targeting HER2 and HER3 respectively. In the present invention, the optimal molar ratio of the two sequences targeting HER2 and HER3 is 1:1.

Methods of using the pharmaceutical composition

The composition of the pharmaceutical composition is determined through a series of optimization and screening work. In the in vitro cell experiment, the nanocomplex formed by the combination of selected siRNA molecules and Lipofectamine ^TM 2000 was transfected into pancreatic cancer cell BxPC3, and the knockdown efficiency of the small interfering nucleic acid target gene was determined by comparing the knockdown efficiency of the target gene, and the effect of the selected siRNA combination on inhibiting tumor growth was determined by comparing the viability of lung cancer cells after transfection of siRNA. Second, the effect of the concentrations of the two siRNA molecules on gene expression levels was analyzed. From the in vitro results, HER2 + HER3 have similar knockdown effects on target genes under different concentration effects, and both have significant killing effects on tumor cells. Furthermore, the inhibitory effect of the selected siRNA molecules on the invasion and spread of lung cancer cells and breast cancer cells was measured, and it can be seen that the selected siRNA molecules can effectively inhibit the invasion and spread of tumor cells. Finally, in the in vivo animal experiment, the nano-preparation formed by mixing the selected siRNA molecule with the lysine-histidine polypeptide nano-importing carrier HKP was injected into the mouse model through intratumoral injection and intravenous injection. According to the results of tumor volume, weight, and section staining, it was found that its therapeutic effect in the in vivo test was better. Based on the above results, the two small interfering nucleic acids against HER2 and anti-HER3 in the prescription of the composition can well inhibit tumor growth.

The indication of the composition here is the treatment of various tumors, including the detection of in vitro cell killing activity on breast cancer and lung cancer cells, and the in vivo pharmacodynamics research using the subcutaneous xenograft tumor model established by the lung cancer cell line, so as to determine the in vivo and in vitro anti-tumor activity of the siRNA composition of the present invention.

specific embodiment

Example 1. Pharmaceutical composition screening

As shown in Figure 1, the siRNAs targeting HER2 mRNA and HER3 mRNA are designed based on the homologous gene sequences of humans and mice, and the siRNA sequences are consistent with the gene sequences of humans and mice.

(1) Screening of siRNA molecules targeting HER2 target genes

The molecular sequences of siRNA targeting HER2 gene expression are shown in Table 1.

Table 1. Sequences of siRNAs targeting HER2 gene expression

siRNA	Sense Strand (5'-3')	SEQ ID No.	Antisense strand (5'-3')	SEQ ID No.
siHER2-1	CAAUAUCCAGGAGUUUGCUGGCUGC	1	GCAGCCAGCAAACUCCUGGAUAUUG	13
siHER2-2	AUAUCCAGGAGUUUGCUGGCUGCAA	2	UUGCAGCCAGCAAAACUCCUGGAUAU	14
siHER2-3	AUCCAGGAGUUUGCUGGCUGCAAGA	3	UCUUGCAGCCAGCAAAACUCCUGGAU	15
siHER2-4	CCAGGAGUUUGCUGGCUGCAAGAAG	4	CUUCUUGCAGCCAGCAAAACUCCUGG	16
siHER2-5	AGGAGUUUGCUGGCUGCAAGAAGAU	5	AUCUUCUUGCAGCCAGCAAAACUCCU	17
siHER2-6	GGAGUUUGCUGGCUGCAAGAAGAUC	6	GAUCUUCUUGCAGCCAGCAAACUCC	18
siHER2-7	AGUUUGCUGGCUGCAAGAAGAUCUU	7	AAGAUCUUCUUGCAGCCAGCAAACU	19
siHER2-8	GUUUGCUGGCUGCAAGAAGAUCUUU	8	AAAGAUCUUCUUGCAGCCAGCAAAC	20
siHER2-9	UUGCUGGCUGCAAGAAGAUCUUUGG	9	CCAAAGAUCUUCUUGCAGCCAGCAA	twenty one
siHER2-10	GCUGGCUGCAAGAAGAUCUUUGGGA	10	UCCCAAAGAUCUUCUUGCAGCCAGC	twenty two
siHER2-11	UGGCUGCAAGAAGAUCUUUGGGAGC	11	GCUCCCAAAGAUCUUCUUGCAGCCA	twenty three
siHER2-12	GGCUGCAAGAAGAUCUUUGGGAGCC	12	GGCUCCCAAAGAUCUUCUUGCAGCC	twenty four

①The breast cancer MCF-7 cell line was used to conduct the first round of screening for the 12 siRNA molecules designed and synthesized against HER2 target genes:

Human breast cancer MCF-7 was inoculated on a 12-well plate with DMEM complete medium containing 10% peptide bovine serum at a seeding density of 2-5×10 ⁵ cells/well, 1 mL of medium per well, and cultured overnight at 37°C. The cell culture medium in the 12-well plate was aspirated, and 0.5 mL of serum-free RPMI-1640 or DMEM medium was added to each well.

Dilute 2 μL of 20 μM siRNA to be screened in 200 μL of Opti-MEM serum-free medium and mix gently; dilute 2 μL of Lipofectamine ^TM 2000 (Invitrogen) (hereinafter referred to as Lipo2000) in 200 μL of Opti-MEM serum-free medium, mix well and incubate at room temperature for 5 minutes; mix the diluted siRNA and diluted Lipo2000 and mix gently , room temperature for 20 minutes in order to form nanocomposites. The transfection groups include: (a) HER2 siRNA transfection experimental group; (b) blank control group with only Lipo2000 added.

Then transfection was carried out. For the HER2 siRNA transfection experiment group, 400 μL of the above mixed solution was added to each well of the 12-well plate inoculated with MCF-7 cells, and the final concentration of siRNA was about 100 nM. The cells were cultured at 37°C for 4-6 hours, then 1 mL of RPMI-1640 or DMEM complete medium containing 10% peptide bovine serum was added to each well, and cultured at 37°C for 24-48 hours.

The transfection of Lipo2000, siHER2-1(#1), siHER2-2(#2), siHER2-3(#3), siHER2-4(#4), siHER2-5(#5), siHER2-6(#6), siHER2-7(#7), siHER2-8(#8), siHER2- 9(#9), siHER2-10(#10), siHER2-11(#11), siHER2-12(#12) the expression of HER2 mRNA in MCF-7 cells.

The specific steps of PCR are: use M5 Hiper Universal RNA Mini Kit (Tissue/Cellular RNA Rapid Extraction Kit, Beijing Polymer Biotechnology Co., Ltd., Cat. No. MF036-01) to extract total RNA in MCF-7 cells; take 0.5 μg of total RNA and reverse transcribe to obtain cDNA according to the method used in the reverse transcription kit (Beijing Polymer Biotechnology Co., Ltd., Cat. No. MF012-01). Using 2x Hiper Realtime PCR Super mix (Beijing Jumei Biotechnology Co., Ltd., Cat. No. MF013-01) kit, cDNA was used as a template to detect the expression level of HER2 mRNA according to the instructions. Wherein, the PCR primers used to amplify HER2 and GADPH as an internal reference gene are shown in Table 2.

Table 2, PCR primers for amplifying HER2, HER3 and GADPH as internal reference gene

gene name	Upstream primer (5'→3')	Downstream primer (5'→3')
hHER2	GGTGGATGCTGAGGAGTATCTA	GCTGGTTCACATATTCCTGGT
hHER3	CCCAGGTCTACGATGGGAAG	ACACCCCCTGACAGAATCTC
Human β-actin	ACAGAGCCTCGCCTTTGCC	GAGGATGCCTCTCTTGCTCTG

The expression level of HER2 mRNA in MCF-7 cells is shown in Figure 2. It can be seen from the figure that after MCF-7 cells were transfected with siHER2-1, siHER2-3, siHER2-4, siHER2-6, siHER2-7, and siHER2-11, the relative expression level of HER2 gene was significantly reduced (pointed by the arrow). Therefore, these 6 siRNA molecules were selected for the second round of screening.

②The second round of screening of siHER2-1, siHER2-3, siHER2-4, siHER2-6, siHER2-7, and siHER2-11 was performed using pancreatic cancer BxPC3 cell line and liver cancer HepG2 cell line:

The difference from the first round of screening is that the breast cancer MCF-7 cell line was replaced by pancreatic cancer BxPC3 cell line and liver cancer HepG2 cell line, and the expression of HER2 mRNA in BxPC3 cells and HepG2 cells transfected with Lipo2000, siHER2-1, siHER2-3, siHER2-4, siHER2-6, siHER2-7, and siHER2-11 were detected by real-time fluorescent quantitative PCR. Wherein, the PCR primers used to amplify HER2 and GADPH as an internal reference gene are shown in Table 2. The results are shown in Figure 3. It can be seen from the figure that after transfection of candidate HER2 siRNA, in BxPC3 cells (Figure 3-A), the inhibitory effect of candidate HER2 siRNA on HER2 gene was not significant; in HepG2 cells (Figure 3-B), the inhibitory effect of siHER2-3 and siHER2-11 in candidate HER2 siRNA on HER2 gene was significant. Therefore, combining the inhibitory effect of siRNA on HER2 gene in HepG2 cells and MCF-7 cells, it can be seen that siHER2-3 has the best silencing effect on HER2 gene.

(2) Screening of siRNA molecules against HER3 target genes

The molecular sequences of siRNA targeting HER3 gene expression are shown in Table 3.

Table 3. Sequences of siRNAs targeting HER3 gene expression

siRNA	Sense Strand (5'-3')	SEQ ID No.	Antisense strand (5'-3')	SEQ ID No.
siHER3-1	UUUGGGAGUUGAUGACCUUCGGGGC	25	GCCCCGAAGGUCAUCAACUCCCAAAA	37
siHER3-2	UUGGGAGUUGAUGACCUUCGGGGCA	26	UGCCCCGAAGGUCAUCAACUCCCAA	38
siHER3-3	GGGAGUUGAUGACCUUCGGGGCAGA	27	UCUGCCCCGAAGGUCAUCAACUCCC	39
siHER3-4	GGAGUUGAUGACCUUCGGGGCAGAG	28	CUCUGCCCCGAAGGUCAUCAACUCC	40

siHER3-5	AGUUGAUGACCUUCGGGGCAGAGCC	29	GGCUCUGCCCCGAAGGUCAUCAACU	41
siHER3-6	UUGAUGACCUUCGGGGCAGAGCCCU	30	AGGGCUCUGCCCCGAAGGUCAUCAA	42
siHER3-7	UGAUGACCUUCGGGGCAGAGCCCUA	31	UAGGGCUCUGCCCCGAAGGUCAUCA	43
siHER3-8	GUUUGGGAGUUGAUGACCUUCGGGG	32	CCCCGAAGGUCAUCAACUCCCAAAC	44
siHER3-9	GAUGAGGAGUAUGAAUACAUGAACC	33	GGUUCAUGUAUUCAUACUCCUCAUC	45
siHER3-10	AUGAGGAGUAUGAAUACAUGAACCG	34	CGGUUCAUGUAUUCAUACUCCUCAU	46
siHER3-11	UGAGGAGUAUGAAUACAUGAACCGG	35	CCGGUUCAUGUAUUCAUACUCCUCA	47
siHER3-12	GAGGAGUAUGAAUACAUGAACCGGA	36	UCCGGUUCAUGUAUUCAUACUCCUC	48

①The breast cancer MCF-7 cell line was used to conduct the first round of screening for the 12 siRNA molecules designed and synthesized against HER3 target genes:

The difference between the first round of screening for siRNA molecules targeting HER3 target genes and the first round of screening for siRNA molecules targeting HER2 target genes is that the siRNA molecules targeting HER3 target genes are used to replace the siRNA molecules targeting HER2 target genes.

Detection of transfected Lipo2000, siHER3-1(#1), siHER3-2(#2), siHER3-3(#3), siHER3-4(#4), siHER3-5(#5), siHER3-6(#6), siHER3-7(#7), siHER3-8(#8), siHER3-9(#9), siHER3-1 by real-time fluorescent quantitative PCR 0 (#10), siHER3-11 (#11), and siHER3-12 (#12) MCF-7 cells expressed HER3 mRNA. Wherein, the PCR primers used to amplify HER3 and GADPH as an internal reference gene are shown in Table 2. The results are shown in Figure 4. It can be seen from the figure that after the MCF-7 cells were transfected with siHER3-1, siHER3-3, siHER3-7, siHER3-8, siHER3-9, and siHER3-10, the relative expression level of the HER3 gene was significantly reduced (pointed by the arrow). Therefore, these 6 siRNA molecules were selected for the second round of screening.

②The second round of screening of siHE3-1, siHER3-3, siHER3-7, siHER3-8, siHER3-9, and siHER3-10 was performed using pancreatic cancer BxPC3 cell line and liver cancer HepG2 cell line:

The difference from the first round of screening is that the breast cancer MCF-7 cell line was replaced by pancreatic cancer BxPC3 cell line and liver cancer HepG2 cell line, and the expression of HER3 mRNA in BxPC3 cells and HepG2 cells transfected with Lipo2000, siHER3-1, siHER3-3, siHER3-7, siHER3-8, siHER3-9, siHER3-10 were detected by real-time fluorescent quantitative PCR. Wherein, the PCR primers used to amplify HER3 and GADPH as an internal reference gene are shown in Table 2. The results are shown in Figure 5. It can be seen from the figure that after transfection of the candidate HER3 siRNA, in HepG2 cells (Figure 5-B), the inhibitory effect of the candidate HER3 siRNA on the HER3 gene was not significant; in BxPC3 cells (Figure 5-A), the inhibitory effect of siHER3-1 and siHER3-8 of the candidate HER3 siRNA on the HER3 gene was significant. Therefore, combining the inhibitory effect of candidate siRNA on HER3 gene in BxPC3 cells and MCF-7 cells, it can be seen that siHER3-8 has the best silencing effect on HER3 gene.

According to the screening results of the pharmaceutical composition, two molecules, siHER2-3 and siHER3-8, were selected for administration in vitro to treat breast cancer and lung cancer.

Example 2. The inhibitory effect of the pharmaceutical composition on intracellular apoptosis genes

This example is used to detect the expression levels of Bcl-2 mRNA and Bax mRNA in vitro when siHER2-3 and siHER3-8 selected in Example 1 are used in combination. The specific implementation is as follows:

The human pancreatic cancer cell line BxPC3 was inoculated on a 12-well plate with RPMI 1640 complete medium containing 10% fetal bovine serum at a seeding density of 2-5×10 ⁵ cells/well, 1 mL of medium per well, and cultured overnight at 37°C. The cell culture medium in the 12-well plate was aspirated, and 0.5 mL of serum-free 1640 medium was added to each well.

Dilute 1 μL of siHER2-3 and siHER3-8 with a concentration of 20 μM in 200 μL of Opti-MEM serum-free medium; take 2 μL of Lipo2000 and dilute in 200 μL of Opti-MEM serum-free medium, mix well and incubate at room temperature for 5 minutes; mix the diluted siRNA and diluted Lipo2000, mix gently, and place at room temperature for 20 minutes to form nanocomplexes. The transfection groups were as follows: (1) siHER2+siHER3 transfection experimental group; (2) GFP-NC/siNC negative control transfection group; (3) blank control group with only Lipo2000 added. Wherein, GFP-NC is an siRNA directed against the GFP (green fluorescent protein) gene, siNC is an siRNA not directed against any gene, and the two siRNAs are combined as a negative control siRNA composition. Then, 400 μL per well of the above-mentioned final mixed solution was added to the 12-well plate seeded with BxPC3 cells. The final concentration of siRNA was about 100 nM, and the concentrations of siHER2-3 and siHER3-8 were both 50 nM. The cells were cultured at 37°C for 4-6 hours, then 1 mL of 1640 complete medium containing 10% fetal bovine serum was added to each well, and the culture was continued at 37°C.

The expression levels of Bcl-2 mRNA and Bax mRNA in BxPC3 cells transfected with Lipo2000, GFP-NC/siNC, siHER2-3&siHER3-8 were detected by real-time fluorescent quantitative PCR. Bcl-2 is an apoptosis suppressing gene, and Bax not only antagonizes the anti-apoptosis effect of Bcl-2, but also has the function of promoting apoptosis.

The results are shown in Figure 6. It can be seen from the figure that after siHER2-3 & siHER3-8 treatment, the cell viability of MCF-7 cells was inhibited (Figure 6-A), and the relative expression level of the apoptosis marker gene-Bax gene was significantly increased (Figure 6-B), but the relative expression level of Bcl-2 gene did not change significantly (Figure 6-C), indicating that the pharmaceutical composition can promote cell apoptosis.

Example 3. The inhibitory effect of the pharmaceutical composition on the cell viability of lung cancer cell lines

This example is used to detect the killing activity of siHER2-3 and siHER3-8 selected in Example 1 on lung cancer cells NCl-H23 and cell A549 in vitro when used alone or in combination.

(1) Detection of the killing activity of the selected siHER2-3 and siHER3-8 on lung cancer cell NCl-H23 and cell A549 in vitro when used alone:

Human lung cancer cells NCl-H23/A549 were inoculated in 96-well plates with RPMI 1640 complete medium containing 10% fetal bovine serum at a seeding density of 1-5×10 ⁴ cells/well, 0.1 mL of medium per well, and cultured overnight at 37°C. The cell culture medium in the 96-well plate was aspirated, and 0.2 mL of serum-free 1640 medium was added to each well.

Dilute 2 μL of siHER2-3 and siHER3-8 with a concentration of 20 μM in 200 μL of Opti-MEM serum-free medium; take 2 μL of Lipo2000 and dilute it in 200 μL of Opti-MEM serum-free medium, prepare two copies, mix well and incubate at room temperature for 5 minutes; mix the diluted siHER2-3 and siHER3-8 with the diluted Lipo2000 respectively, and mix gently , room temperature for 20 minutes in order to form nanocomposites. The transfection groups included: (a) siHER2 transfection experimental group; (b) siHER3 transfection experimental group; (c) GFP-NC/siNC negative control transfection group; (d) blank control group with Lipo2000 only added. Then, 100 μL of the above-mentioned mixed solution was added to each well of the 96-well plate inoculated with NCl-H23/A549 cells. The final concentration of siRNA was about 100 nM. The cells were incubated at 37° C. for 4-6 hours, and then 0.1 mL of 1640 complete medium containing 10% fetal bovine serum was added to each well, and the culture was continued at 37° C.

The cell viability of NCl-H23/A549 transfected with Lipo2000, GFP-NC/siNC, siHER2-3, and siHER3-8 was detected by CCK8 kit. The specific steps are:

After the transfected cells were cultured for 24-48 hours, 10 μL of the CCK8 solution was added to a 96-well plate, incubated in an incubator for 1-4 hours, and the absorbance of the 96-well plate was measured with a microplate reader at a wavelength of 450 nm.

The results are shown in Figure 7. It can be seen from the figure that siHER2-3 and siHER3-8 have a certain inhibitory effect on the viability of NCl-H23 and A549 cells when used alone.

(2) Detection of the killing activity of the selected siHER2-3 and siHER3-8 on lung cancer cell A549 in vitro:

siHER2-3 and siHER3-8 are used in combination to detect the killing activity of lung cancer cells A549 in vitro and siHER2-3 and siHER3-8 are used alone to detect the killing activity of lung cancer cells NCl-H23 and A549 in vitro. The specific implementation steps are different in that the cell line used is only lung cancer cells A549. Two groups of siRNA transfection groups with the concentration of -8 being 100nM (50nM+50nM) and 200nM (100nM+100nM).

The cell viability of A549 cells transfected with Lipo2000, GFP-NC/siNC, siHER2-3&siHER3-8 were detected by CCK8 kit. The results are shown in Figure 8. It can be seen from the figure that different concentrations of siHER2-3 & siHER3-8 all have significant killing effects on cell A549, indicating that the combination of siHER2-3 and siHER3-8 can also effectively kill tumor cells in vitro.

Example 4. The Invasion and Spread Inhibition Effects of Pharmaceutical Compositions on Lung Cancer Cells and Breast Cancer Cells

This example is used to test the ability of siHER2-3 and siHER3-8 selected in Example 1 to inhibit the invasion and proliferation of lung cancer cells and breast cancer cells in vitro when used in combination.

(1) The invasion and diffusion inhibitory effect of the pharmaceutical composition on lung cancer cells, the specific implementation methods are as follows:

The human lung cancer cell line A549 was inoculated on a 12-well plate with RPMI 1640 complete medium containing 10% fetal bovine serum (use a maker pen to draw 2 parallel straight lines on the back of the 12-well plate in advance with a ruler), at a seeding density of 2-5× ¹⁰⁵ cells/well, 1 mL of medium per well, and culture overnight at 37°C. The cell culture medium in the 12-well plate was aspirated, and 0.5 mL of serum-free 1640 medium was added to each well.

Dilute 3 μL of 10 μM of the two siRNAs in 594 μL of Opti-MEM medium to obtain 600 μL of a 100 nM solution, mix gently, and incubate at room temperature for 5 minutes; dilute 60 μL of Lipo2000 in 5940 μL of Opti-MEM medium (diluted 100 times), mix gently, and incubate at room temperature for 5 minutes; take 60 μL each of the diluted siRNA and diluted Lipo2000 Mix 0 μL, mix gently, and let stand at room temperature for 20 minutes to allow nanocomplex formation. The transfection groups included: (a) siHER2+siHER3 group; (b) GFP-NC/siNC negative control transfection group (negative control siRNA group); (c) blank control group with only Lipo2000 added.

Add the above-mentioned nanocomposite to the above-mentioned 12-well plate, put the 12-well plate into the incubator for 4-6 hours, replace the complete medium, and continue culturing. On the second day, use a 10 μL pipette tip to draw two parallel lines along the straight line drawn before with a ruler, wash the cells 3 times with PBS, remove the drawn cells and add the culture medium, put them in the cell culture incubator, and observe under the microscope at different time points (day 0, day 1, day 3, day 5).

The results are shown in Figure 9. It can be seen from the figure that in the blank control group and the negative control transfection group, the A549 lung cancer cells had begun to proliferate on the 3rd day, and the scratches had disappeared on the 5th day, while the cells in the HER2 siRNA and HER3 siRNA composition treatment groups still had scratches on the 5th day, indicating that the HER2 siRNA and HER3 siRNA compositions had the ability to significantly inhibit the invasion and proliferation of lung cancer cells.

(2) The invasion and diffusion inhibitory effect of the pharmaceutical composition on breast cancer cells, the specific implementation method is as follows:

The difference between the test of the ability of the pharmaceutical composition to inhibit the invasion and spread of breast cancer cells and the test of the test of the ability of the drug composition to inhibit the ability of the invasion and spread of lung cancer cells is that the breast cancer MCF-7 cells are used to replace the lung cancer A549 cells.

At different time points (Day 0, Day 1, Day 5, Day 7) microscope observations were taken.

The results are shown in Figure 10. It can be seen from the figure that the proliferation rate of MCF-7 breast cancer cells in the GFP-NC/siNC negative control transfection group was significantly higher than that in the HER2 siRNA and HER3 siRNA composition treatment groups, and the scratches were significantly reduced on the 7th day, while there were still large gaps in the scratches in the composition treatment group, indicating that the HER2 siRNA and HER3 siRNA compositions had the ability to significantly inhibit the invasion and spread of breast cancer cells.

Embodiment 5. preparation and assay effect of pharmaceutical composition

In this example, siHER2-3 and siHER3-8 selected in Example 1 are combined with the lysine-histidine polypeptide nano-import carrier HKP to make a nano-pharmaceutical preparation. The specific implementation method is as follows:

Take 0.16 mg of siHER2 and add 500 μL of water for injection to obtain a siHER2 solution; take 0.16 mg of siHER3 and add 500 μL of water for injection to obtain a siHER3 solution; mix the siHER2 solution and the siHER3 solution, and filter through a 0.22 μm filter membrane to obtain a siHER2 and siHER3 composition solution A with a concentration of 0.32 mg/mL. Weigh 0.8 mg of HKP, add 1 mL of water for injection, and filter with a 0.22 μm filter membrane to obtain HKP solution B with a concentration of 0.8 mg/mL.

Use two sterile syringes to draw 1mL of the above solution A and solution B respectively, and connect to the nano drug preparation system. Set the total volume to 2mL, the flow rate ratio to 1:1, and the total flow rate to 15mL/min, install the collection tube and waste tube, and click the start button to collect the mixed drug solution.

The average particle size of nanoparticles prepared by microfluidics is generally between 60-200nm, and nanoparticles can be dispersed in aqueous solution. After adding the lyoprotectant and lyophilizing it into powder, it can be redispersed in water for injection. The prepared nanoparticle formulations were analyzed and tested with a Malvern particle size analyzer. The particle size test results are shown in Figure 11. The results show that the average particle size of the nanoparticles is 81.02nm, and the Zeta potential is +36.65±0.46mV, which meets the expected requirements.

Embodiment 6. Determination of the inhibitory effect of the pharmaceutical composition on lung cancer by animal experiment (intratumoral injection administration)

Human and mouse mRNA molecules encode proteins that are essentially identical in structure and function, so the efficacy and toxicity responses observed in mouse disease models provide a good understanding of what will happen in humans. What's more, the siRNA molecules tested in the mouse model are good candidates for drug formulation in humans.

This example is used to detect the inhibitory effect of the nanomedicine preparation prepared in Example 5 on lung cancer in the A549 xenograft mouse tumor model in vivo (intratumoral injection). Xenograft mouse tumor models are widely used for in vivo therapeutic research, in which tumors of a certain size are transplanted subcutaneously into immunodeficient mice that do not reject human cells. Drug intervention begins when the tumor grows to a certain size, and the inhibitory effect of the drug in the body is judged according to the change in tumor volume. The specific implementation is as follows:

(1) Mouse Modeling

After washing the cells with PBS, the cultured A549 cells were prepared with Hank's balanced salt solution to prepare a cell suspension of 5×10 ⁶ cells/0.2 mL (concentration: 2.5×10 ⁷ /mL), and each animal was injected with 0.2 mL (subcutaneously, on the right flank of the mouse). When the tumor grew to more than 100mm ³ size, randomized grouping.

(2) Administration method for mice

BALB/c nude mice (female) aged 5-6 weeks were randomly divided into 3 groups, 6 mice in each group, as follows: (1) A549 cell tumor group (normal saline); (2) GFP-NC/siNC group (negative control siRNA); (3) siHER2+siHER3 group (siHER2-3+siHER3-8). All animals were administered by intratumoral injection at 2 mg/kg per mouse, in which the dose of siRNA was 0.4 mg/kg, and the administration volume was 50 μL per mouse, administered twice a week, and the animals in all groups were administered for 3 weeks. The tumor volume was measured before each administration. After the administration was completed, the animals were continued to be fed. According to the tumor growth, when a significant difference in tumor size was observed among the groups, it was recorded as the end point of the experiment. After the last administration, the animals were continued to be fed for 2-3 weeks to collect tumors, whole blood and liver tissues according to the growth of the tumors.

(3) Analysis of tissue slices

After the paraffin slides were dewaxed, the antigens were repaired by heating, the endogenous enzymes were inactivated and the endogenous biotin was blocked, blocked with BSA, the primary antibody was incubated overnight at 4 degrees, the secondary antibody was incubated, stained with DAB and hematoxylin, and then sealed with dehydrated gum, and the results were photographed under a 10X microscope.

tumor volume

The changes in tumor volume are shown in Figure 12. It can be seen from the figure that compared with the tumor volume of animals in the A549 tumor group, the tumor volume of the animals in the siHER2+siHER3 group began to decrease 11 days after administration. At all other time points, 14 days, 18 days, and 21 days after treatment, the tumor volume values of the animals in the siHER2+siHER3 group were lower than those of the A549 tumor group and the GFP-NC/siNC group. When the administration was completed (day 21), the tumor volumes of the animals in the siHER2+siHER3 group were significantly lower than those of the A549 tumor group and the GFP-NC/siNC group. It can be seen that the siHER2+siHER3 pharmaceutical composition was administered by intratumoral injection of xenograft A5 49 mice can significantly inhibit the growth of A549 tumor cells.

tumor weight

At the end of the study (day 21), after the mice were euthanized, the weight of the tumor was weighed. The results are shown in Figure 13. It can be seen from the figure that after treatment with the siHER2+siHER3 pharmaceutical composition (0.4 mg/kg, intratumoral injection), the tumor weight was significantly lower than that of the tumor group and the GFP-NC/siNC group.

H&E staining

Figure 14 shows H&E staining of tumor sections in the tumor group (lung cancer A549 cells), GFP-NC/siNC group and siHER2+siHER3 group. The small gaps on the tumor slices indicate the lack of necrotic areas and tumor cells. As shown in Figure 14, in the A549 subcutaneous transplanted tumor model of nude mice, compared with the reference group (A549 tumor group and GFP-NC/siNC group), after the siHER2+siHER3 pharmaceutical composition (0.4mg/kg, intratumoral injection) was administered and treated, obvious gaps were formed inside the tumor tissue, while the reference group did not have such a significant gap formation, indicating that HER2 siRNA and HER3 siNC The RNA pharmaceutical composition can promote tumor cell apoptosis, and has better ability to inhibit tumor cells.

Embodiment 7. measure the inhibitory effect of pharmaceutical composition to lung cancer by animal experiment (intravenous administration)

This example is used to detect the inhibitory effect of the nanomedicine preparation prepared in Example 5 on lung cancer in the A549 xenograft mouse tumor model in vivo (intravenous injection). The specific implementation is as follows:

(1) Mouse Modeling

Select female BALB/c-nu mice, wash A549 cells with PBS, prepare cell suspension of 5× ¹⁰⁶ cells/mL with Hank’s balanced salt solution, and inject 0.15 mL per mouse (subcutaneously, on the right flank of the mouse). When the average tumor volume of the tumor-bearing mice reached 80-100 mm ³ , they were randomly divided into groups.

(2) Administration method for mice

The model mice were randomly divided into 3 groups, 7 in each group, as follows: (1) A549 cell tumor group (normal saline); (2) NC group (negative control siRNA); (3) siHER2+siHER3 group. All animals were administered by intravenous injection, the administration volume was 10mL/kg, administered twice a week, the mice in all groups were administered for 3 weeks, and observed for 3 weeks after the administration.

(3) Analysis of tissue slices

After the paraffin slides were dewaxed, the antigens were repaired by heating, the endogenous enzymes were inactivated and the endogenous biotin was blocked, blocked with BSA, the primary antibody was incubated overnight at 4 degrees, the secondary antibody was incubated, stained with DAB and hematoxylin, and then sealed with dehydrated gum, and the results were photographed under a 10X microscope.

tumor volume

The tumor volume changes are shown in Figure 15. It can be seen from the figure that at all other time points, the tumor volume values of animals in the siHER2+siHER3 group were lower than those in the A549 cell tumor group and the NC group. It can be seen that the siHER2+siHER3 pharmaceutical composition administered intravenously to A549 xenograft mice can significantly inhibit the growth of A549 tumor cells.

tumor weight

At the end of the observation period, after the mice were euthanized, the tumors were weighed. The results are shown in Figure 16. It can be seen from the figure that after intravenous injection of the siHER2+siHER3 pharmaceutical composition, the tumor weight of the mice was significantly lower than that of the A549 cell tumor group and NC, indicating that the siHER2+siHER3 pharmaceutical composition has a significant inhibitory effect on lung cancer.

H&E staining

Figure 17 shows H&E staining of tumor sections in the tumor group (lung cancer A549 cells), NC group and siHER2+siHER3 group. As shown in Figure 17, in the A549 subcutaneous xenograft tumor model in nude mice, compared with the reference group (A549 tumor group and NC group), after the administration of the siHER2+siHER3 pharmaceutical composition, the tumor cells were significantly reduced, indicating that the siHER2+siHER3 pharmaceutical composition can promote tumor cell apoptosis.

Although certain embodiments of the compositions and methods are described herein, and many details have been set forth for purposes of illustration, it will be apparent to those skilled in the art that these compositions and methods are susceptible to other embodiments and that certain details may be varied from the embodiments described herein without departing from the basic principles of the invention.

Claims (16)

1. A siRNA pharmaceutical composition for inhibiting HER2 and HER3, characterized in that the siRNA pharmaceutical composition comprises a first siRNA molecule targeting mRNA encoding HER2 capable of inhibiting HER2 gene expression, thereby inhibiting HER2 function, and a second siRNA molecule targeting mRNA encoding HER3 capable of inhibiting HER3 gene expression, thereby inhibiting HER3 function.
2. siRNA pharmaceutical composition according to claim 1, is characterized in that,

   The sequence of the first siRNA molecule is:

   Sense strand: 5'-AUCCAGGAGUUUGCUGGCUGCAAGA-3',

   Antisense strand: 5'-UCUUGCAGCCAGCAAAACUCCUGGAU-3',

   The sequence of the second siRNA molecule is:

   Sense strand: 5'-GUUUGGGAGUUGAUGACCUUCGGGG-3',

   Antisense strand: 5'-CCCCGAAGGUCAUCAACUCCCAAAC-3'.
3. The pharmaceutical siRNA composition according to claim 1, wherein the molar ratio of the first siRNA molecule to the second siRNA molecule is 1:3-3:1.
4. An siRNA pharmaceutical preparation, characterized in that the siRNA pharmaceutical preparation comprises the siRNA pharmaceutical composition according to any one of claims 1-3 and a drug carrier or other pharmaceutically acceptable carrier for delivering the siRNA pharmaceutical composition to a desired lesion site.
5. The siRNA drug preparation according to claim 4, wherein the drug carrier is a histidine-lysine branched polypeptide polymer.
6. The siRNA pharmaceutical preparation according to claim 5, wherein the histidine-lysine branched polypeptide polymer is H3K4b and/or H3K(+H)4b.
7. The siRNA pharmaceutical preparation according to claim 4, wherein the N/P mass ratio of the histidine-lysine branched polypeptide polymer to the siRNA pharmaceutical composition is 1.5:1˜6:1.
8. The siRNA pharmaceutical preparation according to claim 4, wherein the siRNA pharmaceutical preparation is a nanoparticle.
9. The siRNA pharmaceutical preparation according to claim 4, wherein the siRNA pharmaceutical preparation is a lyophilized powder preparation or an injection.
10. A method for preparing the siRNA pharmaceutical preparation according to any one of claims 4-9, wherein the preparation method is to mix the siRNA pharmaceutical composition with the drug carrier or other pharmaceutically acceptable carriers to form the siRNA pharmaceutical preparation.
11. An application of the siRNA pharmaceutical composition as described in any one of claims 1-3 or the siRNA pharmaceutical preparation described in any one of claims 4-9 in the treatment of solid tumors, said solid tumors comprising one or more of breast cancer, lung cancer, gastric cancer, esophageal cancer, and colorectal cancer.
12. A method for treating cancer in a subject, characterized in that the treatment method comprises administering an effective amount of the siRNA pharmaceutical composition according to any one of claims 1-3 or the siRNA pharmaceutical preparation according to any one of claims 4-9 to the subject.
13. The method of claim 12, wherein the cancer is breast cancer or lung cancer.
14. The method according to claim 12, characterized in that, the siRNA pharmaceutical composition or the siRNA pharmaceutical preparation is administered locally via microneedle, injection or perfusion through muscle, subcutaneous, endothelial, intratumoral, or intravenous injection.
15. The method of claim 12, wherein the subject is a mammal.
16. The method of claim 12, wherein the subject is a human.

Images