WO2006129867A2

WO2006129867A2 - ENHANCED EXPRESSION OF LACTOFERRIN mRNA BY LACRITIN

Info

Publication number: WO2006129867A2
Application number: PCT/JP2006/311371
Authority: WO
Inventors: Yoshiyuki Tamada; Mitsuyoshi Azuma
Original assignee: Senju Pharmaceutical Co., Ltd.
Priority date: 2005-06-01
Filing date: 2006-05-31
Publication date: 2006-12-07
Also published as: WO2006129867A3

Abstract

The present invention provides a prophylactic/therapeutic agent for ocular disease and various means that enable the development thereof. Specifically, the present invention provides a screening method for a compound having lacritin activity using a lacritin receptor expression cell; an agent of inducing lactoferrin, comprising a lacritin receptor expression cell; an agent of promoting lactoferrin secretion, comprising lacritin or a compound having lacritin activity; a method of promoting lactoferrin secretion using lacritin or a compound having lacritin activity; a method of identifying or producing a lacritin receptor expression cell; and the like.

Description

DESCRIPTION

ENHANCED EXPRESSION OF IACTOFERRIN mRNA BY IACRITIN

Technical Field

The present invention relates to a screening method for a compound having lacritin activity, an agent of regulating or an agent of inducing lactoferrin secretion, a method of regulating lactoferrin secretion, a method of identifying or producing a lacritin receptor expression cell, and the like.

Background Art Lacritin is a protein identified as a tear secretion promoting factor or a growth-factor-like protein (see International Patent Publication No.02/065943 and Sanghi, S. et al., Journal of Molecular Biology, 310, pp. 127-139 (2001)) For lacritin, the following 1) to 5) are reported: I)- Lacritin has an activity as a growth factor for a corneal epithelial cell and a lacrimal gland acinar cell.

2) Lacritin shows tear protein secretion promoting effect.

3) Lacritin is expressed in a cell derived from tissues such as the lacrimal gland, parotid gland, minor salivary gland, - submandibular gland, thyroid gland and corneal epithelium.

4) Eyedrops containing lacritin are likely to be useful in the treatment of ocular diseases such as dry eye syndrome, Sjogren's syndrome, and corneal epithelial wounds.

5) Compounds that bind to lacritin or lacritin receptors can be screened for using a cell expressing a lacritin receptor with a lacritin-dependent calcium signal as the index.

Meantime, lactoferrin, a protein contained in the milk and tears of humans, bovines and the like, is known to exhibit pharmacological actions such as antibacterial action and cell growth action. In ophthalmology, it is known that lactoferrin concentrations have been decreased in the tears of patients with dry eves due to Sjogren's syndrome, StevensrJohnson syndrome and the like (Ohashi, Y. et al., American Journal of Ophthalmology 136(2), pp. 291-299 (2003)). It is described that lactoferrin can be effective against corneal epithelial disorders due to ultraviolet rays, since administration of lactoferrin eye drops suppressed the progression of corneal epithelial defects due to ultraviolet irradiation in rats (Fujihara, T. et al., Cornea 19(2), pp. 207-211 (2000)).

However, no reports have been presented to date regarding the induction of lactoferrin expression in the presence of lacritin to act on particular cell. Disclosure of the Invention

The object of the present invention is to develop a compound having lacritin activity, a prophylactic/therapeutic agent for corneal epithelial disorders due to light stimulation, and the like. ■ The present inventors diligently investigated to solve the problem described above, and found that the expression of lactoferrin, one of tear proteins, is selectively induced by lacritin in a lacrimal gland acinar cell. Based on this finding, the inventors conceived that the expression of lactoferrin in a lacritin receptor expression cell such as a lacrimal gland acinar cell may serve as an index for the development of a compound having lacritin activity, and that lactoferrin is increased in the presence of lacritin or a compound having lacritin activity, thereby showing a protective effect against corneal epithelial disorders due to light stimulation, since lactoferrin is capable of exhibiting a protective effect against corneal epithelial disorders due to light irradiation, and completed the present invention. ■Accordingly, the present invention provides the following:

[1] A screening method for a compound having lacritin activity, which comprises (a) contacting a lacritin receptor expression cell with a test compound, and (b) evaluating whether or not the amount of lactoferrin expressed is increased.

[2] The method described in [1] above, wherein the cell is a lacrimal gland acinar cell.

[3] An agent of promoting lactoferrin secretion, comprising lacritin or a compound having lacritin activity.

[4] The agent described in [3] above, which is a prophylactic/therapeutic agent for ocular disease.

[5] The agent described in [4] above, wherein the ocular disease is a corneal epithelial disorder due to light stimulation.

[6] An agent of inducing lactoferrin, comprising a lacritin receptor expression cell.

[7] The agent described in [6] above, wherein the cell is a lacrimal gland acinar cell. [8] A method of promoting lactoferrin secretion, which comprises contacting a lacritin receptor expression cell with lacritin or a compound having lacritin activity.

[9] A cell whose lactoferrin expression is regulated, which is obtained by the method described in [8] above. [10] A method of identifying a lacritin receptor expression cell, which comprises (a) contacting a certain animal cell with lacritin or a compound having lacritin activity, and (b) evaluating whether or not the amount of lactoferrin expressed is increased. [11] A method of producing a lacritin receptor expression cell, which comprises (a) preparing an animal cell, (b) contacting the cell with lacritin or a compound having lacritin activity, and (c) evaluating whether or not the amount of lactoferrin expressed is increased. [12] A cell obtained by the method described in [11] above.

Brief Description of the Drawings Figure 1 shows an electrophoresis of the P.CR products of lactoferrin and 18s ribosome RNA in lacritin-treated monkey lacrimal gland acinar cells.

Figure 2 shows the results of an analysis of band intensity in Figure 1.

Figure 3 shows an electrophoresis of the PCR products of lysozyme and 18s ribosome RNA in lacritin-treated monkey lacrimal gland acinar cells.

Figure 4 shows the results of an analysis of band intensity in Figure 3.

Best Mode for Embodying the Invention 1. Screening method

The present invention provides a screening method for a compound having lacritin activity. The screening method of the present invention comprises, for example, (a) contacting a lacritin receptor expression cell with a test compound, and (b) evaluating whether or not the amount of lactoferrin expressed is increased.

"Lacritin activity" means any pharmacological action possessed by lacritin. Because lacritin is known to exhibit a range of actions, including growth action of a cell (e.g., a ocular cell such as a corneal cell, a conjunctival cell, and a lacrimal gland cell/ an acinar cell such as a lacrimal gland acinar cell, a salivary gland acinar cell, and a thymic acinar cell) and secretion promoting action of secretes such as tears and saliva, the lacritin activity can, for example, be one of these actions.

In the step (a) of the above-described screening method, the lacritin receptor expression cell is brought into contacted with the test compound. The contact of the test compound with the cell can be performed in a culture medium. For example, a method comprising culturing and passaging the cell by an ordinary method, then seeding them onto a culture plate, and, after the cell have adhered to the plate, adding the test compound, and the like can be used. The test compound may be any known or novel compound, and include, for example, a nucleic acid, a saccharide, a lipid, a protein, a peptide, an small organic compound, a compound library prepared using combinatorial chemistry technology, a random peptide library prepared by solid phase synthesis or the phage display method, or a naturally occurring component derived from a microorganism, an animal, a plant, a marine organism or the like, or the like.

A "lacritin receptor expression cell" means an animal cell expressing a lacritin receptor that mediates the expression of lactoferrin. the lacritin receptor expression cell can, for example, be a cell derived from an animal including a mammal such as mouse, rat, hamster, guinea pig, rabbit, dog, monkey or human, or from a bird such as chicken. The cell can also be exemplified by any cell present in the eye, with preference given to a lacrimal gland acinar cell. The cell can still also be a primary culture cell, a cell line derived from primary culture cell, a cell obtained by culturing an undifferentiated cell such as a stem cell (e.g., a differentiated cell) , a commercially available cell line, a cell line available from a cell bank, and the like. A lacritin receptor expression cell can be obtained by, for example, the identification method and production method described below. According to the screening method of the present invention, it is possible to select a compound having lacritin activity with the increase in the amount of lactoferrin expressed in such a cell as the index.

The culture medium in which lacritin receptor expression cell and a test compound are contacted can be chosen as appropriate according to the kind of a cell used and the like, and is exemplified by minimal essential medium (MEM) , Dulbecco's modified minimal essential medium (DMEM), F12 medium or RPMI1640 medium, and media comprising a mixture thereof as the basal medium. Examples of additives to the medium include insulin, epithelial growth factor (EGF) , fetal bovine serum (FBS), various antibiotics, and various vitamins. Cultivation conditions can also, be determined as appropriate according to the kind of a cell used and the like; for example, culture medium pH is about 6 to about 8, cultivation temperature is normally about 30 to about 40°C, and cultivation time is about 1 day to about 2 weeks.

In the step (b) of the above-described screening method, whether or not the amount of lactoferrin expressed in the lacritin receptor expression^' cell is increased in the presence of the test compound is evaluated. The evaluation of whether or not the amount of lactoferrin expressed is increased can be made by measuring the amount of lactoferrin mRNA or protein expressed, and comparing the measured amount expressed with the amount of lactoferrin expressed in the absence of the test compound.

The amount of lactoferrin mRNA or protein expressed can be determined using a method known per se. For example, the amount of mRNA expressed can be determined by a method such as Northern blotting or RT-PCR, and the amount of protein expressed can be determined by an immunological method such as ELISA or Western blotting.

A comparison of the amount expressed is performed on the basis of, for example, the presence or absence of a significant difference. Although the amount of lactoferrin expressed in the absence of a test compound may be an amount expressed determined before determining the amount expressed in the presence of the test compound, or a simultaneously determined amount expressed, it is preferable from the viewpoint of experimental accuracy and reproducibility that the amount be a simultaneously determined amount expressed. Additionally, in the screening method of the present invention, lacritin (protein) can be used as a positive control. The lacritin that can be used in the screening method of the present invention is the same as that mentioned in the ^' following 2. an agent of inducing lactoferrin. If an increased amount of lactoferrin expressed is revealed in the evaluation of the amount expressed, the test compound can be judged to be a compound having lacritin activity. The compound thus identified is useful as, for example, a prophylactic/therapeutic agent for ocular disease, for example, an agent of promoting the growth of a cell (e.g., a ocular cell such as a corneal cell, a conjunctival cell, and a lacrimal gland cell; an acinar cell such as a lacrimal gland acinar cell, a salivary gland acinar cell, and a thymic acinar cell) , an agent of promoting the secretion of tears and the like, or a cell protecting agent. Ocular diseases to which a compound obtained by the screening method of the present invention is applicable include diseases against which a pharmacological action of lacritin or lactoferrin can be effective, for example, corneal epithelial disorders due to inflammation, infections, and light stimulation (e.g., ultraviolet irradiation) , corneal epithelial wounds, and dry eye syndromes, including lacrimal hyposecretion, dry eye, meibomian gland dysfunction, Sjogren's syndrome, keratoconjunctivitis sicca, blepharitis, Stevens-Johnson syndrome, and dry eyes associated with VDT (visual display terminal) work, as well as keratinoconjunctival epithelial disorder, corneal epithelial disorder, corneal epithelial erosion, corneal ulcer, marginal blepharitis and ocular pemphigoid associated with dry eye, and the like. Preferably, the ocular disease is a corneal epithelial disorder due to light stimulation. According to the present invention, a compound having lacritin activity obtained by the screening method of the present invention is also provided. 2. An agent of inducing lactoferrin

The present invention provides an agent of inducing lactoferrin, comprising a lacritin receptor expression cell. The inducing agent of the present invention may be any inducing agent, as long as it comprises the above-described lacritin receptor expression cell as an active ingredient, and it may further comprise a cell other than a lacritin receptor expression cell, or may substantially comprise a lacritin receptor expression cell only. For example, when the use of the inducing agent substantially comprising a lacritin receptor expression cell only is intended, it is necessary to prepare a population of a cell substantially consisting of a lacritin receptor expression cell only; such a population of a cell can be prepared by, for example, culturing and growing a single cell that has been confirmed to express a lacritin receptor that mediates the expression of lactoferrin. After a cell marker (e.g., lacritin receptor) in a lacritin receptor expression cell is identified, a lacritin receptor expression cell can be purified by a method known per se, for example, method using flowcytometry or panning method.

The inducing agent of the present invention is capable of inducing lactoferrin in the presence of lacritin, and can hence exhibit a pharmacological action of lactoferrin. Therefore, the inducing agent requires support by lacritin or a compound having lacritin activity because of its nature. Accordingly, the inducing agent may further comprise a means (substance or medium) that enables the provision of lacritin, in addition to a lacritin receptor expression cell.

The means that enable the provision of lacritin is not subject to limitation, as long as it is lacritin (protein) as is or means that enable lacritin production, or means having lacritin activity, and include, for example, lacritin, a lacritin expression vector, a lacritin expression cell, a compound having lacritin activity and the like. The compound having lacritin activity may be any known or novel compound, as long as it possesses lacritine activity, and include, for example, a nucleic acid, a saccharide, a protein, a peptide, an small organic compound and the like:

The lacritin can be a naturally occurring or recombinant protein. Examples of the lacritin include lacritin derived from an animal including a mammal such as mouse, rat, hamster, guinea pig, rabbit, dog, monkey or human, or from a bird such as chicken; for example, when the use in a human or a human cell is intended, human lacritin (see, for example, GenBank/EBI databank accession numbers NM_033277 (cDNA) and ay005150 (genomic) ) is preferred. The lacritin may be a mutant wherein one or more amino acids have been substituted, added, deleted, modified and the like, as long as the potential for promoting lactoferrin secretion is retained in the lacritin receptor expression cell.

The lacritin can also be in a form distinguishable from naturally occurring lacritin (e.g., lacritin produced by a lacritin receptor expression cell) . ^λΛA form distinguishable" means that there is a detectable difference between the two lacritins being compared. Examples of lacritin in a form distinguishable from naturally occurring lacritin include lacritin wherein one or more amino acids are substituted, added, deleted, modified and the like so that it would have a different antigenicity from that of naturally occurring lacritin. For example, the lacritin wherein one or more amino acids are added so that it would have a different antigenicity can be lacritin with an epitope such as a histidine (His) tag, Flag tag, or Myc tag added thereto.

Lacritin can be prepared by a method known per se; for example, .1) lacritin may be recovered from a lacritin secretion site (e.g., lacrimal gland, corneum, conjunctivum, salivary gland, thymus and the like), 2) lacritin produced by a transformant prepared by transferring a lacritin expression vector to host cells (e.g., a bacterium of the genus Escherichia, a bacterium of the genus Bacillus, yeast, insect cells, insects, animal cells) may be recovered, or 3) lacritin may be synthesized by a cell-free system using rabbit reticulocyte lysate, wheat germ lysate, Escherichia coli lysate or the like. Lacritin is purified as appropriate by methods based on differences in solubility, such as salting- out and solvent precipitation; methods based mainly on differences in molecular weight, such as dialysis, ultrafiltration, gel filtration, and SDS-polyacrylamide gel electrophoresis; methods based on differences in electric charge, such as ion exchange chromatography; methods based on specific affinity, such as affinity chromatography and use of lacritin antibody; methods based on differences in hydrophobicity, such as reverse phase high performance liquid chromatography; methods based on differences in isoelectric point, such as isoelectric focusing; combinations thereof, and the like.

The lacritin expression vector may be a vector capable of expressing the above-described lacritin. The lacritin expression vector must be such that the polynucleotide that encodes lacritin is functionally linked to^' a promoter capable of exhibiting promoter activity in the target cells. The promoter used is not subject to limitation, as long as it is capable of functioning in the target cells; examples include viral promoters such as SV40-derived early promoter, cytomegalovirus LTR, Rous sarcoma virus LTR, MoMuLV-derived LTR, and adenovirus-derived early promoter, mammalian constitutive protein gene promoters such as β-actin gene promoter, .PGK gene promoter, and transferrin gene promoter, and the like. The promoter may also be a promoter specific to a lacritin receptor expression cell, including a promoter specific to a lacrimal gland acinar cell.

The expression vector preferably comprises a transcription termination signal, i.e., a terminator region, downstream of the polynucleotide that encodes lacritin. It may further comprises a selection marker gene (a gene that confers resistance to a drug such as tetracycline, ampicillin, kanamycin, hygromycin, or phosphinothricin, a gene that compensates for an auxotrophic mutation, and the like) for selection of a transformant cell.

The base backbone vector used as the expression vector is not subject to limitation, and include, for example, plasmid vectors and viral vectors such as those of retrovirus, adenovirus, adeno-associated virus and Sendai virus. When an expression vector is provided as the means enabling the provision of lacritin, the expression vector may be transferred to a lacritin receptor expression cell. Transfer of the expression vector to the cell can be achieved using a method known per se, for example, electroporation, calcium phosphate precipitation, microinjection, methods using lipids such as liposomes or cationic lipids, and the like. The expression vector (or a portion at least comprising the lacritin-coding region and a promoter region) may be incorporated in the genome of the lacritin receptor expression cell or not. Incorporation of the expression vector to the intracellular genome can be achieved using a method known per se, for example, a method using retrovirus, a method using a targeting vector enabling homologous recombination, and the like. A "lacritin expression cell" means any cell that express lacritin. Examples of the lacritin expression cell include a transformant obtained by transferring a lacritin expression vector to a host cell, and a naturally occurring cell that express lacritin. The lacritin expression cell can, for example, be a cell derived from an animal including a mammal such as mouse, rat, hamster, guinea pig, rabbit, dog, monkey or human, or from a bird such as chicken. The lacritin expression cell can also be cell such as a lacrimal gland cell, a parotid gland cell, a minor salivary gland cell, a submandibular gland cell, a thyroid gland cell, a corneal cell, a thymic cell, or a conjunctival cell (these cells are known to express lacritin) . The lacritin expression cell can still also be a primary culture cell, a cell line derived from a primary culture cell, a cell obtained by culturing an undifferentiated cell such as a stem cell (e.g., a differentiated cell) , a commercially available cell line, a cell line available from a cell bank, or the like. When a lacritin expression cell is provided as the means enabling the provision of lacritin, the cell may be identical to the lacritin receptor expression cell or may be different cell from the lacritin receptor expression cell. In other word, the inducing agent of the present invention comprises a lacritin receptor and a lacritin-expressing cell, or a lacritin receptor expression cell and a lacritin expression cell.

The inducing agent of the present invention is also provided without being accompanied by a means enabling the provision of lacritin. In this case, the inducing agent can be prepared to induce lactoferrin as appropriate for the application to an environment in which lacritin is present, for example, the above-described lactoferrin expression site. The inducing agent of the present invention can comprise any carrier or medium and the like, in addition to a lacritin receptor expression cell. Examples of any carrier include a pharmaceutically acceptable carrier (described below) . Examples of any medium include cell culture medium, medium additive and the like.

The inducing agent of the present invention can be used as a pharmaceutical, an investigational reagent or the like, or in vivo or in vitro. When the inducing agent of the present invention is used as a pharmaceutical, it can be used in the dosage form of eye drops, patches, ointments, lotions, creams and the like.

In one embodiment, the inducing agent of the present invention can be a lactoferrin-producing agent (or production system) . According to the producing agent, it is possible to acquire naturally occurring lactoferrin in large amounts at high efficiency.

In another embodiment, the inducing agent of the present invention can be a cell transplantation agent of transplanting a lacritin receptor expression cell to an animal such as a mammal. In this case, the lacritin receptor expression cell may be provided in the form of a cell sheet, cell layer or tissue equivalent for transplantation (hereinafter, optionally abbreviated as "graft") . Techniques concerning graft preparation are described in detail in, for example,

WO03/084431, WO03/026712, WO03/009783, WO00/29553, WO96/13974, Japanese Patent Unexamined Publication Nos .2003-38170 and 2001-161353, US20020039788 and elsewhere. Also, the cell transplantation agent enables xenogeneic transplantation, allogeneic transplantation or syngeneic transplantation depending on the kind of lactoferrin expression cell contained therein and the kind of animal intended to receive the graft. For example, syngeneic transplantation in a human is desired, a graft prepared from a cell culture of lacrimal gland acinar cells collected from one eye can be transplanted to the other eye. The cell transplantation agent can, for example, be used as a prophylactic/therapeutic agent for ocular disease. Although the ocular disease to which the cell transplantation agent is to be applied is not subject to limitation, as long as a pharmacological action of lactoferrin is effective in preventing or treating the disease, and it is exemplified by the above-described diseases, with preference given to a corneal epithelial disorder due to light stimulation (e.g., ultraviolet irradiation) .

The inducing agent of the present invention enables the persistent provision of lactoferrin in the presence of lacritin. Therefore, the inducing agent of the present invention is highly useful in that a pharmacological action of lactoferrin is exhibited for a long period. 3. An agent of regulating lactoferrin secretion

The present invention provides an agent for regulating lactoferrin secretion. The regulating agent of the present invention comprises at least lacritin, a lacritin expression vector, a lacritin expression cell, a compound having lacritin activity, a lacritin inhibitor, a lacritin inhibitor expression vector or a lacritin inhibitor expression cell. The regulating agent of the present invention may comprise one of the above-described ingredients, and may also comprise two or more of the ingredients.

In one embodiment, the lactoferrin secretion regulating agent of the present invention can be an agent of promoting lactoferrin secretion, comprising at least lacritin, a lacritin expression vector, a lacritin expression cell or a compound having lacritin activity. The secretion promoting agent of the present invention can be useful as a prophylactic/therapeutic agent for the above-described ocular diseases for which a pharmacological action of lactoferrin can be effective, or as an antibacterial agent, a cell growth agent, a cell protecting agent, or the like.

In another embodiment, the lactoferrin secretion regulating agent of the present invention can be an agent of suppressing lactoferrin secretion, comprising at least a lacritin inhibitor, a lacritin inhibitor expression vector or a lacritin inhibitor expression cell. The secretion suppressing agent of the present invention can be useful as an agent of suppressing cell growth or the like.

A lacritin inhibitor means a compound that suppresses the expression or function of lactoferrin. Examples of the lacritin inhibitor include an antisense 'nucleic acid, ribozyme, decoy nucleic acid, RNAi inducible nucleic acid, antibody, dominant-negative mutant, aptamer and the like.

The antisense nucleic acid refers to a nucleic acid consisting of a base sequence capable of hybridizing to a target mRNA or initial transcription product under the physiological conditions for a cell that express the target mRNA or initial transcription product, and capable of inhibiting the translation of the polypeptide encoded by the target mRNA in the hybridized state. The kind of antisense nucleic acid may be DNA, RNA, or a DNA/RNA chimera. Because the phosphate diester linkage of any naturally occurring antisense nucleic acid is readily decomposed by a nuclease present in the cells, the antisense nucleic acid of the present invention can also be synthesized using a modified nucleotide such as of the thiophosphate type (P=O in phosphate linkage replaced by P=S) or 2' -0-methyl type, which is stable to the nuclease. Other important factors for the design of antisense nucleic acid include increasing the water solubility and cell membrane permeability and the like, and these issues can also be overcome by improving the dosage form such as by using liposomes or microspheres. The length of the antisense nucleic acid is not subject to limitation, as long as it allows specific hybridization with the transcription product; it may be as short as about 15 bases, or may be as long as a sequence comprising a sequence complementary to the total sequence of the mRNA (initial transcription product) . From the viewpoint of the ease of synthesis, antigenicity issues and the like, an oligonucleotide consisting of, for example, about 15 bases or more, preferably about 15 to about 30 bases, can be mentioned as an example. The target sequence for the antisense nucleic acid is not subject to limitation, as long as its translation is inhibited as a result of hybridization of the antisense nucleic acid, and may be the total sequence of the mRNA, a partial sequence thereof, or the intron portion of the initial transcription product.

The ribozyme refers to an RNA having an enzyme activity for specifically cleaving the mRNA or initial transcription product inside the coding region (including the intron portion in the case of the initial transcription product) . Since an oligo-DNA having a nucleotide sequence of the enzyme activity site has recently been shown to also have nucleic acid cleavage activity, the ribozyme is used herein as a concept to encompass DNA, as long as it has sequence-specific nucleic acid cleavage activity. The most versatile ribozyme is the self-splicing RNA found in infectious RNA such as of viroid and virosoid, and is known to occur in the hammerhead type, hairpin type and the like. When the ribozyme is used in the form of an expression vector comprising the DNA that encodes it, it may be prepared as a hybrid ribozyme wherein a sequence from modified tRNA is further linked to promote the transfer to cytoplasm [Nucleic Acids Res., 29(13): 2780-2788 (2001)].

The decoy nucleic acid refers to a nucleic acid molecule that mimics a region to which a transcription regulation factor binds. The decoy nucleic acid as a lacritin inhibitor can be a nucleic acid molecule that mimics a region to which a transcription activation factor for the lacritin gene binds. Examples of the decoy nucleic acid include oligonucleotides modified to make the oligonucleotide unlikely to be decomposed in vivo, such as an oligonucleotide (S-oligo) having a thiophosphate diester linkage wherein the oxygen atom of the phosphate diester linkage moiety is substituted by a sulfur atom, and an oligonucleotide wherein the phosphate diester linkage is substituted by an uncharged methyl phosphate group, and the like. The decoy nucleic acid may be completely identical to the region to which the transcription activation factor binds, as long as it retains an extent of identity that enables the binding of the transcription activation factor. The length of the decoy nucleic acid is not subject to limitation, as long as the transcription activation factor binds thereto. The decoy nucleic acid may comprise repeats of the same region. The RNAi-inducible nucleic acid refers to a nucleic acid capable of inducing the RNAi effect when transferred into cells, and is preferably an RNA. The RNAi effect refers to the phenomenon in which a double-stranded RNA comprising the same nucleotide sequence as that of an mRNA (or a partial sequence thereof) suppresses the expression of the mRNA. To obtain the RNAi effect, it is preferable to use, for example, a double- stranded RNA having the same nucleotide sequence as that of a target mRNA consisting of at least 20 or more continuous bases (or a partial sequence thereof) . The double-stranded structure may compose of different strands, or double strand achieved from the stem loop structure of RNA. Examples of the RNAi- inducing nucleic acid include siRNA, stRNA, miRNA and the like,

An antisense oligonucleotide and ribozyme can be prepared by, for example, determining the target sequence on the basis of the nucleotide sequence of the lacritin gene, and synthesizing a sequence complementary thereto using a commercially available automated DNA/RNA synthesizer (Applied Biosysterns, Beckman Instruments, and the like) . A decoy nucleic acid and RNAi-inducing nucleic acid can be prepared by synthesizing a sense strand and antisense strand, respectively, using an automated DNA/RNA synthesizer, denaturing them in an appropriate annealing buffer solution at about 90⁰C to about 95°C for about 1 minute, and subsequently performing annealing at about 30⁰C to about 70⁰C for about 1 to 8 hours. It is also possible to prepare a longer double-stranded polynucleotide by synthesizing complementary oligonucleotide strands in alternative overlaps, annealing the strands, and then ligating the strands using ligase.

The lacritin antibody may be a polyclonal antibody or a monoclonal antibody, and can be prepared by a commonly known immunological method. The antibody may be a fragment of an antibody (e.g., Fab, F(ab')2) or a recombinant antibody (e.g., single-stranded antibody) . The lacritin antibody as lacritin inhibitor can be a lacritin-neutralizing antibody (or lacritin inhibitory antibody) .

For example, a polyclonal antibody can be obtained by giving the antigen (may be prepared as a complex cross-linked with a carrier protein such as bovine serum albumin or KLH (Keyhole Limpet Hemocyanin) , if necessary) , along with a commercially available adjuvant (e.g., complete or incomplete Freund' s adjuvant), to an animal by subcutaneous or intraperitoneal administration about 2 to 4 times at intervals of 2 to 3 weeks (the antibody titer of serum separated from drawn blood is determined by a commonly known antigen-antibody reaction, and its elevation is confirmed in advance) , collecting whole blood about 3 to about 10 days after final immunization, and purifying the antiserum. Animals to be administered with the antigen include mammals such as rats, mice, rabbits, goat, guinea pigs and hamsters.

A monoclonal antibody can also be prepared by a cell fusion method (e.g., Takeshi Watanabe, Principles of Cell Fusion and Preparation of Monoclonal Antibodies in "Monoclonal Antibody and Cancer - Fundamentals and Clinical Aspects", Akira Taniuchi and Toshitada Takahashi, edts., pp. 2-14, Science Forum, 1985) . For example, a mouse is given this factor, along with a commercially available adjuvant, 2 to 4 times by subcutaneous or intraperitoneal administration, its spleen or lymph node is collected about 3 days after final administration, and leukocytes are separated. These leukocytes are fused with myeloma cells (e.g., NS-I, P3X63Ag8, etc.) to yield a hybridoma that produces a monoclonal antibody against this antigen. The cell fusion may be achieved by the PEG method [J. Immunol.. Methods, 81(2): 223-228 (1985)] or the voltage pulsation method [Hybridoma, 7(6): 627-633 (1988)]. A hybridoma that produces the desired monoclonal antibody can be selected by detecting in the culture supernatant an antibody that specifically binds to an antigen using well-known EIA, RIA, or the like. Cultivation of a hybridoma that produces a monoclonal antibody can be performed in vitro, or in vivo in mice or rats, preferably in ascites fluid of mouse, and the resulting antibody can be obtained from a hybridoma culture supernatant or animal ascites fluid, respectively.

Furthermore, considering the therapeutic effect and safety in humans, the antibody of the present invention may be a chimeric antibody or a humanized or human antibody. The chimeric antibody can be prepared with reference to, for example, "Jikken Igaku (extra issue), Vol.6, No.10, 1988", Japanese Patent Examined Publication No.HEI-3-73280 and the like/ the humanized antibody can be prepared with reference to, for example, Japanese Patent Kohyo Publication No.HEI-4-506458, Japanese Patent Unexamined Publication No.SHO-62-296890 and the like; the human antibody can be prepared with reference to, for example, "Nature Genetics, Vol.15, pp. 146-1,56, 1997", "Nature Genetics, Vol.7, pp. 13-21, 1994", Japanese Patent Kohyo Publication No.HEI-4-504365, International Patent Application Publication No.W094/25585, "Nikkei Science, June, pp. 40-50, 1995", "Nature, Vol.368, p.856-859, 1994", Japanese Patent Kohyo Publication No.HEI-6-500233 and the like. The dominant-negative mutant refers to a form of lacritin having an activity reduced by inducing a mutation therein. The dominant-negative mutant is capable of indirectly inhibiting the activity of naturally occurring lacritin by competing therewith. The dominant-negative mutant can be prepared by introducing a mutation in the nucleic acid that encodes lacritin. Examples of the mutation include amino acid mutations that result in a reduction in the function of a functional site at the site (e.g., deletion, substitution, and addition of one or more amino acids) . The mutation can be introduced by a method known per se using PCR or a commonly known kit.

The aptamer refers to an oligonucleotide that specifically binds to a given protein to inhibit the functional expression thereof. An aptamer for lacritin can be obtained through, for example, the procedures shown below. First, oligonucleotides (e.g., about 60 bases) are randomly synthesized using an automated DNA/RNA synthesizer to yield a pool of oligonucleotides. Subsequently, an oligonucleotide that binds to the desired protein, i.e., iacritin, is separated using an affinity column. The oligonucleotide separated is amplified by PCR and again subjected to the aforementioned selection process. This process is repeated about 5 times or more to select an aptamer of high affinity for lacritin. The lacritin inhibitor expression vector can be a vector capable of expressing the above-described lacritin inhibitor. The expression vector in the lacritin inhibitor .expression vector is the same as that in the lacritin expression vector. The lacritin inhibitor expression vector can be a vector that expresses, for example, an antisense nucleic acid, ribozyme, decoy nucleic acid, RNAi inducible nucleic acid, antibody, dominant-negative mutant, or aptamer, as the lacritin inhibitor.

The lacritin inhibitor expression cell is a transformant obtained by transferring a lacritin inhibitor expression vector to a host cell. The host cell used to prepare the lacritin inhibitor expression cell can, for example, be a cell derived from an amimal including a mammal such as mouse, rat, hamster, guinea pig, rabbit, dog, monkey or human, or from a bird such as chicken. The host cells can also be cells derived from an optionally chosen tissue. The host cell can still also be a primary culture cell, a cell line derived from a primary culture cell, a cell obtained by culturing an undifferentiated cell such as a stem cell (e.g., a differentiated cell), a commercially available cell line, a cell line available from a cell bank, or the like. The lacritin inhibitor expression cell can be a cell that express a secretable lacritin inhibitor, for example, an antibody, dominant-negative mutant or the like.

The regulating agent of the present invention can comprise any carrier, for example, a phamacologically acceptable carrier, in addition to the above-described ingredients. Examples of the pharmaceutically acceptable carrier include, but are not limited to, excipients such as sucrose, starch, mannitol, sorbitol, lactose, glucose, cellulose, talc, calcium phosphate and calcium carbonate; binders such as cellulose, methylcellulose, hydroxypropylcellulose, polypropylpyrrolidone, gelatin, gum arabic, polyethylene glycol, sucrose and starch; disintegrants such as starch, carboxymethylcellulose, hydroxypropyl starch, sodium-glycol-starch, sodium hydrogen carbonate, calcium phosphate and calcium citrate; lubricants such as magnesium stearate, Aerosil, talc and sodium lauryl sulfate; flavoring agents such as citric acid, menthol, glycyrrhizin ammonium • salt, glycine and orange flour; preservatives such as sodium benzoate, sodium hydrogen sulfite, methyl paraben and propyl paraben; stabilizers such as citric acid, sodium citrate and acetic acid; suspending agents such as methylcellulose, polyvinylpyrrolidone and aluminum stearate; dispersing agents such as surfactants; diluents such as water, physiological saline and orange juice; base waxes such as cacao butter, polyethylene glycol and refined kerosene; and the like. Preparations suitable for oral administration are solutions comprising an effective amount of a substance dissolved in diluents .such as water, physiological saline and orange juice; capsules, sachets or tablets comprising an effective amount of a substance in the form of solid or granules; suspensions comprising an effective amount of a substance suspended in an appropriate dispersant; emulsions comprising a solution of an effective amount of a substance dispersed and emulsified in an appropriate dispersant; and the like.

Preparations suitable for parenteral administration (e.g., intraocular administration, injection into Tenon's capsule, intraoral administration, subcutaneous injection, intramuscular injection, topical injection and the like) are aqueous and non-aqueous isotonic sterile injectable liquids, which may contain an antioxidant, a buffer solution, a bacteriostatic agent, an isotonizing agent and the like. Aqueous and non-aqueous sterile suspensions can also be mentioned, which may contain a suspending agent, a solubilizer, a thickening agent, a stabilizer, an antiseptic and the like. These preparations can be sealed in containers in unit dosage amounts Like ampoules and vials, or in dosage amounts for multiple doses. Also, the active ingredient and a pharmaceutically acceptable carrier may be freeze-dried and stored in a state for dissolution or suspension in an appropriate sterile vehicle just before use.

Although the dosage of the regulating agent of the present invention is variable depending on the activity and kind of the active ingredient, the severity of the illness, animal species, drug sensitivity, body weight, and age of the recipient, and the like, the usual dosage for an adult is about 0.001 to 500 mg/kg per day, based on the amount of active ingredient.

The regulating agent of the present invention can be used as a pharmaceutical, an investigational reagent and the like, or in vivo or in vitro. When the regulating agent of the present invention is used as a pharmaceutical, it can be used in the dosage forms of eye drops, patches, ointments, lotions, creams, oral preparations and the like. 4. Method of regulating lactoferrin secretion

The present invention provides a method of regulating (e.g., promoting or suppressing) lactoferrin secretion. The regulation method of the present invention comprises, for example, contacting a lacritin receptor expression cell with lacritin, a compound having lacritin activity or a lacritin inhibitor. The regulation method of the present invention may involve not only the action of one of the above-described ingredients, but also the action of two or more of the ingredients .

In the step of the above-described regulation method, a lacritin receptor expression cell is brought into contact with lacritin, a compound having lacritin activity or a lacritin inhibitor. The contact of lacritin, a compound having lacritin activity or a lacritin inhibitor with a lacritin receptor expression cell can be performed in vitro (i.e.,. in culture medium) or in vivo, and the contact can be achieved in various manners .

For example, when the regulation method of the present invention is performed in vitro, the contact can be achieved directly by adding lacritin, a compound having lacritin activity or a lacritin inhibitor to a culture medium comprising a lacritin receptor expression cell. The contact can also be achieved indirectly by transferring a lacritin expression vector or a lacritin inhibitor expression vector to a lacritin receptor expression cell or other cell surrounding the cell in the culture medium, or by allowing a lacritin receptor expression cell to coexist with a lacritin expression cell or a lacritin .inhibitor expression cell. Specifically, after a lacritin expression vector or lacritin inhibitor expression vector is transferred to a lacritin receptor expression cell or the other cell, lacritin or a lacritin inhibitor is secreted from the cell and can come into contact with the lacritin receptor expression cell. Also, by allowing a lacritin receptor expression cell to coexist with a lacritin expression cell or a lacritin inhibitor expression cell, the lacritin produced by the lacritin expression cell or the lacritin inhibitor produced by the lacritin inhibitor expression cell can come into contact with the lacritin receptor expression cell. In this step, lacritin or a lacritin inhibitor may be brought into contact with a population of cells comprising a lacritin receptor expression cell and other cell, or with a population of cells substantially comprising a lacritin receptor . expression cell only. The culture medium and cultivation conditions used in this step can be chosen as appropriate according to the kind of cells used and the like, and can, for example, be the same as the step (a) of the screening method of the present invention.

On .the other hand, when the regulation method of the present invention is performed in vivo, the contact can be achieved directly by administering lacritin, a compound having lacritin activity or a lacritin inhibitor to a site where a lacritin receptor expression cell is present. The contact can also be indirectly achieved by transferring a lacritin expression vector or a lacritin inhibitor expression vector to a lacritin receptor expression cell or other cell surrounding the cell in the subject, or by administering a lacritin receptor expression cell to coexist with¹ a lacritin expression cell or a lacritin inhibitor expression cell. When an expression vector is used, it is preferably an expression vector comprising a promoter specific to the lacritin receptor expression cell including a promoter specific to a lacrimal gland acinar cell.

The regulation method of the present invention can further comprise evaluating whether or not the expression of lactoferrin is amplified. When the regulation method of the present invention is performed in vitro, whether or not the expression of lactoferrin is amplified can be evaluated by, for example, following the same procedure as the step (b) of the screening method of the present invention. On the other hand, when the regulation method of the present invention is performed in vivo, whether or not the expression of lactoferrin is amplified can be evaluated by, for example, determining the amount of lactoferrin in secretes (e.g., tears) from a contact site between lacritin, a compound having lacritin activity or a lacritin inhibitor and a lacritin receptor expression cell (e.g., lacrimal gland), and comparing this amount with the amount of lactoferrin in secretes previously determined before the contact, in consideration of the kind and amount of the active ingredient contacted, time after the contact, and the like. Accordingly, the regulation method of. the present invention can comprise determining the amount of lactoferrin in secretes before the contact. The amount of lactoferrin in secretes can, for example, be determined by a method known per se, for example, ELISA, Western blotting, and high performance liquid chromatography (HPLC) . In one embodiment, the regulation method of the present invention can be a method of producing lactoferrin. According to the production method, it is possible to obtain naturally occurring lactoferrin in large amounts at high efficiency. In another embodiment, the regulation method of the present invention can be suitable for a screening method for a compound having lacritin activity. For example, the regulation method of the present invention corresponds to the mode of use of a positive control in the screening method.

In still another embodiment, the regulation method of the present invention can be a prophylactic/therapeutic method for an ocular disease. The ocular disease to be prevented or treated is the same as, for example, the ocular disease that can be prevented or treated with the regulating agent of the present invention. In this case, lacritin, a lacritin expression vector, a lacritin expression cell or a compound having lacritin activity is used in the regulation method of the present invention.

According to the present invention, a lacritin receptor expression cell whose lactoferrin expression is regulated, which is obtained by the regulation method, is also provided. The cell can be provided in an isolated form or in the presence of other cell together.

5. Method of identifying and producing a lacritin receptor expression cell The present invention provides a method of identifying a lacritin receptor expression cell. The identification method comprises, for example, (a) contacting a certain animal cell with lacritin or a compound having lacritin activity, and (b) evaluating whether or not the amount of lactoferrin expressed is increased.

The animal cell used in the identification method of the present invention can be existing animal cell. Examples of useful animal cell include a commercially available cell line, a cell line available from a cell bank, or the like. The animal cell can also be, for example, a cell derived from an amimal including a mammal such as mouse, ^• rat, hamster, guinea pig, rabbit, dog, monkey or human, or from a bird such as chicken. The animal cell can also be a cell derived from any tissue.

In the step (a) of the above-described identification method, the certain animal cell is brought into contact with the lacritin or compound having lacritin activity. The contact of the lacritin or compound having lacritin activity with the animal cell can be performed in a culture medium, and the contact can be achieved by various manners. For example, the contact can be directly achieved by adding the lacritin or compound having lacritin activity to the culture medium containing the animal cell. The contact can also be indirectly achieved by transferring a lacritin expression vector to the animal cell in the culture medium. Specifically, after the lacritin expression vector is transferred to the animal cell, lacritin is secreted from the animal cell (transformant) , and come into contact with the animal cell . The culture medium and cultivation conditions that can be used in this step can be chosen as appropriate according to the kind of cell used and the like, and are, for example, the same as those for the step (a) of the screening method of the present invention. In the step (b) of the above-described identification method, whether or not the expression of lactoferrin in the animal cell in the presence of the lacritin or compound having lacritin activity is increased is evaluated. Whether or not the expression of lactoferrin is increased can be evaluated in the same manner as the step (b) of the screening method of the present invention.

The identification method of the present invention is useful for, for example, enabling the provision of a lacritin receptor expression cell required for the screening method and the agent of the present invention, and the like.

The present invention also provides a method of producing a lacritin receptor expression cell. The production method of the present invention comprises, for example, (a) preparing an animal cell, (b) contacting the cell with lacritin or a compound having lacritin activity, and (c) evaluating whether or not the amount of lactoferrin expressed is increased. ■ In the step (a) of the above-described production method, the animal cell is prepared by a method known per se. For example, the animal cell can be prepared by being isolated from an animal, by modifying a cell isolated from an animal, or by modifying existing cell. The animal cell prepared can be, for example, a cell derived from an animal including a mammal such as mouse, rat, hamster, guinea pig, rabbit, dog, monkey or human, or from a bird such as chicken. The animal cell prepared can also be a cell derived from any tissue, and can, for example, be a ocular cell such as a lacrimal gland acinar cell. The animal cell prepared can still also be a primary culture cell, a cell line derived from a primary culture cell, or a cell obtained by culturing an undifferentiated cell such as a stem cell (e.g., a differentiated cell). The steps (b) and (c) of the above-described production method can be performed in the same manner as the steps (a) and (b) of the above-described identification method.

The production method of the present invention is useful for, for example, enabling the provision of a novel lacritin receptor expression cell that is required to the screening method and the agent of the present invention, and the like. According to the present invention, a novel lacritin receptor expression cell obtained by the production method is also provided.

As used in the specification and claims, the singular form "a," "an" and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a cell" includes a plurality of cells, including mixtures thereof.

All contents mentioned in any publications mentioned herein, including patents and patent descriptions, are incorporated herein by reference to the extent that the entire disclosure of which is incorporated herein.

The present invention is hereinafter described in more detail by means of the following Examples, which, however, are not to be construed as limiting the scope of the invention.

Examples 1. Preparation of lacritin and empty vector extract

The sequence of the lacritin gene from the initiation codon to termination codon was inserted in the pTrcHis-TOPO vector (Invitrogen K.K.) and One Shot competent cells (Invitrogen K.K.) were transformed with the vector. After expression was induced with isopropyl-β-D-thiogalactopyranoside (IPTG) for 3 hours, a soluble fraction of Escherichia coli was used for purification. The purification was performed by affinity chromatography method with His-Tag and Ni using the PreBond Purification System (Invitrogen K.K.). The preparation of empty vector extract was performed as described below. One Shot competent cells (Invitrogen K.K.) were transformed with the pTrcHisA vector (Invitrogen K.K.). Expression induction and purification were performed in the same manner as those for preparing lacritin. 2. Test method

Experiments were performed using lacrimal gland acinar cells prepared freshly from a 10-year-old female rhesus monkey. The cells were cultured in a D-MEM solution (Dulbecco's Modified Eagle Medium, Invitrogen K.K.) comprising 10 μg/mL dexamethasone (Sigma Ltd.), 100 mM putrescine (Sigma Ltd.), 12.5 mg/mL ascorbic acid (Sigma Ltd.), an 83-fold diluted culture medium supplemented with insulin, transferrin, and sodium selenite (Sigma Ltd.), 1 mg/mL glutathione (Sigma Ltd.), 10^"8 M epidermal growth factor (Sigma Ltd.), and 50 μg/mL gentamycin (Invitrαgen K.K.) under the culture conditions of 5% CO₂, 95% air, 100% humidity, and 37°C temperature. The cells were seeded to a 6-well plate at 3.8^χlO⁵ cells/well, and cultured for 2 weeks with the culture medium replaced with a fresh supply every three days. After 2 weeks, the cells were once washed with 2 mL of a D-MEM solution comprising 50 μg/mL gentamycin alone, and 2 mL of the same culture medium was added to each well. After cultivation for 1 hour, purified recombinant lacritin protein was added to obtain a final concentration of 10 ^~7 M. The empty vector extract in the same amount as the lacritin added was added to other wells, and total RNA was extracted four hours later. The total RNA was extracted using the TRIzol reagent (Invitrogen K.K.) according to the protocol.

The culture medium was removed from each well, and 1 mL of the TRIzol reagent was added. The TRIzol reagent was transferred to new tubes. The tubes was incubated at room temperature for 5 minutes, 0.2 mL of chloroform per mL of the TRIzol reagent was added, and the mixture was stirred vigorously for 1 minute. After the stirring, the tubes was incubated, at room temperature for 2 to 3 minutes and centrifuged at 4⁰C for 15 minutes (12000^χg) . After the centrifugation, the resulting supernatant was transferred to a new tube, 0.5 mL of isopropanol was added, and the tube was shaken gently. This was followed by centrifugation at 4°C for 10 minutes (12000^χg) . After pellets were observed, they were once washed with 75% ethanol and dissolved in the RNA Storage Solution (Ambion Inc.), and the concentration was calculated from the absorbance of the solution (A260/280) .

Each total RNA extracted was reacted with 1 μL of 2 Unit/mL DNaseI (Ambion Inc.) at 37°C for 30 minutes. The reaction was then stopped by the addition of 1.5 μL of the

DNase Inactivation Reagent (Ambion Inc.) . This was followed by centrifugation for 1 minute. The resulting supernatant was transferred to a new tube; and the- concentration was determined from the absorbance of the solution. 500 μg of total RNA was reacted for reverse transcription using the

Random Decamer (Ambion Inc.) at 42°C for 50 minutes and then at 72°C for 15 minutes. Subsequently, a PCR reaction was performed with 1 μL of the 20 μL of the reverse transcription solution as the template using lactoferrin-specific primers (sense: CTGTAGCGGCGGAAGTCTAC (SEQ ID NO: 1), antisense: ACACAGGTTGGGGAACTGTC (SEQ ID NO: 2)) and 18s ribosome RNA- specific primer (Ambion Inc.) . For the 18s ribosome RNA- specific primers, the mixing ratio of primer and competimer was 2:8. The PCR reaction was achieved by repeating heat treatment at 94°C for 30 seconds, at 60°C for 30 seconds, and at 72°C for 1 minute in 34 cycles to amplify cDNA; a 284-base PCR product of lactoferrin and a 488-base PCR product of 18s ribosome RNA were obtained. After the amplification of cDNA, electrophoresis was performed using 1.5% agarose gel in the TAE buffer (Invitrogen K.K.) at 100 V for 30 minutes. Likewise, a PCR reaction was performed with 1 μL of the 20 μL of the reverse transcription solution as the template using lysozyme- specific primers (sense: GCCTAGCAAACTGGGTGTGT (SEQ ID NO: 3), antisense: CCCATGCTCTAATGCCTTGT (SEQ ID NO:4)) and 18s ribosome RNA-specific primer. For the 18s ribosome RNA- specific primers, the mixing ratio of primer and competimer was 2:8. The PCR reaction was achieved by repeating heat treatment at 94°C for 30 seconds, at 60°C for 30 seconds, and at 72°C for 1 minute in 31 cycles to amplify cDNA; a 258-base PCR product of lysozyme and a 488-base PCR product of 18s ribosome RNA was obtained. After the amplification of cDNA, electrophoresis was performed using 1.5% agarose gel in the TAE buffer at 100 V for 30 minutes. 3. Test results

Figure 1 shows an electrophoresis of PCR products from monkey lacrimal gland acinar cell samples; PCR products from cells cultured using a culture medium alone are shown in lanes 1 and 2; PCR products from cells supplemented with the empty vector extract are shown in lanes 3 and 4; PCR products from cells supplemented with recombinant lacritin protein are shown in lanes 5 and 6. Figure 2 shows the results of analyses of the band intensities of the PCR products; the ratio of lactoferrin to the internal standard 18s ribosome RNA was calculated for each lane (NIH-Image (Ver 1.62) image analysis software program) . As shown in Figure 2, enhanced expression of lactoferrin was confirmed in the cells supplemented with lacritin, whereas the amount of lactoferrin expressed was not changed in the control group and the cells supplemented with the empty vector extract .

Figure 3 shows an electrophoresis of PCR products from monkey lacrimal gland acinar cells samples; PCR products from cells cultured using a culture medium alone are shown in lanes 1 and 2; PCR products from cells supplemented with the empty vector extract are shown in lanes 3 and 4; PCR products from cells supplemented with lacritin recombinant protein are shown in lanes 5 and 6. Figure 4 shows the results of analyses of the band intensities of the PCR products; the ratio of lysozyme to the internal standard 18s ribosome RNA was calculated for each lane. As shown in Figure 4, the 'amount of lysozyme expressed was not changed in the cells supplemented with the empty vector extract and the cells supplemented with lacritin, compared to the control group.

These results demonstrate that lacritin specifically induces the expression of lactoferrin. '

Industrial Applicability The screening method of the present invention is useful in developing a prophylactic/therapeutic agent for various ocular diseases and the like, since a compound having lacritin activity can be obtained with the increase in the amount of lactoferrin expressed in a lacritin receptor expression cell as the index. The secretion promoting agent of the present invention is useful for increasing the amount of lactoferrin, and hence showing a protective effect against corneal epithelial disorders due to light stimulation.

The present application is based on U.S. provisional application Ser. No. 60/685,884, filed on June 1, 2005, and the contents of which are incorporated herein by reference.

Claims

1. A screening method for a compound having lacritin activity, which comprises (a) contacting a lacritin receptor expression cell with a test compound, and (b) evaluating whether or not the amount of lactoferrin expressed is increased.

2. The method of claim 1, wherein the cell is a lacrimal gland acinar cell.

3. An agent of promoting lactoferrin secretion, comprising lacritin or a compound having lacritin activity.

4. The agent of claim 3, which is a prophylactic/therapeutic agent for ocular disease.

5. The agent of claim 4, wherein the ocular disease is a corneal epithelial disorder due to light stimulation.

6. An agent of inducing lactoferrin, comprising a lacritin receptor expression cell.

7. The agent of claim 6, wherein the cell is a lacrimal gland acinar cell.

8. A method of promoting lactoferrin secretion, which comprises contacting a lacritin receptor expression cell with lacritin or a compound having lacritin activity.

9. A cell whose lactoferrin expression is regulated, which is obtained by the method of claim 8.

10. A method of identifying a lacritin receptor expression cell, which comprises (a) contacting a certain animal cell with lacritin or a compound having lacritin activity, and (b) evaluating whether or not the amount of lactoferrin expressed is increased.

11. A method of producing a lacritin receptor expression cell, which comprises (a) preparing an animal cell, (b) contacting the cell with lacritin or a compound having lacritin activity, and (c) evaluating whether or not the amount of lactoferrin expressed is increased.

12. A cell obtained by the method of claim 11.