JP4592352B2 - Nerve axon formation / elongation using nerve growth cone localized molecule Shotin1 or its splicing variant and its application to nerve regeneration - Google Patents

Description

  The present invention relates to a method for inducing and promoting axon formation or elongation in nerve cells using the nerve growth cone localized molecule Shootin1 or a splicing variant thereof. The present invention can contribute particularly to the development of new nerve regeneration technologies. For example, the establishment of axon regeneration medical technology as an effective treatment method for central and peripheral nerve disorders caused by, for example, stroke or spinal cord injury. And can be used in the research and development stage.

  A nerve cell is a cell having polarity or directionality to the cell itself. In other words, it has multiple dendrites and a single axon, receives information from other neurons in the dendrite, integrates it in the cell body, converts it into a form of action potential, and cells on the axon It is transmitted from the body side to the synaptic terminal side. Information is transmitted to the target cell by releasing a neurotransmitter at the synaptic terminal. This phenomenon plays a fundamental role in higher life activities such as memory, learning, and exercise in higher organisms. However, the molecular mechanism of the polarity formation and maintenance of nerve cells is wrapped in many unknown parts (for research on polarity formation, see, for example, Non-Patent Document 1 below).

  Elucidation of the molecular mechanism of neuronal polarity formation leads to the elucidation of the molecular mechanism of the formation and elongation of nerve axons in the developmental stage and thus the formation of the neural network. Since the polarity formation of nerve cells is the formation of nerve axons in one aspect, it is possible that the molecules can be used for the formation and elongation of nerve axons by identifying the molecules involved in polarity formation. Furthermore, the same molecule may be used for the development of new nerve regeneration techniques, for example, for the development of treatments for regenerating nerve axons that have been cut or degenerated.

  The development of such treatments is important. For example, central and peripheral nerve disorders caused by stroke or trauma are one of the most intractable diseases that are difficult to treat because there is no effective drug treatment for axonal regeneration. It is a medical means. In particular, since the central axon cannot be regenerated once it is damaged, the patient is often forced to live in a lifeless manner such as a wheelchair for the rest of the life, which is a heavy burden on the patient, family, and society.

  By the way, the following Non-Patent Document 2 discloses a cDNA sequence of a gene cloned from a newborn mouse cerebellar library on postnatal day 0 and its deduced amino acid sequence. However, the function of the gene and its protein is not disclosed or suggested in the same document.

Dotti, C.G., Sullivan, C.A., Banker, G.A. (1988) The establishment of polarity by hippocampal neurons in culture.J. Neurosci. 8, 1454-1468 DDBJ / EMBL / GenBank databases: Accession number AK082304

  The first object of the present invention is to change the expression before and after the formation of polarity of nerve cells using proteome analysis such as two-dimensional electrophoresis and mass spectrometry, and is important for the formation and elongation of axons It is to develop and provide a new method for inducing and promoting axon formation or elongation in nerve cells by identifying molecules present in the growth cones of these cells and analyzing their functions. The second object of the present invention is to provide a novel gene and a novel protein that can be used in this method and can also be used in nerve regeneration treatment for disorders of the central nerve and peripheral nerve. Furthermore, the third object of the present invention is to provide a screening method and a research reagent for a therapeutic drug for nerve regeneration using the above molecule as a target and a probe.

  The present inventor has used proteomics based on a highly sensitive two-dimensional electrophoresis method (Inagaki N. and Katsuta K, Curr. Proteomics 1, 35-39, 2004), which was originally developed, to develop cultured rat hippocampal neurons. Protein screening was performed, and proteins whose expression levels increased with axon formation were comprehensively analyzed. As a result, a novel protein (Shootin1) having a molecular weight of 52.6 kD was identified. As a result of further analysis of this molecule, (1) it is specifically expressed in the brain, and its expression level is greatly increased on the 4th day after the axon is formed, (2) Shootin1 is Strong concentration is observed in the growth cone at the tip of the cord, (3) When Shootin1 is expressed exogenously in cultured neurons (ie, when an external gene is introduced and expressed instead of an endogenous gene), multiple axes (4) Shootin1 is axon formation, localized in the growing growth cone as a vesicle, and shows dynamic movement in the growth cone, (5) Shootin1 The inventors have found that there are two splicing variants and have completed the present invention.

That is, the present invention includes the following inventions A) to O) as industrially and medically useful inventions.
A) A method for inducing axon formation or elongation in nerve cells by positively controlling expression or activity of nerve growth cone localized molecule Shootin1 or a splicing variant thereof.
As a method of “controlling the expression or activity positively” of the above Shootin1 etc., (1) a method of introducing a Shootin1 gene or the like into a nerve cell to express exogenous Shootin1 etc. and increasing its intracellular expression level, ( 2) a method for increasing the expression of endogenous Shootin1 and the like, and (3) a method for increasing the activity of Shootin1 and the like, and these methods may be combined.
The “splicing variant” means a protein translated from mRNA formed by alternative splicing. Examples of the “splicing variant” of Shootin1 include Shootin2 (p52b) and Shootin3 (p52c) described later identified by genome analysis.

B) Induction of nerve axon formation / elongation as described in A) above, wherein the intracellular expression of Shootin1 or a splicing variant thereof is positively controlled by introducing a gene of Shootin1 or a splicing variant thereof into the nerve cell. Law.
Gene transfer into nerve cells can be performed according to a conventional method for transfecting cells with a recombinant expression vector.

C) A nerve axon formation / elongation inducer comprising a recombinant expression vector constructed to express a nerve growth cone localized molecule Shootin1 or a splicing variant gene thereof in nerve cells.
As the “recombinant expression vector”, a viral vector, plasmid, phage, cosmid or the like can be used, and it is not particularly limited. In addition, since there are various promoters that function in the host, a promoter corresponding to the intended use may be selected and placed upstream of the Shootin1 gene and the like.

D) The nerve axon formation / elongation inducing agent according to C) above, wherein the recombinant expression vector is constructed so as to express a human, rat or mouse-derived Shootin1 or a splicing variant gene thereof.
The cDNA sequence and amino acid sequence of Shootin1 derived from human, rat, and mouse are shown in SEQ ID NOs: 1-3, 4-6, and 7-9 in the sequence listing, respectively. Based on these information, the recombinant expression vector Can be prepared.

E) A gene therapy drug for nerve regeneration comprising a recombinant expression vector constructed to express a nerve growth cone localized molecule Shootin1 or a splicing variant gene thereof in nerve cells.
The gene therapy drug can be used for axonal regeneration treatment of cut or degenerated nerve cells and nerve tissues.

  F) The gene therapy drug for nerve regeneration according to the above E), wherein the recombinant expression vector is constructed so as to express a gene of Shootin1 derived from human, rat or mouse or a splicing variant thereof.

G) Human-derived Shootin1 protein shown in the following (a) or (b).
(A) A protein consisting of the amino acid sequence shown in SEQ ID NO: 3.
(B) The amino acid sequence shown in SEQ ID NO: 3 consists of an amino acid sequence in which one or several amino acids are deleted, substituted or added, and has the effect of inducing axon formation or elongation in nerve cells. protein.
The “Shootin1 protein” of the present invention may contain an additional polypeptide. Examples of the case where such a polypeptide is added include a case where the epitope is labeled with His, Myc, flag or the like.
In addition, “one or several amino acids have been deleted, substituted or added” means that the number of amino acids is such that they can be deleted, substituted and / or added by a mutant protein production method such as site-directed mutagenesis. Is deleted, substituted and / or added. Thus, in other words, the protein of (b) above is a mutant protein of the protein of (a) above, and the “mutation” referred to here is a mutation artificially introduced mainly by a mutant protein production method. Although it means, it may be a product obtained by isolating and purifying a similar naturally occurring mutant protein.

H) Rat-derived Shootin1 protein shown in the following (a) or (b).
(A) A protein consisting of the amino acid sequence represented by SEQ ID NO: 6.
(B) The amino acid sequence shown in SEQ ID NO: 6 consists of an amino acid sequence in which one or several amino acids are deleted, substituted or added, and has an action of inducing axon formation or elongation in nerve cells. protein.

I) Shootin1 gene encoding the protein described in G) or H) above.
For example, a gene having the base sequence shown in SEQ ID NO: 1 or 4 can be mentioned. The “gene” of the present invention is preferably cDNA, but is not particularly limited, and may be RNA or genomic DNA. The “gene” of the present invention may include sequences such as untranslated region (UTR) sequences and vector sequences (including expression vector sequences) in addition to sequences encoding Shootin1 protein.

J) DNA of any of the following (a) to (c).
(A) DNA consisting of the base sequence shown in SEQ ID NO: 1 or 4.
(B) It consists of a base sequence that hybridizes under stringent conditions with DNA consisting of a base sequence complementary to the base sequence shown in SEQ ID NO: 1 or 4, and induces axon formation or elongation in nerve cells. DNA encoding a protein having an action of
(C) DNA encoding a protein obtained by screening an expression library with an anti-Shootin1 antibody and having an action of inducing axon formation or elongation in nerve cells.

K) A screening method for a therapeutic agent for nerve regeneration, comprising searching for a substance that positively regulates the expression or activity of a nerve growth cone localized molecule Shootin1 or a splicing variant thereof.
For example, (1) a screening method for a substance that binds to Shootin1 etc. by binding assay such as affinity column method, Yeast-two-hybrid method, immunoprecipitation method, etc. and enhances its activity, (2) a candidate substance is administered to nerve cells And a method of screening for substances that increase the expression level of endogenous Shootin1 and the like.

L) A reagent for research related to formation or elongation of nerve axons or nerve regeneration, which specifically detects Shootin1 or a splicing variant thereof.
The “antibody” of the present invention is an antibody obtained as a polyclonal antibody or a monoclonal antibody by a known method using a protein such as Shootin1 to be detected or a partial peptide thereof as an antigen.

  M) The antibody according to L) above, which is an anti-Shootin1 antibody that specifically detects human or rat-derived Shootin1 protein.

  N) The DNA shown in (c) among the DNAs described in J) above, wherein the antibody is the antibody of L) or M).

O) A reagent for research relating to formation or elongation of nerve axons or nerve regeneration, and an RNAi reagent introduced into cells to specifically suppress the expression of Shootin1 or a splicing variant thereof.
The RNAi reagent may be siRNA (short interference RNA) or an RNAi expression vector. siRNA and RNAi expression vectors can be designed according to known methods based on gene sequences such as Shootin1 to be suppressed. The RNAi expression vector is (1) a single RNA designed to express dsRNA having a hairpin structure of an appropriate length in the target cell, and (2) a sense strand and an antisense strand, respectively. Any of those designed to be expressed and associated in the target cell may be used.

  As shown in Examples described later, the Shootin1 was found to have the effect of inducing the formation of multiple axons when exogenously expressed in cultured neurons. Thus, Shootin1 has the ability to form nerve axons, and thus can be a target molecule for axonal regeneration treatment in the central nerve and peripheral nerve, and can be applied in the fields of medicine and pharmacy. First, because Shootin1 itself promotes axon formation, nerve cells and nerve tissues of patients with disabilities can be expressed exogenously via vectors such as viruses to regenerate nerve axons. It is thought that it can be caused. Further, if a molecule that interacts with, for example, Shootin1 and activates endogenous Shootin1 is found by the screening method of the present invention, the molecule can be a candidate for a nerve axon regeneration therapeutic drug. Furthermore, novel Shootin1 gene and Shootin1 protein derived from humans and rats, these antibodies, and RNAi reagents can be used as research reagents for nerve regeneration and the like.

  Shootin1 splicing variants (Shootin2 and Shootin3, described later) are similar in structure to Shootin1 as shown in FIG. 2, and are considered to have the same function because they have a common structure, and are used in the same way as Shootin1. be able to.

Hereinafter, specific embodiments of the present invention will be described in detail with reference to the drawings.
FIG. 1 shows a schematic structure of a Shootin1 protein that has been clarified as a result of analysis by the present inventor. Shootin1 protein consists of 456 amino acids in total length, and there are three Coiled-coil (C.C1-3 in the figure) region and one Proline-rich-region. Since the molecular weight was 52.6 kD, it was originally called “p52a”, but the subsequent analysis showed that the molecule moved like a shooting star at the tip of the nerve axon. Named "Shootin1".

  Shootin1 protein has no homology with known proteins, and genomic information indicates that homologous proteins exist in humans, Japanese monkeys, mice, zebrafish and pufferfish in addition to rats.

  SEQ ID NOs: 1-3 show the cDNA sequence and amino acid sequence of human-derived Shootin1 determined by the present inventors. On the other hand, SEQ ID NOs: 4-6 show the cDNA sequence and amino acid sequence of rat-derived Shootin1 determined by the present inventors. As shown in Examples described later, these genes / proteins are novel genes / new proteins cloned for the first time by the present inventors.

  The gene of the present invention includes (1) the human-derived Shootin1 gene consisting of the base sequence shown in SEQ ID NO: 1 and (2) the rat-derived Shootin1 gene consisting of the base sequence shown in SEQ ID NO: 4, ) It consists of a base sequence that hybridizes under stringent conditions with DNA consisting of a base sequence complementary to the base sequence shown in SEQ ID NO: 1 or 4, and the encoded protein promotes the formation (or elongation) of nerve axons. Also included are genes having

  Hybridization under the above stringent conditions can be performed, for example, by the method described in Molecular Cloning: Cold Spring Harbor Laboratory Press, Current Protocols in Molecular Biology; Wiley Interscience. Specifically, the following methods are exemplified. The

  A DNA molecule such as a cDNA library is transferred to a membrane, and this is hybridized with a labeled probe in a hybridization buffer. The composition of the hybridization buffer consists of, for example, 0.1 wt% SDS, 5 wt% dextran sulfate, 1/20 volume blocking reagent, and 2-7 × SSC. As a blocking reagent, for example, 100 × Denhardt's solution, 2% (weight / volume) Bovine serum albumin, 2% (weight / volume) polyvinylpyrrolidone prepared at 5 culture concentrations are diluted to 1/20 and used.

  The hybridization temperature is in the range of 40 to 80 ° C., more preferably 50 to 70 ° C., and still more preferably 55 to 65 ° C. After incubation for several hours to overnight, the plate is washed with a washing buffer. The washing temperature is preferably room temperature or the temperature during hybridization. The composition of the washing buffer is preferably 0.1 to 6 × SSC + 0.1 wt% SDS solution, and the membrane is washed several times with the washing buffer while changing the concentration of SSC. Thereafter, the DNA molecule to which the probe is hybridized is detected using a label attached to the probe.

  SEQ ID NOs: 7-9 show the cDNA sequence and amino acid sequence of mouse-derived Shootin1. These sequences themselves are disclosed in the accession number “AK082304” of DDBJ / EMBL / GenBank databases, and are known sequences. However, there is no disclosure or suggestion of its function.

  As a result of analyzing the genome information, it was found that the other two splicing variants Shootin2 (p52b) and Shootin3 (p52c) exist in the Shootin1 (p52a). FIG. 2 is a diagram comparing the schematic structures of Shootin1 (p52a in the figure) and its splicing variants Shootin2 (p52b in the figure) and Shootin3 (p52c in the figure). AE corresponds to each exon on the genome.

  Mouse-derived Shootin2 (p52b) consists of 631 amino acids and has a region corresponding to exons A and B in common with Shootin1 (p52a). On the other hand, rat-derived Shootin3 (p52c) consists of 599 amino acids and has a region corresponding to exon A in common with Shootin1 (p52a). In either case, the sequence is known. The sequence of mouse-derived Shootin2 is disclosed in accession number “BC030338”, and the sequence number of rat-derived Shootin3 is disclosed in “XM — 214734”. Shootin2 and Shootin3 are present not only in mice and rats but also in zebrafish, and human homologs are also considered. Since Shootin2 and Shootin3 are structurally similar to Shootin1, it is considered that Shootin2 and Shootin3 have the same function as Shootin1, ie, the action of inducing formation and elongation of nerve axons.

About the above Shootin1, as a result of expressing cloned human Shootin1 and creating an anti-Shootin1 antibody based on this, the following findings were obtained (details such as experimental methods are described in the examples below) explain).
(1) Western blot analysis using anti-Shootin1 antibody was used to examine the presence and timing of expression in various rat organs. Shootin1 was specifically expressed in the brain, and the expression level was determined by the formation of axons. Strong expression was observed in the brain on the fourth day after birth (P4) (FIG. 3).
(2) Strong concentration of Shootin1 was observed in the growing cone at the tip of the axon that was growing in cultured neurons prepared from the rat hippocampus on the 18th day of embryogenesis (FIG. 4).
(3) When Shootin1 was expressed exogenously in cultured hippocampal neurons, formation of multiple axons was induced (FIG. 5). When Shootin1 was expressed exogenously in neurons, Shootin1 also showed localization to the growth cone at the tip of the axon (FIG. 6).
(4) Shootin1 was localized in a vesicle-shaped growth cone during axon formation and elongation, and showed dynamic movement in the growth cone.

  These results indicate that Shootin1 is present in the axon growth cone and plays an important role in the formation of nerve axons. In particular, since the formation of axons was induced by expressing Shootin1 in neurons, it is possible to induce and promote axon formation or elongation in neurons by positively controlling Shootin1 expression or activity it can.

  For example, a method of inducing and promoting the formation or elongation of nerve axons by introducing the Shootin1 gene into nerve cells using a vector such as a viral vector and expressing exogenous Shootin1. In addition, this Shootin1 gene vector can be used as a gene therapy for nerve regeneration to regenerate damaged nerve cells. In vivo or ex vivo methods can be used for gene transfer into nerve cells. In vivo, a known gene carrier or drug delivery system is used to efficiently transfer genes locally into nerve cells. be able to.

  Examples of methods for positively controlling Shootin1 expression or activity include methods for increasing endogenous Shootin1 expression and methods for enhancing endogenous (or exogenous) Shootin1 activity in addition to the methods described above. be able to. These methods are preferably carried out by drug administration. Therefore, screening methods for searching for substances that enhance Shootin1 expression and activity are useful, and such screening methods are also included in the present invention.

  As the screening method of the present invention, various conventionally known methods for examining gene / protein expression levels, protein activity changes and the like can be applied, and are not particularly limited. Moreover, you may use the screening method newly developed after this invention. Either in vitro or in vivo screening systems may be used, and screening may be performed with a cell-free system. The Shootin1 gene / protein may be derived from rats, mice and other animals in addition to those derived from humans. Of course, screening may be performed using information on the higher order structure of Shootin1 protein.

  Examples of the screening method include (1) a screening method for a substance that binds to Shootin1 and enhances its activity by a binding assay such as affinity column method, yeast-two-hybrid method, immunoprecipitation method, and (2) candidate substance. Examples thereof include a method for screening a substance that is administered to a nerve cell and increases the expression level of endogenous Shootin1.

  As described above, Shootin1 is localized in the vesicle shape in the nerve growth cone and strong enrichment is observed, so it is highly likely that they are bound to each other directly or indirectly through other molecules. If Shootin1 has such a binding ability, it is considered that the activity is controlled by the presence or absence of the binding.

  Shootin1 is expressed at a high level in the growth cone, where the nerve axon is just elongated, and its expression promotes axon formation. Therefore, Shootin1 is an important target molecule for regenerative medicine of nerve axons. In addition, for clinical application of Shootin1, it will be important to clarify the intracellular molecular mechanism of Shootin1's axonal formation. Anti-Shootin1 antibodies that specifically detect Shootin1 protein and RNAi reagents that specifically suppress Shootin1 expression are useful as research reagents.

  Anti-Shootin1 antibody can be obtained as a polyclonal antibody by a known method by injecting rabbit or the like as a antigen with a peptide synthesized based on Shootin1 full-length protein or its epitope region. The epitope region can be estimated by predicting a hydrophilic region by the method of Kite & Doolittle. Of course, a monoclonal antibody of Shootin1 may be prepared by a known method. Known methods include those described in, for example, Harlow et al., “Antibodies: A laboratory manual (Cold Spring Harbor Laboratory, New York (1988))”, Iwasaki et al., “Monoclonal antibody hybridoma and ELISA, Kodansha (1991)”. A method is mentioned.

  By screening an expression library using the anti-Shootin1 antibody, a gene encoding a protein having an action of inducing axon formation or elongation in nerve cells can be obtained. That is, a plasmid linked to a λ phage vector so as to express cDNA is packaged, infected with E. coli, and spread on agar to form a plaque. An appropriate size of plaque (for example, cultured at 37 ° C. for 8 hours) is covered with a nitrocellulose membrane or a nylon membrane, and the cDNA product is bound to the membrane. A clone expressing a protein having a similar amino acid sequence can be found. Antibody treatment typically uses a Shootin 1 antibody as the primary antibody and an anti-primary antibody labeled with peroxidase or alkaline phosphatase as the secondary antibody (eg, an anti-rabbit IgG antibody if the primary antibody is derived from a rabbit). You may label and use an antibody. If candidate plaques are obtained by these screenings, a full-length cDNA clone can be obtained by a method well known to those skilled in the art using the cDNA fragment as a probe. Alternatively, a commercially available cDNA 5'-end cloning kit may be used. By introducing the clone thus obtained into a nerve cell and assaying the axon formation and elongation activity, a gene of a protein having nerve axon formation and elongation activity can be obtained.

  The Shootin1-specific RNAi reagent may be siRNA or an RNAi expression vector as described above. The RNAi reagent is not necessarily required to completely suppress the expression of Shootin1 protein, and any RNAi reagent may be used as long as it substantially reduces the expression level of Shootin1 protein in the cell.

  EXAMPLES Hereinafter, although an Example demonstrates this invention more concretely, this invention is not limited at all by these Examples.

[Example 1: Cloning of human and rat Shootin1 gene]
The inventor recently developed a highly sensitive two-dimensional electrophoresis method (Inagaki N. and Katsuta K, Curr. Proteomics 1, 35-39, 2004). Using this method, about 6,200 proteins of cultured rat hippocampal neurons were screened, and 277 protein spots whose expression levels increased with the formation of nerve axons were detected.

  Similarly, about 5,200 proteins were screened to detect protein spots concentrated in 200 nerve axons. One of the proteins commonly detected in the above two different screens is analyzed with a MALDI-TOF / MS mass spectrometer and matched with the amino acid sequence in the protein encoded by a known human cDNA (KIAA1598) 10 Peptides were detected.

Human cDNA (KIAA1598) encodes 446 amino acids deleted at the 5′-end. That is, analysis by the present inventors such as BLAST search revealed that this gene lacks the N-terminal 10 amino acids. Therefore, it was next decided to clone a gene encoding a 456 amino acid sequence. Specifically, PCR was performed using human cDNA (KIAA1598) as a template and using forward and reverse primers having the following sequences.
Forward primer: 5'-GCGGATCCATGAACAGCTCGGACGAAGAGAAGCAGCTGCAGCTCATTACCAGTCTGAAG (SEQ ID NO: 10)
Reverse primer: 5'-GCGGATCCCTACTGGGAGGCCAGTATTC (SEQ ID NO: 11)

  The gene cloned in this way and the protein encoded by the same gene were originally called “p52a”, but were finally named “Shootin1”. The cDNA sequence and amino acid sequence of Shootin1 are shown in SEQ ID NOs: 1-3.

In order to clone the rat Shootin1 gene by the same method as the above human Shootin1, PCR was performed from the rat cDNA library (Clontech) using the forward primer and reverse primer of the following sequences.
Forward primer: 5'-CCGCTCGAGATGAACAGCTCGGACGAGGAGAAG (SEQ ID NO: 12)
Reverse primer: 5'-CCGCTCGAGTTACTGGGAGGCCAGGATTCCCTTCAG (SEQ ID NO: 13)
The cloned Shootin1 cDNA and amino acid sequences are shown in SEQ ID NOs: 4-6.

[Example 2: Analysis of tissue expression of Shootin1 in each organ of rats]
Production and Purification of Anti-Shootin1 Antibody Human Shootin1 GST fusion protein cloned by the above method was expressed in E. coli and purified using a Glutathion Sepharose 4B column. GST was cleaved and removed from the purified protein using protease, and the resulting Shootin1 was immunized to rabbits to prepare antibodies according to a conventional method. The obtained antibody was subjected to column purification using Shootin1 as a ligand, and the purified antibody was used for all experiments.

Immunoblotting
SDS samples were prepared from various Wistar rat tissues, and each 15 μg sample was separated on a 10% polyacrylamide gel. Thereafter, the protein was transferred to a PVDF membrane, and Shootin1 was detected with the above-mentioned anti-Shootin1 antibody (diluted 1000 times), HRP-labeled anti-rabbit IgG antibody (diluted 2000 times) and ECL reagent (Amersham Bioscience). As a result, as shown in FIG. 3, Shootin1 was specifically expressed in the brain, and the expression level was greatly increased on the fourth day after birth (P4) when axons were formed.

[Example 3: Analysis of intracellular distribution of Shootin1 in cultured rat hippocampal neurons]
Preparation of rat cultured hippocampal neurons The hippocampus of Wistar rats on the 18th day of embryonic life was excised and enzymatically digested with papain to prepare isolated neurons. The obtained neurons were cultured on poly-D-lysine and laminin-coated coverslips in a culture solution (Neurobasal Medium, B-27 supplement, 1 mM glutamine, 2.5 μM cytosine β-D-arabinofuranoside) at 37 ° C., 5 They were cultured in the conditions of the% CO _2.

Immunostaining of cultured rat hippocampal neurons Rat cultured hippocampal neurons on the third day of culture were fixed with 3.7% formalin on ice for 10 minutes, and membrane permeabilized with -20 ° C methanol for 10 minutes. Then, the anti-Shootin1 antibody (diluted 5000 times) as a primary antibody was reacted at 4 ° C for 1 day, and the secondary antibody was reacted with ALEXA488-labeled anti-rabbit IgG antibody (diluted 1000 times) for 1 hour at room temperature to visualize Shootin1. Went. The result is shown in FIG. As shown in the figure, in the cultured neurons prepared from the embryonic rat hippocampus on the 18th day, a strong concentration of Shootin1 was observed in the growing cone of the axonal tip that was growing.

[Example 4: Analysis of nerve axon formation ability by exogenous expression of Shootin1]
Human Shootin1 with a Myc-tag was subcloned into mammalian cell expression vector pCAGGS having an actin promoter (see Niwa et al., Gene 108 (1991), p193-200) to create a Shootin1 expression vector.

This vector was transfected into neurons prepared from the hippocampus of embryonic day 18 Wistar rats using Nucleofector ^™ (AMAXA biosystems) and cultured on a cover glass. On day 7 of culture, neurons were fixed as described above, and nerve cells expressing exogenous Shootin1 were visualized using an anti-myc antibody, and their morphology was analyzed. The result is shown in FIG. As shown by the arrows in the figure, formation of multiple axons was induced when Shootin1 was overexpressed exogenously in cultured hippocampal neurons.

  FIG. 6 is a diagram showing intracellular localization when Shootin1 is expressed exogenously in rat hippocampal cultured neurons. Specifically, the hippocampus excised from the rat on day 18 of gestation was dispersed in culture for 2 days, transfected with a human Shootin1 expression vector with a myc tag, and immunostained 5 days later (primary antibody anti-myc × 400, Detection was performed with a secondary antibody anti-rabbit × 800). The upper part of FIG. 6 is an overall view of the transfected nerve cells, and the lower part is an enlarged view of the vicinity of the axon growth cone surrounded by a square. As shown in the figure, when Shootin1 is expressed exogenously, strong concentration of Shootin1 is observed in the growth cone at the tip of the axon.

  Furthermore, (1) Analysis with a high-resolution sectioning microscope revealed that Shootin1 was localized in the vesicle shape in the nerve growth cone, and (2) Analysis with a time-lapse microscope showed that Shootin1 moved dynamically in the nerve growth cone. .

  As described above, the present invention can be used to develop a new nerve regeneration technique. For example, it can be used as an effective treatment for central and peripheral nerve disorders caused by stroke, spinal cord injury, etc. in the establishment and research and development stage of axonal regeneration medical technology. More specifically, it is used in a treatment method for promoting regeneration of nerve axons by expressing Shootin1 having an axon formation promoting action via a vector such as a virus in nerve cells of a patient with a disorder, or Shootin1 It can be expected to be used in various clinical and pharmaceutical development fields, such as the search for a substance that activates Shootin1 as a probe for the development of therapeutic agents for nerve axon regeneration.

It is a figure which shows roughly the structure of Shootin1 (p52a) clarified as a result of analysis. It is a figure which compares and shows schematic structure of Shootin1 (p52a) and its splicing variant Shootin2 (p52b) and Shootin3 (p52c). In the figure, AE corresponds to each exon on the genome. It is a figure which shows the result of having investigated the expression distribution in each organ of Shootin1 using an anti-Shootin1 antibody, and the change of the expression level in the brain in the developmental stage. It is a figure which shows the result of having investigated the distribution of Shootin1 in a cultured hippocampal nerve cell using an anti-Shootin1 antibody. It is a figure showing that multiple axons were formed in cultured hippocampal neurons by overexpression of Shootin1, and immunostained images with anti-myc antibody and immunostained images with axon marker antibody (anti-tau1) It is a superposition. It is a figure which shows the intracellular localization when Shootin1 is expressed exogenously in rat hippocampal cultured neurons, the upper part is a general view of the nerve cells that exogenously expressed Shootin1, and the lower part is an axon surrounded by a square It is an enlarged view near the growth cone.

SEQ ID NO: 1: cDNA sequence of human-derived Shootin1 SEQ ID NO: 2: cDNA sequence of human-derived Shootin1 and amino acid sequence encoded thereby SEQ ID NO: 3: amino acid sequence of human-derived Shootin1 SEQ ID NO: 4: cDNA sequence sequence number of rat-derived Shootin1 5: Rat-derived Shootin1 cDNA sequence and amino acid sequence encoded thereby SEQ ID NO: 6: Rat-derived Shootin1 amino acid sequence SEQ ID NO: 7: Mouse-derived Shootin1 cDNA sequence SEQ ID NO: 8: Mouse-derived Shootin1 cDNA sequence and encoded thereby Amino acid sequence SEQ ID NO: 9: amino acid sequence of mouse-derived Shootin1 SEQ ID NO: 10: PCR forward primer sequence for human cDNA cloning SEQ ID NO: 11: PCR reverse primer sequence for human cDNA cloning SEQ ID NO: 12: for rat cDNA cloning CR forward primer sequence SEQ ID NO 13: PCR reverse primer sequence for the rat cDNA cloning

Claims (5)

A method for inducing axon formation or elongation in nerve cells by positively controlling expression or activity of a nerve growth cone localized molecule Shootin1 comprising a protein shown in any of the following (a) to (f) ( (Excluding methods applicable to human medical practice):
(A) a protein comprising the amino acid sequence represented by SEQ ID NO: 3,
(B) The amino acid sequence shown in SEQ ID NO: 3 consists of an amino acid sequence in which one or several amino acids are deleted, substituted or added, and has the effect of inducing axon formation or elongation in nerve cells. protein,
(C) a protein consisting of the amino acid sequence shown in SEQ ID NO: 6,
(D) The amino acid sequence shown in SEQ ID NO: 6 consists of an amino acid sequence in which one or several amino acids are deleted, substituted or added, and has an action of inducing axon formation or elongation in nerve cells. protein,
(E) a protein consisting of the amino acid sequence shown in SEQ ID NO: 9, and
(F) The amino acid sequence shown in SEQ ID NO: 9 consists of an amino acid sequence in which one or several amino acids are deleted, substituted or added, and has the effect of inducing axon formation or elongation in nerve cells. Protein . The method for inducing nerve axon formation / elongation according to claim 1, wherein the intracellular expression of Shootin1 is positively controlled by introducing a gene encoding the nerve growth cone localized molecule Shootin1 into a nerve cell. . A nerve axon formation / elongation inducer comprising a recombinant expression vector constructed to express a gene encoding the nerve growth cone localized molecule Shootin1 according to claim 1 in nerve cells. A gene therapy drug for nerve regeneration comprising a recombinant expression vector constructed to express a gene encoding the nerve growth cone localized molecule Shootin1 according to claim 1 in nerve cells. A reagent for research related to formation or elongation of nerve axons or nerve regeneration, which is an RNAi reagent introduced into cells in order to specifically suppress the expression of the nerve growth cone localized molecule Shootin1 according to claim 1 .