CN104771763A - DNA vaccine for central nervous system - Google Patents

Abstract

The present invention discloses a preparation method of a DNA vaccine for central nervous system, and applications of the DNA vaccine in central nervous system disorders such as Parkinson's disease.

Description

A kind of DNA vaccination for central nervous system

Technical field

One aspect of the present invention relates to the pathological effect of Nogo protein in parkinsonism and the value research as drug target; Relate to Nogo protein on the other hand in preparation for the application in the biological engineering DNA vaccination of central nervous system, and comprise vaccine and the vaccine preparation method of the DNA fragmentation of described Nogo protein of encoding.

Background technology

Parkinsonism (Parkinsonism, PD) betides adult's black substance above middle age and nigro-striatal pathway degenerative disease.Generally acknowledge that its cause of disease is the degeneration of neurocyte at present, major lesions position is at black substance and striatum.Wherein have a kind of neurocyte being called as nigral cell, the progressively forfeiture of minimizing, the function gradually of nigral cell quantity, causes dopamine to reduce, thus causes the generation of PD.At present, only have and by means such as prevention, surgical intervention and rehabilitations, PD is treated, but effect is not fully up to expectations.Therefore, utilize some to have neuroprotective, promote degenerative neurological regeneration and promote that the treatment means that neural plasticity is rebuild is likely treat the more effective measure of PD at present.

Myelin and associated protein thereof play an important role in neuranagenesis.After damaged, central nervous system (Central Nervous System, CNS) neural axis cannot regenerate and cause permanent damage.This suppression to nerve fiber regeneration is to a great extent because Nogo protein hinders axonal regeneration to cause.Nogo protein-A type is filamentous actin (Nogo-A), myelin phospholipid associated glycoprotein (Myelin-associatedglycoprotein not, and oligodendrocyte myelin glycoprotein (Oligodendrocyte-myelinglycoprotein MAG), OMgp), being positioned at the Jie Pang district of myelinated fiber, is the main constitutive protein of the myelin suppressing neuranagenesis.They, by common receptor NgR, play inhibitory action by unified signal path to neuranagenesis.Tenasin-C (TNC), Tenasin-R (TNR), be positioned on the bright Fei Shi joint of myelinated fiber, and they play an important role in adjustment neuranagenesis and neural plasticity.

Discovered in recent years, the pathology that myelin likely participates in parkinsonism directly develops.In patient's brain that parkinsonism is early stage, when even also there is not obvious clinical symptoms, the ANOMALOUS VARIATIONS of myelin can be detected.And there is the abnormal the easiest affected brain district of parkinsonism patient exactly, region in myelin.In addition, research finds, myelin plays an important role in the dependent Synaptic plasticity of experience regulates.This illustrates that myelin and associated protein thereof are also likely the drug targets for the treatment of parkinsonism or other central nervous system's degeneratioies.

DNA vaccination is a kind of new generation vaccine.It utilizes the DNA sequence of vector expression coding destination protein.DNA vaccination has that safety is good, stability is high, easy design, easily large-scale production can the advantage such as the cell of inducing T cell and B cell mediation and humoral immunization.Nogo-A, MAG, OMgp, TNC and TNR suppress neuranagenesis.Block above molecule and not only can promote neuranagenesis, and have protective effect to neuron.At present, in the inhibition effect attempting elimination molecule, achieved success in various degree.Existing bibliographical information utilizes the rat model of coding MAG, TN-R and Nogo-A recombinant DNA vaccine treatment spinal cord injury, finds that this vaccine has very strong improvement result to the behavior of rat after spinal cord injury and neuranagenesis.Within after vaccination 8 weeks, by spinal cord dorsal part Hemisected injany, compared with matched group, vaccination group creates the regeneration (CST) of healthy corticospinal tract axon.Inoculate the facilitation of this DNA vaccination to neuranagenesis, the animal model of traumatic brain injury have also been obtained checking.Partial Mechanism research finds, this DNA vaccination of coding Nogo protein can regulate and control the expression of spinous process nerve growth factor, and is realized by its neuroprotective.We result of study display Nogo-A, MAG, OMgp, TNC and TNR may play an important role to PD pathology.

Central nervous system's degeneration such as apoplexy, parkinsonism also exist a lot of similarity on pathomechanism and cure mechanism.The present invention finds, Nogo-A, MAG, OMgp, TNC and TNR may be the target spots for the treatment of PD.Based on this, the present invention constructs the gene vaccine of coding Nogo-A, MAG, OMgp related antigen fragment, and has carried out comprehensive evaluation to the safety of this vaccine and effectiveness on APP/PS1 double transgenic model mice.Result shows, and this vaccine, on APP/PS1 double transgenic model mice model, has delayed the pathological evolution of PD.

Summary of the invention

Data provided by the invention have set forth Nogo protein Nogo-A, MAG, Omgp, TNC and TNR pathomechanism in parkinsonism clearly.And on Research foundation, develop the novel DNA vaccines of coding Nogo-A, MAG and OMgp associated antigen epitopes fragment.This vaccine can the pathological development of prevention and therapy PD on PD model mice APP/PS1.

The object of the present invention is to provide Nogo protein Nogo-A, MAG, Omgp, TNC and TNR in the experimental data of PD pathomechanism; DNA vaccination of coding myelin endogenous binding protein and its production and use.

An aspect of of the present present invention is to find that Nogo protein Nogo-A, MAG, Omgp, TNC and TNR participate in the pathological development of PD, and finds that they are new drug targets for the treatment of PD.

An aspect of of the present present invention is to provide a DNA vaccination, and described vaccine is formed primarily of the 1-5Ig region of encoding rat MAG, outer 8 the liposome receptor-like proteins (8LRP) of encoding murine OMgp born of the same parents, the N end of encoding human bNogo-A, 66 amino acid whose DNA fragmentations of encoding human Nogo-A born of the same parents outer end.

Another aspect of the present invention is also the method providing these vaccines of preparation, and described method comprises the steps:

1. construction recombination plasmid, is linked in sequence described vaccine genetic fragment separately and is subcloned into vector plasmid.

2. carry out double digestion by restricted enzyme.

3. alanine connexon be convenient between two adjacent domains polypeptide fold.

4. check synthetic product by PCR and order-checking, confirm that products therefrom is required DNA vaccination.

5. utilize the method for electrotransfection, immunity is carried out to vaccine.

Further, vector plasmid of the present invention is pcDNA3.1, and described restricted enzyme is BamH I and Xba I.

Another aspect of the invention is to provide the application of described DNA vaccination in prevention central nervous system pathological change, and described central nervous system includes but not limited to following disease: parkinsonism, multiple sclerosis, spinal cord injury, traumatic brain injury, apoplexy and the cerebral tumor etc.

Detailed description of the invention

Experimental technique

One, co-immunoprecipitation

I: prepare cerebral tissue lysate

Get an Adult Rat Brain, put into Potter-Elvehjem Tissue Grinders, add 6mL lysate (10mM Tris-hydrochloric acid, pH=9,150mM sodium chloride solution, 0.5%Triton x-100,1% NaTDC, 0.5% sodium lauryl sulphate (SDS), 2mM ethylenediaminetetraacetic acid (EDTA) and protease inhibitor) after evenly grind on ice; Then tissue homogenate is forwarded in 1.5mL EP pipe, slowly rock at 4 DEG C 20 minutes (EP pipe is placed on horizontal shaker on ice); And then at 4 DEG C with 16000rcf centrifugal 15 minutes; Collect in supernatant to new 1.5mL EP pipe.It is 6mg/mL that the sample BCA protein assay kit collected detects protein concentration.

II: cleaning

20mg brain albumen is diluted with 10mL balanced salt solution PBS; 1 hour is hatched at 4 DEG C after brain albumen after dilution is added 150 μ L Protein-A Sepharose beads;

III: immunoprecipitation

Prepare following solution: 1, sepharose 4B: add protein A/G plus (santa cruz:sc-2003) 50 μ L to each test tube; 2, brain albumen: containing brain albumen 1mg in 0.5mL volume; 3, prepare antibody to be added in following ratio: a) anti-APP (A8717from Sigma): 1 μ L simultaneously; B) anti-MAG (chemicon, MAB1567): 1 μ L; C) anti-Nogo A (Abeam:ab62024): 2 μ L.D) simulation contrast: only containing brain albumen and sepharose 4B.

Subsequently the brain albumen of respective amount and sepharose 4B are shaken overnight incubation at 4 DEG C.

IV: cleaning

With RIPA lysate (150mM Nacl solution, 1%NP-40,0.5%DOC (deoxycholic acid), 0.1%SDS and 50mM Tris, pH=8.0) clean sepharose 4B five times, after each 10 minutes, 3000rpm/ minute, centrifugal 5 minutes, collects sepharose 4B.

V: eluting

72 DEG C of heating 10 minutes after sepharose 4B is resuspended containing 2 × SDS albumen buffer of beta-mercaptoethanol with 50 μ L.

VI: Western blot

Application of sample in the following order on albumin glue:

1, brain albumen: 22.5 μ g; 2, APP:30 μ L; 3, Nogo A:30 μ L; 4, simulation contrast: 30 μ L; 5, brain albumen: 45 μ g; 6, APP:30 μ L; 7, Nogo A:30 μ L; 8, simulation contrast: 30 μ L; 9, protein standard sample: 10 μ L; 10, macromolecule protein standard sample: 10 μ L.

With constant current 350mA transferring film 90 minutes after electrophoresis.Then 1 hour is closed with the defatted milk powder room temperature of 5%.

Immune-blotting method is carried out respectively subsequently: anti-NogoA (1:500, ab62024, Abcam) with the antibody of following concentration; Anti-MAG (1:1000, MAB1567, Chemicon); Anti-App (1:1000, MAB348, Chemicon).

Two, enzyme-linked immunosorbent assay

I. separation and Culture cortical neuron

1. bed board: after PDL thaws, with DMEM by bed board after the dilution proportion of 1: 50,4 DEG C are spent the night.

2. within second day, prepare following solution and culture medium:

HBS=HBSS+350mg/L NaHCO ₃(by 1mM HEPES adjust ph)

Adhere-wall culture base=DMEM+10%FBS+1 × L-Glu+P/S (100 × storing solution, 1: 1000 dilution)

Growth medium=Neurobasal medium+2%B27+1 × L-Glu+P/S

Digestion HBS buffer (every tire Mus 5mL)=2.5ml HBSS+2.5mL pancreatin (0.25%)

3. peel off cerebral tissue: with 70% alcohol disinfecting apparatus, by after birth 0-3 days young Mus broken end and the cerebral cortex of mice is separated being put in the culture dish filling HBS on ice, shred the small pieces of growth 0.5-1mm.

Tissue to move in 15mL conical tubes and with HBS cleaning twice by 4.a.; B. add the digestion HBS of 3mL preheating, hatch 20 minutes for 37 DEG C; C. the adherent culture medium cleaning twice of rear use preheating is hatched; D. 15 times are blown and beaten up and down with 1000 μ L pipettors; E. count with after 70 μm of frit cell suspension.

5. inoculating cell: cell suspension 1500rpm discards supernatant after centrifugal 5 minutes, is inoculated into after hanging in the porous plate with PDL bed board, is placed in 37 DEG C, 5%CO with adhere-wall culture basic weight ₂in incubator.

6. cultivate: second day, change liquid by growth medium half amount; After this, every 2 ~ 3 days half amounts change liquid;

II. with Nogo protein process cell

1. use culture medium diluted protein

Following albumen culture medium is diluted to respective concentration.

Myelin associated glucoprotein (MAG), Nogo-A nitrogen end 566-748 fragment (Nogo-N; 3728_NG, R & D), Nogo-A fragment (Nogo66) oligodendrocyte myelin glycoprotein OMgp, tendon glycoprotein-R (TNR), tendon glycoprotein-C (TNC).

2. the culture medium in raw sheet hole is sopped up gently rear every hole and add 200 μ L diluted protein.

3. at 37 DEG C, 5%CO ₂cultivate 2 hours or 24 hours in cell culture incubator.

III. enzyme linked immunosorbent assay (ELISA) detects A β _1-42

1. (WAK0290-6601, for A β to prepare reagent _1-42eLISA kit, for A β _1-42wAKO292-62301):

ELISA detection porous plate is opened after all ELISA reagent rises to room temperature;

With diluent, standard substance are diluted to following series concentration: 2.5pmol/L, 5pmol/L, 10pmol/L, 25pmol/L, 50pmol/L, 100pmol/L.

With distilled water dilution 20 × cleanout fluid to 1 × for subsequent use.

2. collect culture medium and labelling from the cell place plate of Nogo protein process.

3. the culture medium of collection is respectively got 100 μ L and be added to ELISA detection porous plate, standard substance also respectively add sealing detection plate after in 100 μ L to plate, spend the night at 4 DEG C.

4. discard in plate after solution, clean 5 times.

5. seal after every hole adds TMB solution 100 μ L, under room temperature lucifuge condition, hatch 30 minutes.

6. every hole adds 100 μ L stop buffers.

Plate is read by microplate reader at 450nm wavelength in 7.30 minutes.

Three, Wen Erji dyeing

With FD Rapid Golgistain test kit, operating procedure is according to instruction in test kit, specific as follows:

I. brain sections is prepared by after sacrifice, carefully take out brain rapidly, immerse after cleaning in deionized water in the test tube that A+B equivalent mixed liquor (preparation in 24 hours in advance, does not shake) is housed, room temperature keeps in Dark Place 2 weeks (note: change A+B equivalent mixed liquor next day);

1. put into the test tube that C liquid is housed after being taken out from A+B mixed liquor by brain, 4 DEG C keep in Dark Place 48 hours (note: change C liquid next day);

2. by brain vibrations microtome in cut into slices, thick 150 μm of sheet, be placed on 0.1M DPBS prepare 6% sucrose solution in 4 DEG C keep in Dark Place for subsequent use.

II. staining procedure

1. being placed on by brain sheet bleachinges and dyeing in ware, by rinsed with deionized water 2 times, and each 2 minutes;

2. with vacuum extractor, deionized water is exhausted, add the mixed liquor that dyes in right amount (D liquid: E liquid: deionized water=1: 1: 2) hatch 10 minutes.

3. with vacuum extractor will dye mixed liquor exhaustion, add washed with de-ionized water twice, each 4 minutes;

4. brain sheet is moved on microscope slide, drip 50,75,95% ethanol serial dehydration of new preparation successively, each concentration 4 minutes;

5. drip 100% dehydration of alcohol, each 4 minutes, totally 4 times;

6. drip dimethylbenzene, each 4 minutes, totally 3 times;

7. drip appropriate neutral gum, use coverslip mounting; With transparent nail polish by coverslip all round closure, dry, keep in Dark Place.

Four, immunofluorescence

I. mouse brain section

1. by after sacrifice, carefully take out brain, put into 4% paraformaldehyde solution after cleaning in 4 DEG C of DPBS solution after, fix 48 hours;

2. after brain being taken out from paraformaldehyde, put into 40% sucrose solution dehydrated overnight;

3. cut into slices in freezing microtome by brain, thick 16 μm of sheet, room temperature is dried latter-20 DEG C and is saved backup.

II. immunofluorescence step

1. clean: clean section 3 times with 0.1M DPBS/0.3%Triton-100, after each 10 minutes, residual cleaning liquid filter paper is sopped up;

2. close: hatch 1 hour with 0.1M DPBS/0.5%Triton x-100/10% donkey serum room temperature;

3. hatch Primary antibodies: section is hatched Primary antibodies (with 0.1M DPBS/0.5%Triton x-100/5% donkey serum-dilution), 4 DEG C are spent the night;

4. clean: clean section 3 times with 0.1M DPBS/0.3%triton-100, each 10 minutes;

5. hatch secondary antibody: section is hatched corresponding fluorescence secondary antibody (with 0.1M DPBS/0.3%Tritonx-100/5% donkey serum-dilution), room temperature lucifuge 1 hour;

6. clean: with 0.1M DPBS/0.3%Triton x-100 lucifuge cleaning section 3 times, each 10 minutes;

7. after residual cleaning liquid sops up by mounting: a., drip appropriate containing after the mountant of DAPI with coverslip mounting (avoiding bubble to produce); B. with transparent nail polish by coverslip all round closure, dry, lucifuge 4 DEG C preservation.

Embodiment 1: the preparation of DNA vaccination of the present invention

Through immune analysis, in the present invention, have selected the DNA fragmentation (SEQ ID N0.2) of 8 liposome receptor-like proteins outside the DNA fragmentation (SEQ ID N0.1) in the 1-5Ig region of encoding rat MAG, encoding murine OMgp born of the same parents, the DNA fragmentation (SEQ ID N0.3) of encoding human Nogo-A N end and 66 amino acid whose DNA fragmentations (SEQ ID N0.4) of coding Nogo-A born of the same parents outer end and, as immunogen, build vaccine carrier.DNA vaccination comprises Mus MAGIg1-5, outer 8 the liposome receptor-like proteins of Mus OMgp born of the same parents, people Nogo-AN hold and 66 aminoacid of Nogo-A born of the same parents outer end, and is inserted between each sub-clone sequence by 3-alanine junctional complex, so that polypeptide chain folds.Its concrete preparation method is as follows:

One, material: pCDNA3.1 plasmid, DH5 α competent cell, ammonia benzyl antibiotic solution and flat board, Accuprimepfx Polymerase high-fidelity amplification enzyme, BamH I restricted enzyme, Sac II restricted enzyme, Not I restricted enzyme, Pst I restricted enzyme, Xba I restricted enzyme, Ligase ligase.

Two, method

Build pCDNA3.1-MAGIg1-5+AAA+0Mgp8+AAA+Nogo-N+AAA+Nogo_66 carrier.

Have selected the DNA fragmentation in the 1-5Ig region of encoding rat MAG, the DNA fragmentation of outer 8 the liposome receptor-like proteins of encoding murine OMgp born of the same parents, the DNA fragmentation of encoding human Nogo-A N end, with coding Nogo-A born of the same parents outer end 66 amino acid whose DNA fragmentations as immunogen, build vaccine carrier.DNA vaccination comprises rat MAG Ig1-5, outer 8 the liposome receptor-like proteins of mice OMgp born of the same parents, people Nogo-A N hold and 66 aminoacid of Nogo-A born of the same parents outer end, and is inserted between each sub-clone sequence by 3-alanine junctional complex, so that polypeptide chain folds.

(1) aim sequence that will increase is as follows:

SEQ ID N0.1 rat MAG (1524bp):

atgatattccttaccaccctgcctctgttttggataatgatttcagcttctcgaggggggcactggggtgcctggatgccctcgtccatctcagccttcgagggcacgtgtgtctccatcccctgccgtttcgacttcccggatgagctcagaccggctgtggtacatggcgtctggtatttcaacagtccctaccccaagaactacccgccagtggtcttcaagtcccgcacacaagtggtccacgagagcttccagggccgtagccgcctgttgggagacctgggcctacgaaactgcaccctgcttctcagcacgctgagccctgagctgggagggaaatactatttccgaggtgacctgggcggctacaaccagtacaccttctcggagcacagcgtcctggacatcatcaacacccccaacatcgtggtgcccccagaagtggtggcaggaacggaagtagaggtcagctgcatggtgccggacaactgcccagagctgcgccctgagetgagetggctgggccacgaggggctaggggagcccactgttctgggtcggctgcgggaggatgaaggcacctgggtgcaggtgtcactgctacacttcgtgcctactagagaggccaacggccaccgtctgggctgtcaggctgccttccccaacaccaccttgcagttcgagggttacgccagtctggacgtcaagtaccccccggtgattgtggagatgaattcctctgtggaggccattgagggctcccatgtcagcctgctctgtggggctgacagcaacccgccaccgctgctgacttggatgcgggatgggatggtgttgagggaggcagttgctgagagcctgtacctggatctggaggaggtgaccccagcagaggacggcatctatgcttgcctggcagagaatgcctatggccaggacaaccgcacggtggagctgagcgtcatgtatgcaccttggaagcccacagtgaatgggacggtggtggcggtagagggggagacagtctccatcctgtgttccacacagagcaacccggaccctattctcaccatcttcaaggagaagcagatcctggccacggtcatctatgagagtcagctgcagctggaactccctgcagtgacgcccgaggacgatggggagtactggtgtgtagctgagaaccagtatggccagagagccaccgccttcaacctgtctgtggagtttgctcccataatccttctggaatcgcactgtgcagcggccagagacaccgtgcagtgcctgtgtgtggtaaaatccaacccggaaccctccgtggcctttgagctgccttcccgcaacgtgactgtgaacgagacagagagggagtttgtgtactcagagcgcagcggcctcctgctcaccagcatcctcacgctccggggtcaggcccaagccccaccccgcgtcatttgtacctccaggaacctctacggcacccagagcctcgagctgcctttccagggagcacaccga

The nucleotide (645bp) of outer 8 the liposome receptor-like proteins of SEQ ID N0.2 coding OMgp8 born of the same parents:

acatgcacagagaggcacaggcatgtggactgttcaggcagaaacttgactacattaccacctggactgcaggagaacattatacatttaaacctgtcttataaccactttactgatctgcataaccagttaaccccatataccaatctgagaaccctggatatttcaaacaacaggcttgaaagtctgcctgctcagttacctcggtctctctggaacatgtctgctgctaacaacaatattaaacttcttgacaaatctgatactgcttatcagtggaaccttaaatacctggatgtttctaagaatatgctggaaaaggttgttctcattaaaaataccctaagaagtctcgaggttcttaacctcagcagtaacaagctttggacagttccaaccaacatgccttccaaactgcatatcgtggacctgtctaataactcactgacacaaatccttccagggacattaataaacctgacaaatctcacacatctttacctgcacaacaataaattcacattcattccagaacagtcttttgaccaacttttgcagttgcaagagataactcttcataataacaggtggtcatgtgaccataaacaaaacattacttacttattgaagtgggtgatggaaacg

SEQ ID N0.3Nogo-N(555bp)：

atggaagacctggaccagtctcctctggtctcgtcctcggacagcccaccccggccgcagcccgcgttcaagtaccagttcgtgagggagcccgaggacgaggaggaagaagaggaggaggaagaggaggacgaggacgaagacctggaggagctggaggtgctggagaggaagcccgccgccgggctgtccgcggccccagtgcccaccgcccctgccgccggcgcgcccctgatggacttcggaaatgacttcgtgccgccggcgccccggggacccctgccggccgctccccccgtcgccccggagcggcagccgtcttgggacccgagcccggtgtcgtcgaccgtgcccgcgccatccccgctgtctgctgccgcagtctcgccctccaagctccctgaggacgacgagcctccggcccggcctccccctcctcccccggccagcgtgagcccccaggcagagcccgtgtggaccccgccagccccggctcccgccgcgcccccctccaccccggccgcgcccaagcgcaggggctcctcgggctcagtg

SEQ ID N0.4Nogo-66(198bp)：

aggatatacaagggtgtgatccaagctatccagaaatcagatgaaggccacccattcagggcatatctggaatctgaagttgctatatctgaggagttggttcagaagtacagtaattctgctcttggtcatgtgaactgcacgataaaggaactcaggcgcctcttcttagttgatgatttagttgattctctgaag

(2) following PCR primer is designed respectively according to aim sequence:

MAGIg1：

5’-CGGGATCCATGATATTCCTTACCACCCT-3’BamHI(SEQ ID N0.5)

5’-TCCCCGCGGCTCGGTGTGCTCCCTGGAA-3’Sac II(SEQ ID N0.6)

OMgp8：

5’-GCGCCCGCGGCAACATGCACAGAGAGGCACAG-3’Sac II(SEQ IDN0.7)

5’-GGCGGCGGCCGCCGTTTCCATCACCCACTTC-3’Not I(SEQ ID N0.8)

Nogo-N

5’-TTGCGGCCGCAATGGAAGACCTGGACCAGTCT-3’Not I(SEQ IDN0.9)

5’-AAACTGCAGCCACTGAGCCCGAGGAGCCCCT-3’Pst I(SEQ ID N0.10)

Nogo-66

5’-AAACTGCAGCAAGGATATACAAGGGTGT-3’Pst I(SEQ ID N0.11)

5’-GCTCTAGATCACTTCAGAGAATCAACTA-3’Xba I(SEQ ID N0.12)

Three, the first step: with the cDNA of rat, mice and people for template, increase aim sequence respectively, and amplification system is as follows:

The object fragment of 1.MAG

Amplification system 1:

Following PCR program is used to increase:

Electrophoresis reclaims about 1524bp band;

The object fragment of 2.OMgp

Amplification system 2:

Following PCR program is used to increase:

Electrophoresis reclaims about 645bp band;

The object fragment of 3.Nogo-N

Amplification system 3:

Following PCR program is used to increase:

Electrophoresis reclaims about 556bp band;

The object fragment of 4.Nogo-66

Amplification system:

Following PCR program is used to increase:

Electrophoresis reclaims about 199bp band;

Second step: the above-mentioned corresponding electrophoresis of enzyme action reclaims fragment to obtain being with the object fragment of sticky end respectively.

1. reclaim the object fragment of MAGIgl with BamH I enzyme action, enzyme action system is as follows:

37 DEG C of enzyme action carry out enzyme action with Sac II after 1 hour again, and enzyme action system is as follows:

37 DEG C of enzyme action are crossed post and are reclaimed after 1 hour;

2. reclaim the object fragment of 0Mgp8 with Sac II enzyme action, enzyme action system is as follows:

37 DEG C of enzyme action carry out enzyme action with Not I after 1 hour again, and enzyme action system is as follows:

37 DEG C of enzyme action are crossed post and are reclaimed after 1 hour;

3., by the NogoN object fragment that Not I and Pst I double digestion reclaim, enzyme action system is as follows:

Cross post after during 37 DEG C of enzyme action 1 to reclaim;

4., by the Nogo-66 object fragment that Pst I and Xba I double digestion reclaim, enzyme action system is as follows:

37 DEG C of enzyme action are crossed post and are reclaimed after 1 hour;

5., with the pCDNA3.1 carrier that BamH I and Xba I double digestion reclaim, enzyme action system is as follows:

37 DEG C of enzyme action are crossed post and are reclaimed after 1 hour;

All fragments after 3rd step, connection enzyme action and carrier.

Linked system:

Competent cell DH5 α is transformed into after 16 DEG C of connection 8h.

The sequence information of each Insert Fragment in sequence verification recombinant clone, to confirm to obtain DNA vaccination of the present invention.

The PCR forward primer of MAG comprises an ATG start codon, and Nogo-66 downstream primer comprises a termination codon, is reacted subsequently by BamH I and Xba I two kinds of restriction enzymes double zyme cuttings.Four sequences are sequentially attached, and insert pcDNA3.1 carrier.The plasmid of synthesis is through order-checking qualification.

Embodiment 2: the qualification that DNA vaccination of the present invention is expressed

Can the DNA vaccination built for qualification correction, and DNA vaccination, through being transiently transfected in HEK-293 cell, collects HEK-293 cell after 48h, extract albumen and carry out Westernblot test after lysate cracking.Transfection empty plasmid (vector) and do not have the cell (mock) of any plasmid of transfection as negative control.Anti-MAG antibody and anti-OMgp antibody can detect the band of correct size (150KDa), only transfection empty plasmid and do not turn any plasmid cell sample in then can't detect any band.These results illustrate DNA vaccination can in eukaryotic system correction, also again prove vaccine of the present invention build on correctness.

Embodiment 3: carry out the result after immunity with DNA vaccination of the present invention

With DNA vaccination 3 monthly ages of immunity or the APP/PS1 mice at 5 monthly ages, every 2 weeks by immune 1 time of intramuscular injection, continuous immunity 4 months.Each 50 μ g, and undertaken importing to increase immunogenicity by electric pulse.Other two groups of cotemporary APP/PS1 mices are given PBS, empty plasmid and the injection of coding eGFP plasmid group in the same way.Weekly by tail venous collection peripheral blood, gather serum and carry out immunology detection.The content of anti-MAG, Nogo-A and OMgp antibody in serum is detected by ELISA method.From anti-MAG, OMgp and Nogo-A antibody of the immune 6 weeks high titres that come into existence in immune serum.In the present invention, calculated in all immunity in the mice of DNA vaccination, the gauge producing the mice of MAG antibody in serum is got it right the positive positive rate of DNA vaccination reflection, found that nearly all mice all can produce MAG antibody.

Therefore, DNA vaccination of the present invention can prevention and therapy parkinsonism.Consider that parkinsonism and other central nervous system's degeneration have many similarities in some cure the disease mechanism and pathological development, as neuranagenesis suppresses, neuroprotective etc.This vaccine can also be used for the prevention and therapy of other central nervous system's degeneration, as traumatic brain injury, apoplexy, spinal cord injury, the cerebral tumor etc.

Claims (9)

1.DNA vaccine, described vaccine comprises 66 amino acid whose DNA fragmentations of the DNA fragmentation in the 1-5Ig region of encoding rat MAG, the DNA fragmentation of outer 8 the liposome receptor-like proteins of encoding murine OMgp born of the same parents, DNA fragmentation that encoding human Nogo-A N holds and encoding human Nogo-A born of the same parents outer end.

2. DNA vaccination as claimed in claim 1, it is characterized in that, the 1-5Ig region of described rat MAG is by the sequential coding shown in SEQ IDN0.1.

3. DNA vaccination as claimed in claim 1, is characterized in that, outer 8 the liposome receptor-like proteins of described mice OMgp born of the same parents are by the sequential coding shown in SEQ ID N0.2.

4. DNA vaccination as claimed in claim 1, is characterized in that, described people Nogo-A N holds by the sequential coding shown in SEQ ID N0.3.

5. DNA vaccination as claimed in claim 1, it is characterized in that, 66 aminoacid of described people Nogo-A born of the same parents outer end are by the sequential coding shown in SEQ ID N0.4.

6. the method for the DNA vaccination of preparation according to any one of claim 1-5, described method comprises the steps: construction recombination plasmid, described vaccine genetic fragment is separately linked in sequence and is subcloned into vector plasmid, double digestion is carried out by restricted enzyme, alanine connexon is convenient to polypeptide and is folded between two adjacent domains, check synthetic product by PCR and order-checking, confirm that products therefrom is required DNA vaccination.

7. method as claimed in claim 6, wherein said vector plasmid is pcDNA3.1.

8. method as claimed in claim 6, wherein said restricted enzyme is BamH I and Xba I.

9. the DNA vaccination according to any one of claim 1-5 is preventing central nervous system pathological change as the application in parkinsonism.