WO2022206821A1 - Rna delivery system for treating parkinson's disease - Google Patents

Abstract

The present application provides an RNA delivery system for treating Parkinson's disease. The system comprises a viral vector. The viral vector carries an RNA fragment capable of treating Parkinson's disease. The viral vector can be enriched in an organ tissue of a host, and endogenously and spontaneously form, in the organ tissue of the host, a composite structure containing the RNA fragment capable of treating Parkinson's disease. The composite structure can deliver the RNA fragment to a target tissue to achieve the treatment of Parkinson's disease. The safety and reliability of the RNA delivery system for treating Parkinson's disease provided by the present application has been fully verified, and the RNA delivery system has remarkable druggability and high universality, and thus has excellent economic benefits and application prospects.

Description

An RNA delivery system for the treatment of Parkinson's technical field

The present application relates to the field of biomedical technology, in particular to an RNA delivery system for treating Parkinson's disease.

Background technique

Parkinson's disease (PD), also known as tremor palsy, is a common neurodegenerative disease of the middle-aged and elderly people. The main lesions are in the substantia nigra and striatum. Parkinson's disease is the fourth most common neurodegenerative disease in older adults.

RNA interference (RNAi) therapy has been considered a promising strategy for the treatment of human diseases since its invention, but many problems have been encountered during clinical practice, and the development of this therapy has lagged far behind expectations.

It is generally believed that RNA cannot exist stably outside the cell for a long time, because RNA will be degraded into fragments by RNases rich in extracellular, so it is necessary to find a method that can make RNA stable outside the cell and can enter specific tissues in a targeted manner. Highlight the effect of RNAi therapy.

At present, there are many patents related to siRNA, mainly focusing on the following aspects: 1. Designing siRNA with medical effects. 2. Chemical modification of siRNA to improve the stability of siRNA in vivo and increase the yield. 3. Improve the design of various artificial carriers (such as lipid nanoparticles, cationic polymers and viruses) to improve the efficiency of siRNA delivery in vivo. Among them, there are many patents in the third aspect. The fundamental reason is that researchers have realized that there is currently a lack of suitable siRNA delivery systems to safely, precisely and efficiently deliver siRNA to target tissues. This problem has become the core restricting RNAi therapy. question.

Virus (Biological virus) is a small individual, simple structure, containing only one nucleic acid (DNA or RNA), must be parasitic in living cells and replicated non-cellular organisms. Viral vectors can bring genetic material into cells. The principle is to use the molecular mechanism of viruses to transmit their genomes into other cells for infection. It can occur in a complete living body (in vivo) or cell culture (in vitro), mainly used in Basic research, gene therapy or vaccines. However, there are few related studies on the use of viruses as vectors to deliver RNA, especially siRNA, using a special self-assembly mechanism.

The Chinese Patent Publication No. CN108624590A discloses a siRNA capable of inhibiting the expression of DDR2 gene; the Chinese Patent Publication No. CN108624591A discloses a siRNA capable of silencing the ARPC4 gene, and the siRNA is modified with α-phosphorus-selenium; The Chinese Patent Publication No. CN108546702A discloses a siRNA targeting long-chain non-coding RNA DDX11-AS1. The Chinese Patent Publication No. CN106177990A discloses a siRNA precursor that can be used for various tumor treatments. These patents design specific siRNAs to target certain diseases caused by genetic changes.

Chinese Patent Publication No. CN108250267A discloses a polypeptide, polypeptide-siRNA induced co-assembly, using polypeptide as a carrier of siRNA. The Chinese Patent Publication No. CN108117585A discloses a polypeptide for promoting apoptosis of breast cancer cells through targeted introduction of siRNA, and the polypeptide is also used as the carrier of siRNA. The Chinese Patent Publication No. CN108096583A discloses a nanoparticle carrier, which can be loaded with siRNA with breast cancer curative effect while containing chemotherapeutic drugs. These patents are all inventions and creations in terms of siRNA vectors, but their technical solutions have a common feature, that is, the vectors and siRNA are pre-assembled in vitro and then introduced into the host. In fact, this is the case with most of the delivery technologies currently designed. However, this type of delivery system has a common problem, that is, these synthetic exogenous delivery systems are easily cleared by the host's circulatory system, may also cause immunogenic responses, and may even be toxic to specific cell types and tissues.

The research team of the present invention found that endogenous cells can selectively encapsulate miRNAs into exosomes, and exosomes can deliver miRNAs to recipient cells, which secrete miRNAs at relatively low concentrations , which can effectively block the expression of target genes. Exosomes are biocompatible with the host immune system and possess the innate ability to protect and transport miRNAs across biological barriers in vivo, thus becoming a potential solution to overcome problems associated with siRNA delivery. For example, the Chinese Patent Publication No. CN110699382A discloses a method for preparing siRNA-delivering exosomes, and discloses the technology of separating exosomes from plasma and encapsulating siRNA into exosomes by electroporation .

However, such techniques of in vitro isolation or preparation of exosomes often require obtaining a large amount of exosomes through cell culture, coupled with the step of siRNA encapsulation, which makes the clinical cost of large-scale application of this product very high. Patients cannot afford it; more importantly, the complex production/purification process of exosomes makes it almost impossible to comply with GMP standards.

So far, drugs with exosomes as active ingredients have never been approved by the CFDA. The core problem is that the consistency of exosome products cannot be guaranteed, and this problem directly leads to the inability of such products to obtain drug production licenses. If this problem can be solved, it will be of great significance to promote RNAi therapy for Parkinson's disease.

Therefore, the development of a safe, precise and efficient siRNA delivery system is a crucial part of improving the effect of RNAi therapy and advancing RNAi therapy.

SUMMARY OF THE INVENTION

In view of this, the embodiments of the present application provide an RNA delivery system for treating Parkinson's and its application, so as to solve the technical defects existing in the prior art.

One of the inventions of the present application is to provide an RNA delivery system for treating Parkinson's disease. The system includes a viral vector carrying an RNA segment capable of treating Parkinson's disease. It is enriched in the host organ tissue and endogenously and spontaneously forms a composite structure containing the RNA fragment capable of treating Parkinson's disease, and the composite structure can deliver the RNA fragment into the target tissue to achieve Parkinson's disease. Treatment. After the RNA fragment is delivered to the target tissue, it can inhibit the expression of the matching gene, thereby inhibiting the development of disease in the target tissue. The target tissue is the brain.

Further, the viral vector is an adenovirus-associated virus.

Further, the adenovirus-associated virus is adenovirus-associated virus type 5, adenovirus-associated virus type 8 or adenovirus-associated virus type 9.

Further, the RNA fragment comprises one, two or more specific RNA sequences with medical significance, and the RNA sequences are siRNA, shRNA or miRNA with medical significance.

Further, the viral vector comprises a promoter and a targeting tag, the targeting tag can form the targeting structure of the composite structure in the organ tissue of the host, the targeting structure is located on the surface of the composite structure, the The complex structure is capable of finding and binding to the target tissue through the targeting structure, delivering the RNA fragment into the target tissue.

Further, the viral vector includes any one of the following circuits or a combination of several circuits: promoter-RNA fragment, promoter-targeting tag, promoter-RNA fragment-targeting tag; each of the viral vectors including at least one RNA segment and one targeting tag, the RNA segment and targeting tag are located in the same circuit or are located in different circuits.

Further, the viral vector also includes a flanking sequence, a compensation sequence and a loop sequence that can make the circuit fold into a correct structure and express, and the flanking sequence includes a 5' flanking sequence and a 3' flanking sequence;

The viral vector includes any one of the following lines or a combination of several lines: 5'-promoter-5' flanking sequence-RNA fragment-loop sequence-compensating sequence-3' flanking sequence, 5'-promoter-target To tag, 5'-promoter-targeting tag-5'flanking sequence-RNA fragment-loop sequence-compensating sequence-3'flanking sequence.

Further, the 5' flanking sequence is ggatcctggaggcttgctgaaggctgtatgctgaattc or a sequence whose homology is greater than 80%;

The loop sequence is gttttggccactgactgac or a sequence whose homology is greater than 80%;

Described 3 ' flanking sequence is accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag or its homology is greater than 80% sequence;

The compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-5 bases are deleted. The purpose of deleting bases 1-5 of the reverse complement of the RNA is to make the sequence unexpressed.

Unlike shRNA, in siRNA and miRNA precursors, due to deletion of the 9th and 10th bases of the reverse complementary strand of the active strand (such as the reverse complementary strand of siRNA), the active strand of siRNA and miRNA will form a bulge. structure, which facilitates more efficient silencing of gene expression. To sum up, it is an accepted conclusion that the silencing efficiency can be improved by deleting the reverse complementary sequence of the 9th and 10th bases.

Preferably, the compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-3 bases are deleted.

More preferably, the compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-3 consecutive bases are deleted.

Most preferably, the compensation sequence is the reverse complement of the RNA fragment, and the 9th and/or 10th bases are deleted.

Further, when there are at least two lines in the viral vector, adjacent lines are connected by a sequence composed of sequences 1-3 (sequence 1-sequence 2-sequence 3);

Wherein, sequence 1 is CAGATC, sequence 2 is a sequence consisting of 5-80 bases, and sequence 3 is TGGATC.

Further, when there are at least two lines in the viral vector, adjacent lines are connected by sequence 4 or a sequence with more than 80% homology to sequence 4;

Wherein, sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC.

Further, the organ tissue is liver, and the composite structure is exosome.

Further, the targeting tag is selected from targeting peptides or targeting proteins with targeting function.

Further, the targeting peptides include RVG targeting peptides, GE11 targeting peptides, PTP targeting peptides, TCP-1 targeting peptides, and MSP targeting peptides;

The targeting proteins include RVG-LAMP2B fusion protein, GE11-LAMP2B fusion protein, PTP-LAMP2B fusion protein, TCP-1-LAMP2B fusion protein, and MSP-LAMP2B fusion protein.

The targeting tag is preferably an RVG targeting peptide or RVG-LAMP2B fusion protein that can precisely target brain tissue.

Further, the length of the RNA sequence is 15-25 nucleotides. For example, the length of the RNA sequence can be 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 nucleotides. Preferably, the RNA sequence is 18-22 nucleotides in length.

Further, the RNA capable of treating Parkinson's is selected from: siRNA of the LRRK2 gene, or an RNA sequence with a homology of more than 80% to the above sequence, or a nucleic acid molecule encoding the above RNA. It should be noted that the RNA sequences in the "nucleic acid molecules encoding the above RNA sequences" here also include RNA sequences with a homology of more than 80% of each RNA.

The siRNA of LRRK2 gene includes AUUAACAUGAAAAUAUCACUU, UUAACAAUAUCAUAUAAUCUU, AUCUUUAAAAUUUGUUAACGC, UUGAUUUAAGAAAAUAGUCUC, UUUGAUAACAGUAUUUUUCUG, other sequences that inhibit the expression of LRRK2 gene and sequences with more than 80% homology to the above sequences.

It should be noted that the above-mentioned "sequences with more than 80% homology" may be 85%, 88%, 90%, 95%, 98%, etc. homology. Optionally, the RNA fragment includes an RNA sequence ontology and a modified RNA sequence obtained by modifying the RNA sequence ontology with ribose sugar. That is, the RNA fragment can be composed of only at least one RNA sequence ontology, or only at least one modified RNA sequence, and can also be composed of RNA sequence ontology and modified RNA sequence.

In the present invention, the isolated nucleic acid also includes its variants and derivatives. The nucleic acid can be modified by one of ordinary skill in the art using general methods. Modification methods include (but are not limited to): methylation modification, hydrocarbyl modification, glycosylation modification (such as 2-methoxy-glycosyl modification, hydrocarbyl-glycosyl modification, sugar ring modification, etc.), nucleic acid modification, peptide modification Segment modification, lipid modification, halogen modification, nucleic acid modification (such as "TT" modification) and the like. In one of the embodiments of the present invention, the modification is an internucleotide linkage, for example selected from: phosphorothioate, 2'-O methoxyethyl (MOE), 2'-fluoro, phosphine Acid alkyl esters, phosphorodithioates, alkyl phosphorothioates, phosphoramidates, carbamates, carbonates, phosphoric triesters, acetamidates, carboxymethyl esters, and combinations thereof. In one of the embodiments of the present invention, the modification is a modification of nucleotides, such as selected from: peptide nucleic acid (PNA), locked nucleic acid (LNA), arabinose-nucleic acid (FANA), analogs, derivatives objects and their combinations. Preferably, the modification is a 2' fluoropyrimidine modification. 2'Fluoropyrimidine modification is to replace the 2'-OH of pyrimidine nucleotides on RNA with 2'-F. 2'-F can make RNA not easily recognized by RNase in vivo, thereby increasing the stability of RNA fragment transmission in vivo. sex.

Further, the delivery system is a delivery system for use in mammals including humans.

Another inventive point of the present application is to provide an application of the above-mentioned RNA delivery system for treating Parkinson's in medicine.

The drug is a drug for the treatment of Parkinson's and its related diseases, and the related diseases here refer to the associated diseases or complications, sequelae, etc. that occur in the formation or development of Parkinson's, or other diseases that are related to Parkinson's. disease.

The drug includes the above-mentioned viral vector, specifically, the viral vector here refers to a viral vector carrying RNA fragments, or carrying RNA fragments and targeting tags, and can enter the host body, can be enriched in the liver, and self-assemble. A composite structure exosome is formed, which can deliver RNA fragments to the target tissue, so that the RNA fragments are expressed in the target tissue, thereby inhibiting the expression of matching genes, and achieving the purpose of treating diseases.

The dosage forms of the drug can be tablets, capsules, powders, granules, pills, suppositories, ointments, solutions, suspensions, lotions, gels, pastes and the like.

Further, the administration modes of the drug include oral, inhalation, subcutaneous injection, intramuscular injection, and intravenous injection. Intravenous injection is preferred.

The technical effects of this application are:

The RNA delivery system for the treatment of Parkinson's provided in this application uses a virus as a vector, and the virus vector is used as a mature injection, and its safety and reliability have been fully verified, and the drugability is very good. The final effective RNA sequence is packaged and delivered by endogenous exosomes, and there is no immune response, so there is no need to verify the safety of the exosomes. The delivery system can deliver all kinds of small molecule RNAs, and has strong versatility. And the preparation of viral vectors is much cheaper and more economical than the preparation of exosomes or proteins, polypeptides and other substances. The RNA delivery system for the treatment of Parkinson's provided in this application can be tightly combined with AGO ₂ and enriched into a composite structure (exosome) after self-assembly in vivo, which can not only prevent its premature degradation, but also maintain its circulation in the circulation. It is stable, and facilitates uptake by recipient cells, intracytoplasmic release and lysosomal escape, and requires a low dose.

The RNA delivery system for the treatment of Parkinson's disease provided in this application is applied to medicine, that is, it provides a drug delivery platform, which can greatly improve the therapeutic effect of Parkinson's disease, and can also form a research and development basis for more RNA drugs through this platform. , which greatly promotes the development and use of RNA drugs.

Description of drawings

Fig. 1 is a comparison diagram of the Parkinson's treatment situation of transgenic mice provided by an embodiment of the present application;

2 is a comparison diagram of the activation of mouse microglia and the secretion of inflammatory factors according to an embodiment of the present application;

FIG. 3 is a comparison diagram of the number of mouse microglia provided in an example of the present application.

FIG. 4 is an effect diagram of in vivo enrichment of the siRNA-loaded lentiviral vector provided in an embodiment of the present application.

FIG. 5 is an effect diagram of in vivo self-assembly of the siRNA-loaded lentiviral vector provided in an embodiment of the present application.

Fig. 6 is the data result graph that the lentiviral vector loaded with siRNA provided by an embodiment of the present application has the therapeutic effect of Parkinson's disease.

FIG. 7 is a graph showing the effect of in vivo enrichment of adeno-associated virus type 1, type 4, and type 7 vectors loaded with siRNA provided in an example of the present application.

FIG. 8 is a diagram showing the effect of in vivo self-assembly of the siRNA-loaded adeno-associated virus type 1, type 4, and type 7 vectors provided in an embodiment of the present application.

Fig. 9 is a graph showing the data of the Parkinson's treatment effect of adeno-associated virus type 1, 4, and 7 vectors loaded with siRNA provided in an example of the present application.

Figure 10 is an effect diagram of in vivo enrichment of adenovirus-associated virus type 8 vectors loaded with 6 individual RNA sequences provided by an embodiment of the present application.

FIG. 11 is an effect diagram of in vivo self-assembly of adeno-associated virus type 8 and type 9 vectors loaded with 6 individual RNA sequences provided in an example of the present application.

FIG. 12 is a diagram showing the effect of in vivo enrichment of an adeno-associated virus type 9 vector loaded with RNA fragments of any two RNA sequences provided in an example of the present application.

13 is a diagram showing the effect of in vivo self-assembly of adeno-associated virus type 8 and type 9 vectors loaded with RNA fragments of any two RNA sequences provided in an example of the present application.

FIG. 14 is an electrophoresis result of the Parkinson's treatment effect of an adenovirus vector loaded with RNA fragments of any three RNA sequences provided in an example of the present application.

FIG. 15 is a graph showing the in vivo enrichment data of the adeno-associated virus type 9 sequences provided in an example of the present application when siRNA and RVG are included.

Figure 16 is a graph showing the effect of Parkinson's treatment according to the expression data of LRRK2 mRNA when the sequence in the adenovirus-associated virus type 9 provided in an example of the present application includes siRNA and RVG.

FIG. 17 is a data diagram of in vivo enrichment of adenovirus vectors loaded with RVG-LAMP2B fusion proteins and other fusion proteins provided in an example of the present application.

Figure 18 is a data comparison diagram of the therapeutic effect of RVG-LAMP2B fusion protein and other fusion proteins on adenovirus vectors for Parkinson's disease provided in an example of the present application, and the data is reflected by the relative level of LRRK2 mRNA.

Figure 19 is a graph of in vivo enrichment data of the adenoviral vector system provided in an example of the present application when three RNA sequences with more than 80% homology to the siRNA sequence of the LRRK2 gene are included.

Figure 20 is a data comparison diagram of the therapeutic effect on Parkinson's disease when the adenovirus vector system provided by an embodiment of the present application includes 3 RNA sequences with a homology of more than 80% to the siRNA sequence of the LRRK2 gene. to reflect the relative level.

Detailed ways

The specific embodiments of the present application will be described below with reference to the accompanying drawings.

In the present invention, unless otherwise specified, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. In addition, the reagents, materials and operation steps used herein are the reagents, materials and conventional steps widely used in the corresponding fields.

Western blot (Western Blot) is to transfer the protein to the membrane, and then use the antibody for detection. For the known expressed protein, the corresponding antibody can be used as the primary antibody for detection, and the expression product of the new gene can be detected by the fusion part of the antibody. .

Western Blot uses polyacrylamide gel electrophoresis, the detected object is protein, the "probe" is an antibody, and the "color development" is a labeled secondary antibody. The protein sample separated by PAGE is transferred to a solid phase carrier (such as nitrocellulose membrane), and the solid phase carrier adsorbs proteins in the form of non-covalent bonds, and can keep the types of polypeptides separated by electrophoresis and their biological activities unchanged. The protein or polypeptide on the solid phase carrier is used as an antigen, which reacts with the corresponding antibody, and then reacts with the enzyme or isotope-labeled secondary antibody to detect the specific target gene separated by electrophoresis through substrate color development or autoradiography. expressed protein components. The steps mainly include: protein extraction, protein quantification, gel preparation and electrophoresis, membrane transfer, immunolabeling and development.

Immunohistochemistry, using antigen-antibody reaction, that is, the principle of specific binding of antigen and antibody, determines the antigen (polypeptide) in tissue cells by developing the color of the chromogenic reagent (fluorescein, enzyme, metal ion, isotope) labeled antibody through chemical reaction. and protein), the localization, qualitative and relative quantitative research, called immunohistochemistry (immunohistochemistry) or immunocytochemistry (immunocytochemistry).

The main steps of immunohistochemistry include: section soaking, overnight drying, xylene dewaxing, gradient alcohol dewaxing (100%, 95%, 90%, 80%, 75%, 70%, 50%, 3min each time) , double-distilled water, dropwise addition of 3% hydrogen peroxide solution to remove catalase, water washing, antigen retrieval, dropwise addition of 5% BSA, blocking for 1 h, dilution of primary antibody, washing with PBS buffer, incubation with secondary antibody, washing with PBS buffer , color developing solution, washing with water, hematoxylin staining, dehydration with gradient ethanol, and sealing with neutral gum.

The detection of the siRNA level, the protein content and the mRNA content involved in the present invention is to establish the mouse stem cell in vitro model by injecting the RNA delivery system into the mouse. The expression levels of mRNA and siRNA in cells and tissues were detected by qRT-PCR. Absolute quantification of siRNA was determined by plotting a standard curve using the standards. The expression level of each siRNA or mRNA relative to the internal control can be represented by 2-ΔCT, where ΔCT=C sample-C internal control. When amplifying siRNA, the internal reference gene is U6snRNA (in tissue) or miR-16 (in serum, exosomes), and when amplifying mRNA, the gene is GAPDH or 18s RNA. Western blotting was used to detect protein expression levels in cells and tissues, and ImageJ software was used for protein quantitative analysis.

Example 1

This embodiment provides an RNA delivery system for treating Parkinson's, the system comprising a viral vector carrying RNA fragments capable of treating Parkinson's, the viral vector can be enriched in the organ tissue of a host, And endogenously and spontaneously form a composite structure containing the RNA fragment capable of treating Parkinson's disease in the host organ tissue, and the composite structure can send the RNA fragment into the target tissue to achieve Parkinson's treatment.

In addition to adenovirus, other viral vectors also have in vivo enrichment, self-assembly and Parkinson's treatment effects, such as lentivirus. The data of lentivirus are shown in Figure 4-6, where CTX stands for cortex and STR stands for Striatum (Striatum).

The viral vector is preferably adeno-associated virus, more preferably adeno-associated virus type 5, adenovirus-associated virus type 8 or adenovirus-associated virus type 9.

In addition to adeno-associated virus types 5, 8 and 9, other viral vectors also have in vivo enrichment, self-assembly and Parkinson's treatment effects, such as adenovirus types 1, 4 and 7, the data of which are shown in Figure 7- 9 shown.

In this embodiment, the viral vector also includes a promoter and a targeting tag. The viral vector includes any one of the following circuits or a combination of several circuits: promoter-RNA sequence, promoter-targeting tag, promoter-RNA sequence-targeting tag, and each of the viral vectors includes at least one RNA fragments and a targeting tag, either in the same circuit or in different circuits. In other words, the viral vector may only include a promoter-RNA sequence-targeting tag, or may include a combination of a promoter-RNA sequence, a promoter-targeting tag, or a promoter-targeting tag, a promoter A combination of RNA-seq-targeting tags.

Further, the viral vector may also include a flanking sequence, a compensation sequence and a loop sequence that can make the circuit fold into a correct structure and express, and the flanking sequence includes a 5' flanking sequence and a 3' flanking sequence; the viral vector Including any one of the following lines or a combination of several lines: 5'-promoter-5' flanking sequence-RNA fragment-loop sequence-compensating sequence-3' flanking sequence, 5'-promoter-targeting tag, 5' - Promoter - Targeting Tag - 5' Flanking Sequence - RNA Fragment - Loop Sequence - Compensation Sequence - 3' Flanking Sequence.

When the viral vector contains 5'-promoter-targeting tag-5'flanking sequence-RNA fragment-loop sequence-compensating sequence-3'flanking sequence, its RNA delivery system has in vivo enrichment and Parkinson's treatment The effect is shown in Figure 15-16, the targeting tag is RVG, and the RNA fragment is siRNA with therapeutic effect.

Wherein, the 5' flanking sequence is preferably ggatcctggaggcttgctgaaggctgtatgctgaattc or a sequence with a homology greater than 80%, including a sequence with 85%, 90%, 92%, 95%, 98%, 99% homology with ggatcctggaggcttgctgaaggctgtatgctgaattc, etc.

The loop sequence is preferably gttttggccactgactgac or a sequence with more than 80% homology thereto, including sequences with 85%, 90%, 92%, 95%, 98%, 99% homology with gttttggccactgactgac, and the like.

The 3' flanking sequence is preferably accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag or a sequence with a homology greater than 80%, including a sequence with 85%, 90%, 92%, 95%, 98%, 99% homology with accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag, etc.

The compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-5 bases are deleted. When the RNA fragment contains only one RNA sequence, the compensation sequence can be the reverse complementary sequence of the RNA sequence by deleting any 1-5 bases therein.

Preferably, the compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-3 bases are deleted. When the RNA fragment contains only one RNA sequence, the compensation sequence can be the reverse complementary sequence of the RNA sequence by deleting any 1-3 bases therein.

More preferably, the compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-3 consecutive bases are deleted. When the RNA fragment contains only one RNA sequence, the compensation sequence may be the reverse complementary sequence of the RNA sequence by deleting any 1-3 consecutively arranged bases.

Most preferably, the compensation sequence is the reverse complement of the RNA fragment, and the 9th and/or 10th bases are deleted. When the RNA fragment contains only one RNA sequence, the compensation sequence may be the reverse complementary sequence of the 9th position and/or the 10th position in the deletion of the RNA sequence. Deleting bases 9 and 10 works best.

It should be noted that the above-mentioned flanking sequences, compensation sequences and loop sequences are not randomly selected, but are determined based on a large number of theoretical studies and experiments. increase the expression rate of RNA fragments.

In the case that the viral vector carries two or more lines, the adjacent lines can be connected by sequence 1-sequence 2-sequence 3; wherein, sequence 1 is preferably CAGATC, and sequence 2 can be composed of 5-80 bases Sequence of bases, such as 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75 bases The sequence of 10-50 bases is preferable, and the sequence of 20-40 bases is more preferable. Sequence 3 is preferably TGGATC.

Sequence 2 is specifically shown in Table 1 below.

More preferably, when the viral vector carries two or more lines, adjacent lines are connected by sequence 4 or a sequence with more than 80% homology to sequence 4; wherein, sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC.

The sequence is specifically shown in Table 4 below.

sequence 4	CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC
Sequence 4-1	CAGATCTGGCCGCACTCGTAGAGGTGAGTCGACCAGTGGATC
Sequence 4-2	CAGATCTGGCACCCGTCGAGGTAGTGAGTCGACCAGTGGATC
Sequence 4-3	CAGATCTGGCCGCACAGGTCGTAGTGAGTCGACCAGTGGATC

The above-mentioned RNA fragments comprise one, two or more specific RNA sequences of medical significance, the RNA sequences can be expressed in the target receptor, and the compensatory sequence cannot be expressed in the target receptor. The RNA sequence can be an siRNA sequence, a shRNA sequence or a miRNA sequence, preferably an siRNA sequence.

The length of an RNA sequence is 15-25 nucleotides (nt), preferably 18-22nt, such as 18nt, 19nt, 20nt, 21nt, and 22nt. This range of sequence lengths was not chosen arbitrarily, but was determined through trial and error. A large number of experiments have proved that when the length of the RNA sequence is less than 18nt, especially less than 15nt, the RNA sequence is mostly invalid and will not play a role. The cost of the line is greatly increased, and the effect is not better than the RNA sequence with a length of 18-22nt, and the economic benefit is poor. Therefore, when the length of the RNA sequence is 15-25nt, especially 18-22nt, the cost and the effect can be taken into consideration, and the effect is the best.

The RNA capable of treating Parkinson's disease is selected from: siRNA of LRRK2 gene or nucleic acid molecule encoding the above RNA.

Three LRRK2 siRNA sequences were selected, namely UUGGUCAUCUGGAUACAUC, CAUGAUGCUGUUAUUCU, GAUUGGAAAUAAAGGACCA, and the first siRNA was used as an example to verify the effect of the sequences with homology of 80%, 90% and 98%. The delivery system of the source sequence, its in vivo enrichment and Parkinson's treatment effect are shown in Figures 19-20.

The number of required delivery RNA effective sequences is one, two or more.

Taking the combined use of "siRNA1" and "siRNA2" on the same viral vector as an example, the functional structural region of the viral vector can be expressed as: (promoter-siRNA1)-connector sequence-(promoter-siRNA2)-connector sequence- (promoter-targeting tag), or (promoter-targeting tag-siRNA1)-linker-(promoter-targeting tag-siRNA2), or (promoter-siRNA1)-linker-(promoter- Targeting tag-siRNA2) etc.

More specifically, the functional structural region of the viral vector can be expressed as: (5'-promoter-5'flanking sequence-siRNA1-loop sequence-compensating sequence-3'flanking sequence)-connector sequence-(5'-promoter - 5' flanking sequence - siRNA2-loop sequence - compensation sequence - 3' flanking sequence) - linking sequence - (5'-promoter-targeting tag), or (5'-promoter-targeting tag-5' flanking sequence-siRNA1-loop sequence-compensation sequence-3' flanking sequence)-linker sequence-(5'-promoter-targeting tag-5'flanking sequence-siRNA2-loop sequence-compensating sequence-3'flanking sequence), or (5'-promoter-5'flanking sequence-siRNA1-loop sequence-compensating sequence-3'flanking sequence)-linking sequence-(5'-promoter-targeting tag-5'flanking sequence-siRNA2-loop sequence- Compensation sequence-3'flanking sequence), (5'-promoter-targeting tag-5'flanking sequence-siRNA1-siRNA2-loop sequence-compensating sequence-3'flanking sequence), etc. Other situations can be deduced by analogy, and details are not repeated here. The above connecting sequence can be "sequence 1-sequence 2-sequence 3" or "sequence 4", and a bracket indicates a complete circuit.

Preferably, the above RNA can also be obtained by ribose modification of the RNA sequence (siRNA, shRNA or miRNA) therein, preferably 2' fluoropyrimidine modification. 2'Fluoropyrimidine modification is to replace the 2'-OH of pyrimidine nucleotides on siRNA, shRNA or miRNA with 2'-F. 2'-F can make it difficult for RNase in the human body to recognize siRNA, shRNA or miRNA, so it can Increases the stability of RNA transport in vivo.

Specifically, the liver will phagocytose exogenous viruses, and up to 99% of the exogenous viruses will enter the liver. Therefore, when viruses are used as vectors, they can be enriched in liver tissue without specific design. After being opened, RNA molecules (siRNA, shRNA, or miRNA) are released, and liver tissue spontaneously wraps the above RNA molecules into exosomes, and these exosomes become RNA delivery mechanisms.

Preferably, in order to make the RNA delivery mechanism (exosome) have the ability of "precision guidance", we design a targeting tag in the viral vector injected into the body, and the targeting tag will also be assembled into exosomes by liver tissue In particular, when certain specific targeting tags are selected, the targeting tags can be inserted into the surface of exosomes to become targeting structures that can guide exosomes, which greatly improves the RNA delivery of the present invention. The accuracy of the mechanism, on the one hand, can greatly reduce the amount of viral vector that needs to be introduced, and on the other hand, greatly improves the efficiency of potential drug delivery.

The targeting tag is selected from one of the peptides, proteins or antibodies with targeting function. The selection of the targeting tag is a process that requires creative work. On the one hand, it is necessary to select the available targeting tags according to the target tissue. It is ensured that the targeting label can stably appear on the surface of exosomes, so as to achieve the targeting function. Targeting tags that have been screened include: targeting peptides, targeting proteins, and antibodies. Wherein, targeting peptides include but are not limited to RVG targeting peptide (nucleotide sequence shown in SEQ ID No: 1), GE11 targeting peptide (nucleotide sequence shown in SEQ ID No: 2), PTP targeting peptide Peptide (nucleotide sequence shown in SEQ ID No: 3), TCP-1 targeting peptide (nucleotide sequence shown in SEQ ID No: 4), MSP targeting peptide (nucleotide sequence shown in SEQ ID No: 4) : 5); targeting proteins include but are not limited to RVG-LAMP2B fusion protein (nucleotide sequence shown in SEQ ID No: 6), GE11-LAMP2B fusion protein (nucleotide sequence shown in SEQ ID No: 7) shown), PTP-LAMP2B fusion protein (nucleotide sequence shown in SEQ ID No: 8), TCP-1-LAMP2B fusion protein (nucleotide sequence shown in SEQ ID No: 9), MSP-LAMP2B fusion protein (The nucleotide sequence is shown in SEQ ID No: 10). In this embodiment, the targeting tag preferably adopts RVG targeting peptide and RVG-LAMP2B fusion protein that can accurately target brain tissue.

Figures 17-18 show the in vivo enrichment and Parkinson's treatment effect of RVG-LAMP2B fusion protein on adenovirus vector, and its therapeutic effect is reflected by the level of LRRK2 mRNA.

In addition, in order to achieve the purpose of precise delivery, we have experimented with a variety of viral vector loading schemes, and came up with another optimized scheme: the viral vector can also be composed of multiple viruses with different structures, one of which contains a promoter promoters and targeting tags, other viruses contain promoters and RNA segments. Loading the targeting tag and RNA fragment into different viral vectors, and injecting the two viral vectors into the body, the targeting effect is no worse than the targeting effect produced by loading the same targeting tag and RNA fragment into one viral vector .

More preferably, when two different viral vectors are injected into the host, the viral vector containing the RNA sequence can be injected first, and then the viral vector containing the targeting tag can be injected after 1-2 hours, so that a better target can be achieved. to the effect.

The delivery systems described above can all be used in mammals, including humans.

The RNA delivery system for the treatment of Parkinson's provided in this example uses a virus as a vector, and the virus vector is used as a mature injection. Its safety and reliability have been fully verified, and its druggability is very good. The final effective RNA sequence is packaged and delivered by endogenous exosomes, and there is no immune response, so there is no need to verify the safety of the exosomes. The delivery system can deliver all kinds of small molecule RNAs, and has strong versatility. And the preparation of viral vectors is much cheaper and more economical than the preparation of exosomes or proteins, polypeptides and other substances. The RNA delivery system for the treatment of Parkinson's disease provided in this example can be tightly combined with AGO ₂ and enriched into a complex structure (exosome) after self-assembly in vivo, which can not only prevent its premature degradation, but also maintain its circulation in the circulation. It is stable, and is beneficial to receptor cell uptake, intracytoplasmic release and lysosomal escape, and the required dose is low.

Example 2

On the basis of Embodiment 1, this embodiment provides a medicine. The medicament includes a viral vector carrying an RNA segment capable of treating Parkinson's, the viral vector being capable of enriching in the organ tissue of a host, and endogenously and spontaneously forming in the organ tissue of the host an RNA segment capable of treating Parkinson's disease The composite structure of the RNA fragment for treating Parkinson's disease, the composite structure can deliver the RNA fragment into the target tissue to realize the treatment of Parkinson's disease.

Optionally, the RNA fragment comprises one, two or more specific RNA sequences with medical significance, and the RNA sequences are siRNA, shRNA or miRNA with medical significance.

Adenovirus-associated virus types 8 and 9 are used as viral vectors, which have in vivo enrichment, self-assembly and Parkinson's treatment effects when carrying one or more RNA fragments. Figure 10-11 shows that the vectors carry Figures 12-13 show data presented for RNA fragments with 6 individual RNA sequences; Figures 12-13 show data presented for vectors carrying 4 sets of RNA fragments containing any two RNA sequences; Figure 14 shows vectors carrying 3 Groups contain therapeutic data results presented by RNA fragments of any of the 3 RNA sequences.

The specific sequence is shown in Table 3 below.

Optionally, the viral vector includes a promoter and a targeting tag, the targeting tag can form the targeting structure of the composite structure in the organ tissue of the host, and the targeting structure is located on the surface of the composite structure, so The complex structure can seek and bind to the target tissue through the targeting structure, and deliver the RNA fragment into the target tissue.

For explanations about the above-mentioned viral vectors, RNA fragments, targeting tags, etc. in this embodiment, reference may be made to Embodiment 1, which will not be repeated here.

After the drug can be administered orally, inhaled, subcutaneously injected, intramuscularly injected or intravenously injected into the human body, it can be delivered to the target tissue through the RNA delivery system described in Example 1 to exert a therapeutic effect.

The drug can be used in combination with other Parkinson's disease drugs to improve the treatment effect, such as anticholinergics (Antan, etc.), antihistamines (diphenhydramine, amantadine, etc.), levodopa Drugs (Dopa, Sining, Xilaimei, etc.), dopamine receptor agonists (Texida, Xie Liangxing, Crepa, bromocriptine, etc.), monoamine oxidase B inhibitors (Sgining, Jin Siping, etc.) ), catecholamine oxygen methyltransferase inhibitors (Entocapone, etc.).

The medicine of this embodiment may also include a pharmaceutically acceptable carrier, which includes but is not limited to diluents, buffers, emulsions, encapsulation agents, excipients, fillers, adhesives, sprays, transdermal absorption Agents, wetting agents, disintegrating agents, absorption enhancers, surfactants, colorants, flavoring agents, adjuvants, desiccants, adsorption carriers, etc.

The dosage forms of the medicine provided in this embodiment can be tablets, capsules, powders, granules, pills, suppositories, ointments, solutions, suspensions, lotions, gels, pastes, and the like.

The medicine provided in this example uses a virus as a carrier, and the virus carrier is used as a mature injection. Its safety and reliability have been fully verified, and the druggability is very good. The final effective RNA sequence is packaged and delivered by endogenous exosomes, and there is no immune response, so there is no need to verify the safety of the exosomes. The drug can deliver various kinds of small molecule RNAs and has strong versatility. And the preparation of viral vectors is much cheaper and more economical than the preparation of exosomes or proteins, polypeptides and other substances. The drug provided by this application can be closely combined with AGO ₂ and enriched into a composite structure (exosome) after self-assembly in vivo, which can not only prevent its premature degradation and maintain its stability in circulation, but also benefit the receptor. Cellular uptake, intracytoplasmic release and lysosomal escape require low doses.

Example 3

On the basis of Embodiment 1 or 2, this embodiment provides an application of an RNA delivery system for treating Parkinson's disease in a drug, and the drug is a drug for treating Parkinson's disease. In this example, the application of the RNA delivery system in the treatment of Parkinson's disease is specifically described in conjunction with the following experiments.

First, LRRK2R1441G transgenic mice were selected for the experiment when they were 3 months old, and the experiment set up LPS intervention group and LPS non-intervention group. The LPS intervention group was treated with AAV-CMV-scrR/AAV-CMV-RVG-siR ^LRRK2 after 7 days of LPS intervention (AAV-CMV-scrR, AAV-CMV-RVG-siR ^LRRK2 are abbreviated as CMV-scrR, CMV- RVG-siR ^LRRK2 ).

As shown in Figure 1, we selected 12-week-old LRRK2 ^R1441G mice, intraperitoneally injected 5 mg/kg LPS for inflammation induction, and 7 days later, intravenously injected 5 mg/kg CMV-scrR or CMV-RVG-siR ^LRRK2 line ( Genetic) for a total of 2 weeks of injection. Mice were sacrificed after treatment, and the expression of LRRK2/S935 in striatum and substantia nigra pars compacta was quantitatively detected. Referring to Figure 1A, Western blot analysis of LRRK2/S935 protein levels in the striatum and substantia nigra pars compacta revealed α-tubulin as an internal loading control. Referring to Figure 1B, the quantitative display of LRRK2 protein levels shows that the LRRK2 protein levels in mice treated with AAV-CMV-scrR after LPS intervention were significantly higher than those in other groups, while the LRRK2 in mice treated with AAV-CMV-RVG-siR ^LRRK2 Protein levels were significantly lower. See Figure 1C-D, which show the results of LRRK2/S935 immunofluorescence staining (red) and neuronal immunofluorescence staining (red) of the striatum (Striatum) and substantia nigra pars compacta (SNpc), scale bar: 50 μm, the results showed that mice injected with AV-CMV-RVG-siR ^LRRK2 rescued the loss of TH neurons and could inhibit the activation of microglia, indicating that AV-CMV-RVG-siR ^LRRK2 released siRNA in the liver to assemble into exosomes After passing through the blood-brain barrier, it can enter the deep brain to function.

As shown in Figure 2, 12-week-old LRRK2 ^R1441G mice were selected and injected intraperitoneally with 5 mg/kg LPS to induce inflammation. After 7 days, 5 mg/kg AAV-CMV-scrR or AAV-CMV-RVG-siR was intravenously injected every 2 days. ^LRRK2 Genetic, injected for 2 weeks. After the treatment was terminated, the mice were sacrificed to observe the activation of microglia and the secretion of inflammatory factors. (AAV-CMV-scrR, AAV-CMV-RVG-siR ^LRRK2 are abbreviated as CMV-scrR, CMV-RVG-siR ^LRRK2 in the figure)

See Figure 2, anti-iba-1 antibody immunostaining shows activation of microglia in the striatum and substantia nigra pars compacta of R1441G mice, scale bar: 50 μm. Referring to Figure 3, after quantifying the number of microglia in the striatum and SNpc in Figure 2, it can be seen that the number of microglia in the striatum and SNpc of mice treated with AAV-CMV-scrR after LPS intervention was significantly higher Compared with the other groups, the number of microglia in the striatum and SNpc of mice treated with AAV-CMV-RVG-siR ^LRRK2 was significantly lower.

The above experiments can illustrate that intravenous injection of AAV-CMV-RVG-siR ^LRRK2 helps to inhibit LRRK2 in dopaminergic neurons, thereby reducing the neuropathological development of Parkinson's PD mice.

In this document, "upper", "lower", "front", "rear", "left", "right", etc. are only used to indicate the relative positional relationship between related parts, rather than limit the absolute positions of these related parts .

In this document, "first", "second", etc. are only used to distinguish each other, but do not indicate the degree of importance and order, and the premise of mutual existence.

In this paper, "equal", "same" and the like are not limitations in strict mathematical and/or geometric senses, and also include errors that can be understood by those skilled in the art and allowed by manufacturing or use.

Unless otherwise indicated, numerical ranges herein include not only the entire range between its two endpoints, but also several subranges subsumed therein.

The preferred specific embodiments and embodiments of the present application have been described in detail above in conjunction with the accompanying drawings, but the present application is not limited to the above-mentioned embodiments and embodiments. Various changes are made under the premise of the application concept.

Claims (19)

1. An RNA delivery system for treating Parkinson's, characterized in that the system comprises a viral vector, the viral vector carries an RNA fragment capable of treating Parkinson's, and the viral vector can be enriched in the organ tissue of a host, And endogenously and spontaneously form a composite structure containing the RNA fragment capable of treating Parkinson's disease in the host organ tissue, and the composite structure can send the RNA fragment into the target tissue to achieve Parkinson's treatment.
2. The RNA delivery system for treating Parkinson's according to claim 1, wherein the viral vector is an adenovirus-associated virus.
3. The RNA delivery system for treating Parkinson's according to claim 2, wherein the adeno-associated virus is adeno-associated virus type 5, adenovirus-associated virus type 8 or adenovirus-associated virus type 9.
4. The RNA delivery system for treating Parkinson's according to claim 1, wherein the RNA fragment comprises one, two or more specific RNA sequences with medical significance, and the RNA sequences are medically significant siRNA, shRNA or miRNA.
5. The RNA delivery system for treating Parkinson's according to claim 1, wherein the viral vector comprises a promoter and a targeting tag, and the targeting tag can form the composite structure in the organ tissue of the host The targeting structure is located on the surface of the composite structure, and the composite structure can find and bind to the target tissue through the targeting structure, and deliver the RNA fragment into the target tissue.
6. The RNA delivery system for treating Parkinson's according to claim 4, wherein the viral vector comprises any one of the following lines or a combination of several lines: promoter-RNA fragment, promoter-targeting Tag, promoter-RNA segment-targeting tag; each of the viral vectors includes at least one RNA segment and one targeting tag, and the RNA segment and targeting tag are located in the same line or in different lines.
7. The RNA delivery system for treating Parkinson's according to claim 6, wherein the viral vector further comprises a flanking sequence, a compensation sequence and a loop sequence that can fold the circuit into a correct structure and express it, the Flanking sequences include 5' flanking sequences and 3' flanking sequences;

   The viral vector includes any one of the following lines or a combination of several lines: 5'-promoter-5' flanking sequence-RNA fragment-loop sequence-compensating sequence-3' flanking sequence, 5'-promoter-target To tag, 5'-promoter-targeting tag-5'flanking sequence-RNA fragment-loop sequence-compensating sequence-3'flanking sequence.
8. The RNA delivery system for treating Parkinson's according to claim 6, wherein the 5' flanking sequence is ggatcctggaggcttgctgaaggctgtatgctgaattc or a sequence with a homology greater than 80%;

   The loop sequence is gttttggccactgactgac or a sequence whose homology is greater than 80%;

   The 3' flanking sequence is accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag or a sequence whose homology is greater than 80%;

   The compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-5 bases are deleted.
9. The RNA delivery system for treating Parkinson's as claimed in claim 6, characterized in that, when there are at least two circuits in the viral vector, adjacent circuits are connected by a sequence consisting of sequences 1-3;

   Wherein, sequence 1 is CAGATC, sequence 2 is a sequence consisting of 5-80 bases, and sequence 3 is TGGATC.
10. The RNA delivery system for treating Parkinson's as claimed in claim 9, characterized in that, when there are at least two lines in the viral vector, adjacent lines pass through sequence 4 or homology with sequence 4 More than 80% of the sequences are connected;

    Wherein, sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC.
11. The RNA delivery system for treating Parkinson's according to claim 1, wherein the organ tissue is liver, and the composite structure is exosome.
12. The RNA delivery system for treating Parkinson's according to claim 5, wherein the targeting tag is selected from targeting peptides or targeting proteins with targeting function.
13. The RNA delivery system for treating Parkinson's according to claim 12, wherein the targeting peptide comprises RVG targeting peptide, GE11 targeting peptide, PTP targeting peptide, TCP-1 targeting peptide, MSP targeting peptide targeting peptide;

    The targeting proteins include RVG-LAMP2B fusion protein, GE11-LAMP2B fusion protein, PTP-LAMP2B fusion protein, TCP-1-LAMP2B fusion protein, and MSP-LAMP2B fusion protein.
14. The RNA delivery system for treating Parkinson's according to claim 4, wherein the length of the RNA sequence is 15-25 nucleotides.
15. The RNA delivery system for treating Parkinson's according to claim 14, wherein the RNA capable of treating Parkinson's is selected from the group consisting of: siRNA of LRRK2 gene, or an RNA sequence with more than 80% homology to the above sequence , or a nucleic acid molecule encoding the above RNA.
16. The RNA delivery system for treating Parkinson's according to claim 15, wherein the siRNA of the LRRK2 gene comprises AUUAACAUGAAAAUAUCACUU, UUAACAAUAUCAUAUAAUCUU, AUCUUUAAAAUUUGUUAACGC, UUGAUUUAAGAAAAUAGUCUC, UUUGAUAACAGUAUUUUUCUG, other sequences that inhibit the expression of the LRRK2 gene, and sequences homologous to the above sequences Sequences with sex greater than 80%.
17. The RNA delivery system for treating Parkinson's of claim 1, wherein the delivery system is a delivery system for use in mammals including humans.
18. A use of the RNA delivery system for treating Parkinson's according to any one of claims 1-17 in medicine.
19. The application according to claim 18, wherein the medicine is a medicine for the treatment of Parkinson's and related diseases, and the administration mode of the medicine comprises oral administration, inhalation, subcutaneous injection, intramuscular injection, and intravenous injection.

Images