KR102147491B1 - Pharmaceutical composition for preventing or treating infertility or abortion comprising inhibitors of DEPTOR protein or mSIN1 protein as an active ingredient - Google Patents

Abstract

The present invention relates to a pharmaceutical composition for the prevention or treatment of infertility or miscarriage containing a DEPTOR (DEP domain-containing mTOR-interacting protein) protein inhibitor or mSIN1 (mammalian stress-activated protein kinase interacting protein 1) protein inhibitor as an active ingredient. will be. Specifically, in the present invention, in the process of decidualization, the activity of mTORC1 (mammalian target of rapamycin complex 1) increases, and the activity of mTORC2 decreases. At this time, the DEPTOR protein, a negative regulator of mTORC1, increases. By confirming that expression and binding to mTORC1 are reduced, expression of mSIN1 protein, a positive regulator of mTORC2, and binding to mTORC2 are reduced, DEPTOR protein inhibitors or mSIN1 protein inhibitors are useful in the treatment of infertility or abortion. Can be used.

Description

Pharmaceutical composition for preventing or treating infertility or abortion containing inhibitors of DEPTOR protein or mSIN1 protein as an active ingredient {Pharmaceutical composition for preventing or treating infertility or abortion comprising inhibitors of DEPTOR protein or mSIN1 protein as an active ingredient}

The present invention relates to a pharmaceutical composition for the prevention or treatment of infertility or miscarriage containing a DEPTOR (DEP domain-containing mTOR-interacting protein) protein inhibitor or mSIN1 (mammalian stress-activated protein kinase interacting protein 1) protein inhibitor as an active ingredient. will be.

Infertility is a failure to reach pregnancy within one year despite normal marital relationships, and male factors, ovarian function decline, ovulation disorders, fallopian tube damage, cervical factors, uterine factors, and immunological factors have been reported as causes. Pregnancy is terminated before the fetus is viable, and genetic factors due to chromosomal abnormalities, anatomical abnormalities of the uterus or endometrium, intrauterine infection, and endocrine problems due to hormonal abnormalities have been reported. However, in many cases, the cause of infertility or miscarriage is often unknown, and development of a therapeutic agent based on the cause is difficult.

The endometrium, an environment in which embryos are implanted and developed, is a layer that makes up the inner wall of the uterus, and its shape and function change according to a certain cycle by the control of estrogen and progesterone. In early pregnancy, endometrial stromal cells differentiate into decidual cells through decidualization, such as prolactin and insulin-like growth factor binding protein 1 (IGFBP1). A specific gene is expressed, and the shape of the cell changes from an elongated shape to a round shape and a large cytoplasm (Ha Zhu et al ., Gene, 2014, 551(1): 1-14). It is known that decidualization of endometrial cells during the initial gestation period is very important for implantation of fertilized eggs (Dunn et al ., Reprod Biomed Online 7, 2003, 151-161).

On the other hand, mTOR (mammalian target of rapamycin) is a mammalian target of rapamycin and regulates the cell development process by various cellular signaling systems, growth factors, and nutrients. mTOR forms two complexes, mTORC1 (mammalian target of rapamycin complex 1) is composed of mTOR, raptor, and mLST8, and protein translation by phosphorylating S6K1 (S6 kinase 1) and 4EBP (eukaryotic initiation factor 4E-binding protein). And control synthesis, mTORC2 is composed of mTOR, rictor, mLST8, and mSIN1, and regulates cell survival and cytoskeleton reconstruction by activating Akt, serum/glucocorticoid kinase, and protein kinase Cα. . mTOR is being studied as a target for the treatment of these diseases because its inhibitors exhibit immunosuppressive, antiproliferative and anticancer activities (Soliman GA, Current Opinion in Lipidology, 2005, 16: 317-323), and autophagy. ) Since it regulates the autodigestion pathway as an important factor in regulation, it has been studied as a target for the treatment of cancer, neurodegenerative diseases, heart diseases, aging, immune diseases, infectious diseases and Crohn's disease (Mizushima N. et al . , Nature, 2008, 451: 1069-1075), the mechanism by which mTOR acts on decidualization, implantation, or pregnancy has not been studied.

An object of the present invention is to provide a use of a DEPTOR protein inhibitor or an mSIN1 protein inhibitor to prevent or treat infertility or miscarriage.

In order to achieve the above object, the present invention provides a pharmaceutical composition for the prevention or treatment of infertility or miscarriage containing a DEPTOR gene expression inhibitor or DEPTOR protein activity inhibitor as an active ingredient.

In addition, the present invention provides a pharmaceutical composition for preventing or treating infertility or miscarriage, containing an mSIN1 gene expression inhibitor or an mSIN1 protein activity inhibitor as an active ingredient.

In addition, the present invention provides a health functional food for preventing or improving infertility or miscarriage, containing a DEPTOR gene expression inhibitor or a DEPTOR protein activity inhibitor as an active ingredient.

In addition, the present invention provides a health functional food for preventing or improving infertility or miscarriage, containing an mSIN1 gene expression inhibitor or an mSIN1 protein activity inhibitor as an active ingredient.

In addition, the present invention comprises the steps of: 1) treating a test substance on a cell line expressing DEPTOR protein; 2) measuring the expression level of the DEPTOR protein in the cell line; And 3) selecting a test substance whose expression level of the DEPTOR protein is reduced compared to a control test substance not treated with the test substance.

In addition, the present invention comprises the steps of: 1) treating a test substance in a cell line expressing mSIN1 protein; 2) measuring the expression level of the mSIN1 protein in the cell line; And 3) selecting a test substance whose expression level of the mSIN1 protein is reduced compared to a control test substance not treated with the test substance.

In the present invention, in the process of decidualization, the activity of mTORC1 (mammalian target of rapamycin complex 1) increases, and the activity of mTORC2 decreases. At this time, the expression of DEPTOR protein, a negative regulator of mTORC1, and mTORC1 By confirming that the binding of the protein is reduced, expression of mSIN1 protein, a positive regulator of mTORC2, and binding to mTORC2 are reduced, DEPTOR protein inhibitors or mSIN1 protein inhibitors can be usefully used in the treatment of infertility or abortion. have.

1 is a diagram showing changes in expression and activity of mTORC constituent proteins and mTOR kinase activity-related proteins (Diff: differentiation).
FIG. 2 is a diagram showing the expression of a deciduous marker gene and changes in the number of differentiated cells by knockdown of raptor, a major component of mTORC1 (Diff: differentiation).
3 is a diagram showing the expression of a deciduous marker gene and the change in the number of differentiated cells by knockdown of rictor, a major component of mTORC2 (Diff: differentiation).
Fig. 4 is a diagram showing changes in phosphorylation of S6K1 (p70S6 kinase 1) protein and S6 protein (Diff: differentiation).
Fig. 5 is a diagram showing changes in the expression of a PRL (prolactin) gene by inhibition of S6K1 protein activity (Diff: differentiation).
6 is a diagram showing changes in phosphorylation of IRS-1 protein (Diff: differentiation).
7 is a diagram showing the expression change of the PRL gene by rapamycin, an mTOR protein activity inhibitor (Diff: differentiation).
FIG. 8 is a diagram showing changes in phosphorylation of IRS-1 (insulin receptor substrate-1) protein by knockdown of raptor, a major component of mTORC1 (Diff: differentiation).
9 is a diagram showing changes in the expression of DEPTOR proteins and genes (Diff: differentiation).
Figure 10 is a diagram showing the expression of the DEPTOR protein in mTORC1 or mTORC2, and the interaction change between the raptor protein and the IRS-1 protein in mTORC1 (Diff: differentiation).
Figure 11 is a diagram showing the binding of the DEPTOR protein to mTORC1 by PA (phosphatidic acid), and the interaction change between the raptor protein and the IRS-1 protein (PA: phosphatidic acid (phosphatidic acid).
12 is a diagram showing the change in phosphorylation of S636/639 of the IRS-1 protein by knockdown of DEPTOR.
13 is a diagram showing changes in the expression of DEPTOR, PRL, and IGFBP1 genes and changes in the number of differentiated cells by knockdown of DEPTOR (Diff: differentiation).
14 is a diagram showing the change in phosphorylation of S636/639 of IRS-1 protein by overexpression of DEPTOR.
15 is a diagram showing changes in the expression of DEPTOR and PRL genes due to overexpression of DEPTOR (Diff: differentiation).
FIG. 16 is a diagram showing changes in phosphorylation of Akt protein and FOX O1 protein (Forkhead box O1) (Diff: differentiation).
17 is a diagram showing the change in the expression of mSIN1 protein during decidualization (Diff: differentiation).
18 is a diagram showing the change in the degree of binding of mSIN1 protein in mTORC2 during decidualization (Diff: differentiation).
FIG. 19 is a diagram showing changes in phosphorylation of Akt protein and FOX O1 protein by knockdown of mTORC2 (Diff: differentiation).
FIG. 20 is a diagram showing the change in phosphorylation of Akt protein by knockdown of raptor, a major component of mTORC1 (Diff: differentiation).
Fig. 21 is a diagram showing changes in phosphorylation of Akt protein and FOX O1 protein by knockdown of DEPTOR (Diff: differentiation).
22 is a diagram showing changes in phosphorylation of Akt protein and FOX O1 protein due to overexpression of DEPTOR (Diff: differentiation).
23 is a diagram schematically illustrating a process in which DEPTOR and mSIN1 proteins are separated from mTORC1 and mTORC2, respectively, during decidualization.

Hereinafter, the present invention will be described in detail.

The present invention provides a pharmaceutical composition for the prevention or treatment of infertility or miscarriage containing a DEPTOR gene expression inhibitor or a DEPTOR protein activity inhibitor as an active ingredient.

The DEPTOR gene may be a polynucleotide composed of a nucleotide sequence represented by SEQ ID NO: 1.

The expression inhibitor of the DEPTOR gene may contain any material known in the art as long as it suppresses the mRNA of the gene encoding the DEPTOR protein, and can be prepared by various methods such as chemically synthesized or synthesized using in vitro transcription. I can. The expression inhibitor may include any one or more selected from the group consisting of an antisense nucleotide complementarily binding to a polynucleotide constituting the DEPTOR gene, a small interfering RNA (siRNA), and a short hairpin RNA (shRNA). I can.

The antisense nucleotide, as defined by the Watson-Click base pair, binds (hybridizes) to the complementary nucleotide sequence of DNA, immature-mRNA or mature mRNA, thereby preventing the flow of genetic information from DNA to protein. In addition, since the antisense nucleotide is a long chain of monomer units, it can be easily synthesized with respect to the target RNA sequence.

The siRNA refers to a short double-stranded RNA capable of inducing RNA interference through cleavage of a specific mRNA. In addition, the siRNA is not limited to a complete pair of double-stranded RNA portions that form a pair of RNAs, and mismatches (corresponding bases are not complementary), bulge (no base corresponding to one chain), etc. It may also include a part that is not paired. The siRNA terminal structure can be either a blunt end or a protruding end, as long as the expression of a target gene can be suppressed by an RNA interference effect, and the adhesive end structure can be both a 3'end overhang structure and a 5'end overhang structure.

The shRNA refers to a sequence of RNA that makes a strong hairpin turn, which can be used to silence gene expression through RNA interference. In addition, the shRNA can be delivered to cells using a vector for cell introduction, and such vectors are always delivered to daughter cells, so that gene silencing can be inherited. The shRNA hairpin structure is degraded into siRNA by an intracellular mechanism and is bound to an RNA-induced silencing complex, and the complex binds to an mRNA corresponding to the siRNA to degrade it.

In addition, the DEPTOR protein may be a polypeptide composed of an amino acid sequence represented by SEQ ID NO: 2.

The DEPTOR protein activity inhibitor is any one or more selected from the group consisting of compounds, peptides, peptide mimetics, matrix analogs, aptamers, and antibodies that bind complementarily to the polypeptide constituting the DEPTOR protein. It may include.

The peptide and peptide mimetics may inhibit the DEPTOR protein from binding to other proteins, thereby inhibiting the activity of the DEPTOR protein. The peptide mimetics may be a peptide or a non-peptide, and may be composed of an amino acid bound by a non-peptide bond such as a psi bond. Non-hydrolyzable peptide mimetics can be prepared using a β-turn dipeptide core, keto-methylene pseudopeptides, azepine, benzodiazepine, β-amino alcohol, or substituted gammalactam ring as the main residue.

The aptamer refers to a single-stranded nucleic acid (DNA, RNA, or modified nucleic acid) having a characteristic that can bind to a target molecule with high affinity and specificity while having a stable tertiary structure by itself, and molecular organic matter, peptide , It can be seen as a kind of chemical antibody that replaces a single antibody because it can bind to membrane proteins and block its function. In addition, the aptamer can be obtained by separating oligomers that bind to specific chemical molecules or biological molecules with high affinity and selectivity using an oligonucleotide library called SELEX (systematic evolution of ligands by exponential enrichment). .

The antibody may be a monoclonal antibody, a polyclonal antibody, or a recombinant antibody. Antibodies against a specific protein can be easily prepared using techniques well known in the art if the sequence of the protein is known. Specifically, it can be prepared using a hybridoma method or phage antibody library technology. In general, hybridoma cells secreting monoclonal antibodies can be made by fusion of immune cells isolated from an immunologically suitable host animal such as a mouse injected with an antigenic protein and a cancer cell line. The fusion of these two groups of cells can be fused using polyethylene glycol or the like, and the antibody-producing cells can be proliferated by standard culture methods. After subcloning is performed using a limiting dilution method, a homogeneous cell population is obtained, and then hybridoma cells capable of producing an antigen-specific antibody can be prepared by culturing in a large amount in vitro or in vivo. The antibody prepared by the above method can be separated and purified using a method such as gel electrophoresis, dialysis, salt precipitation, ion exchange chromatography, and affinity chromatography.

The polyclonal antibody can be prepared by injecting a biomarker protein or fragment thereof as an immunogen into an external host. The external host can be a mammal such as a mouse, rat, sheep, or rabbit. When the immunogen is injected by intramuscular, intraperitoneal or subcutaneous injection, it may be administered together with an adjuvant for increasing antigenicity. Thereafter, blood may be collected from an external host on a regular basis to obtain serum showing improved titer and specificity for an antigen, and the antibody may be isolated and purified therefrom.

In addition, the present invention provides a pharmaceutical composition for preventing or treating infertility or miscarriage, containing an mSIN1 gene expression inhibitor or an mSIN1 protein activity inhibitor as an active ingredient.

The mSIN1 gene may be a polynucleotide composed of a nucleotide sequence represented by SEQ ID NO: 3.

The mSIN1 gene expression inhibitor may contain any material known in the art as long as it suppresses the mRNA of the gene encoding the mSIN1 protein, and can be prepared by various methods such as chemically synthesized or synthesized using in vitro transcription. I can. The expression inhibitor may include any one or more selected from the group consisting of antisense nucleotides, siRNAs (small interfering RNAs), and shRNAs (short hairpin RNAs) that complementarily bind to the polynucleotides constituting the mSIN1 gene. I can.

The antisense nucleotide, siRNA, or shRNA may have the characteristics as described above.

In addition, the mSIN1 protein may be a polypeptide composed of an amino acid sequence represented by SEQ ID NO: 4.

The mSIN1 protein activity inhibitor is any one or more selected from the group consisting of compounds, peptides, peptide mimetics, matrix analogs, aptamers, and antibodies that complementarily bind to the polypeptide constituting the mSIN1 protein. It may include.

The peptide, peptide mimetics, aptamer or antibody may have the characteristics as described above.

In a specific embodiment of the present invention, the present inventors increase the phosphorylation of the 2481 th serine (S2481-mTOR) of the mTOR protein by mTORC1 (raptor) and decrease the phosphorylation of S2481-mTOR by mTORC2 (rictor) in the process of decidualization. (See Fig. 1), increased phosphorylation of S636/639-IRS-1 by mTORC1, displacement of DEPTOR protein, and increased interaction between raptor protein and IRS-1 protein (Fig. 6 and Fig. 10), negative regulation of deciduous membrane through inhibition of S636/639-IRS-1 phosphorylation of DEPTOR protein and reduction in expression of mSIN1 protein, a positive regulator of mTORC2, were confirmed (FIGS. 12 to 15 , See FIGS. 17 and 18), it was confirmed that the phosphorylation of Akt and FOX O1 proteins decreased by increasing mTORC1 activity or decreasing mTORC2 activity (see FIGS. 16 and 19 to 22).

Accordingly, the inhibitor of DEPTOR gene expression, the inhibitor of DEPTOR protein activity, the mSIN1 gene expression inhibitor, or the mSIN1 protein activity inhibitor of the present invention may be usefully used in the prevention or treatment of infertility or miscarriage.

The pharmaceutical composition contains 10 to 95% by weight of the active ingredient, the DEPTOR gene expression inhibitor, the DEPTOR protein activity inhibitor, the mSIN1 gene expression inhibitor, or the mSIN1 protein activity inhibitor according to the present invention, based on the total weight of the pharmaceutical composition. Can include. In addition, the pharmaceutical composition of the present invention may further contain one or more active ingredients exhibiting the same or similar functions in addition to the active ingredients.

The compositions of the present invention may also contain carriers, diluents, excipients or combinations of two or more commonly used in biological preparations. The pharmaceutically acceptable carrier is not particularly limited as long as it is suitable for delivering the composition in vivo, and examples include Merck Index, 13th ed., Merck & Co. Inc. The compound described in, saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, or a mixture of one or more of these components. At this time, other conventional additives such as antioxidants, buffers, and bacteriostatic agents may be added as needed.

When the composition is formulated, it is prepared using a diluent or excipient such as a filler, extender, binder, wetting agent, disintegrant, or surfactant, which is usually used.

The composition of the present invention may be formulated as an oral or parenteral formulation. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, troches, and the like, and these solid preparations include at least one excipient in one or more compositions, such as starch, calcium carbonate, sucrose, It can be prepared by mixing lactose and gelatin. In addition, lubricants such as magnesium stearate and talc may be added. On the other hand, the liquid formulation includes a suspension agent, a liquid solution agent, an emulsion or a syrup agent, and the like, which may include excipients such as wetting agents, sweetening agents, fragrances, and preservatives.

Formulations for parenteral administration may include injections such as sterilized aqueous solutions, non-aqueous solutions, suspensions, and emulsions. Propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate may be used as the non-aqueous solvent and the suspension.

The composition of the present invention may be administered orally or parenterally according to a desired method, and parenteral administration may be performed by external or intraperitoneal injection, rectal injection, subcutaneous injection, intravenous injection, intramuscular injection, or intrathoracic injection. Can be chosen.

The composition according to the present invention is administered in a pharmaceutically effective amount. This may vary depending on the type of disease, the severity, the activity of the drug, the sensitivity to the drug, the administration time, the route of administration and the rate of excretion, the treatment period, and the drugs used simultaneously. The composition of the present invention may be administered alone or in combination with other therapeutic agents. When administered in combination, administration may be sequential or simultaneous. However, for a desirable effect, the amount of the active ingredient contained in the pharmaceutical composition according to the present invention may be 0.001 to 10,000 mg/kg, specifically 0.1 to 5000 mg/kg. The administration may be once a day or may be divided into several times.

In addition, the present invention provides a health functional food for preventing or improving infertility or miscarriage, containing a DEPTOR gene expression inhibitor or a DEPTOR protein activity inhibitor as an active ingredient.

The DEPTOR gene and the expression inhibitor of the DEPTOR gene may have the characteristics as described above. For example, the DEPTOR gene may be a polynucleotide composed of a nucleotide sequence described in SEQ ID NO: 1. In addition, the expression inhibitor may include any one or more selected from the group consisting of antisense nucleotides, siRNAs, and shRNAs that complementarily bind to polynucleotides constituting the DEPTOR gene.

The DEPTOR protein and the inhibitor of activity of the DEPTOR protein may have the characteristics as described above. For example, the DEPTOR protein may be a polypeptide composed of an amino acid sequence represented by SEQ ID NO: 2. In addition, the activity inhibitor may include any one or more selected from the group consisting of compounds, peptides, peptide mimetics, matrix analogs, aptamers, and antibodies that complementarily bind to the polypeptide constituting the DEPTOR protein.

In addition, the present invention provides a health functional food for preventing or improving infertility or miscarriage, containing an mSIN1 gene expression inhibitor or an mSIN1 protein activity inhibitor as an active ingredient.

The mSIN1 gene and the mSIN1 gene expression inhibitor may have the characteristics as described above. For example, the mSIN1 gene may be a polynucleotide composed of a nucleotide sequence represented by SEQ ID NO: 3. In addition, the expression inhibitor may include any one or more selected from the group consisting of antisense nucleotides, siRNAs, and shRNAs that complementarily bind to polynucleotides constituting the mSIN1 gene.

The mSIN1 protein and the mSIN1 protein activity inhibitor may have the characteristics as described above. For example, the mSIN1 protein may be a polypeptide composed of an amino acid sequence represented by SEQ ID NO: 4. In addition, the activity inhibitor may include any one or more selected from the group consisting of compounds, peptides, peptide mimetics, matrix analogs, aptamers, and antibodies that complementarily bind to the polypeptide constituting the mSIN1 protein.

In a specific embodiment of the present invention, the present inventors increase the phosphorylation of the 2481 th serine (S2481-mTOR) of the mTOR protein by mTORC1 (raptor) and decrease the phosphorylation of S2481-mTOR by mTORC2 (rictor) in the process of decidualization. It was confirmed (see FIG. 1), and it was confirmed that the expression of mSIN1 protein, which is a negative regulation of mTORC2 and a positive regulator of mTORC2, was reduced through the inhibition of S636/639-IRS-1 phosphorylation of the DEPTOR protein ( 12 to 15, 17 and 18).

Therefore, the inhibitor of expression of the DEPTOR gene of the present invention, the inhibitor of the activity of the DEPTOR protein, the inhibitor of the expression of the mSIN1 gene, or the inhibitor of the mSIN1 protein may be usefully used for the prevention or improvement of infertility or miscarriage.

The term "health functional food" as used herein refers to a food manufactured using nutrients that are easily deficient in daily meals or raw materials or ingredients having useful functions for the human body, and refers to foods that help maintain human health, but is not limited thereto. It is used as a meaning that includes all health foods in the usual meaning.

The form and type of the health functional food is not particularly limited. Specifically, the health functional food may be in the form of tablets, capsules, powders, granules, liquids, and pills. The health functional food may contain various flavoring agents, sweetening agents, or natural carbohydrates as additional ingredients. The sweetener may be a natural or synthetic sweetener, and examples of the natural sweetener include taumatin and stevia extract. Meanwhile, examples of synthetic sweeteners include saccharin and aspartame. In addition, the natural carbohydrates may be monosaccharides, disaccharides, polysaccharides, oligosaccharides and sugar alcohols.

In addition to the above-described additional ingredients, the health functional food of the present invention includes nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pexane and salts thereof, alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives. , Glycerin, alcohol, and the like may be further included. These ingredients can be used independently or in combination. The proportion of the additive may be selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the composition of the present invention.

The DEPTOR gene expression inhibitor, the DEPTOR protein activity inhibitor, the mSIN1 gene expression inhibitor, or the mSIN1 protein activity inhibitor according to the present invention may be added to food as it is or used with other foods or food ingredients. At this time, the content of the added active ingredient may be determined according to the purpose. In general, the content of the health functional food may be 0.01 to 90 parts by weight of the total food weight. However, in the case of long-term intake for the purpose of health and hygiene or for health control purposes, the amount may be less than the above range, and if there is no problem in terms of safety, the active ingredient may be used in an amount greater than the above range.

In addition, the present invention provides a method for screening candidates for infertility or abortion treatment using DEPTOR protein.

The DEPTOR protein may have the characteristics as described above. For example, the DEPTOR protein may be a polypeptide composed of an amino acid sequence represented by SEQ ID NO: 2.

Specifically, the method comprises the steps of: 1) treating a test substance on a cell line expressing the DEPTOR protein; 2) measuring the expression level of the DEPTOR protein in the cell line; And 3) selecting a test substance whose expression level of the DEPTOR protein is reduced compared to a control group not treated with the test substance.

The test substance of step 1) may be at least one selected from the group consisting of peptides, proteins, non-peptidic compounds, active compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, and plasma.

The level of protein expression in step 2) was determined by enzyme-linked immunosorbent assay (ELISA), radioimmunoassays, sandwich enzyme immunoassay, western blot, immunoprecipitation, and immunity. It can be measured by any one or more methods selected from the group consisting of histochemical staining method (immunohistochemistry), fluorescence immunoassay method (fluoroimmunoassay), and flow cytometry (FACS).

In addition, the present invention provides a method for screening candidate substances for infertility or abortion treatment using mSIN1 protein.

The mSIN1 protein may have the characteristics as described above. For example, the mSIN1 protein may be a polypeptide composed of an amino acid sequence represented by SEQ ID NO: 4.

Specifically, the method comprises the steps of: 1) treating a test substance in a cell line expressing the mSIN1 protein; 2) measuring the expression level of the mSIN1 protein in the cell line; And 3) selecting a test substance whose expression level of the mSIN1 protein is decreased compared to a control group not treated with the test substance.

The test material of step 1) may have the characteristics as described above.

The method of measuring the level of protein expression in step 2) may have the above-described characteristics.

In a specific embodiment of the present invention, the present inventors increase the phosphorylation of the 2481 th serine (S2481-mTOR) of the mTOR protein by mTORC1 (raptor) and decrease the phosphorylation of S2481-mTOR by mTORC2 (rictor) in the process of decidualization. It was confirmed (see FIG. 1), and it was confirmed that the expression of mSIN1 protein, which is a negative regulation of mTORC2 and a positive regulator of mTORC2, was reduced through the inhibition of S636/639-IRS-1 phosphorylation of the DEPTOR protein ( 12 to 15, 17 and 18).

Therefore, the method of measuring the expression level of the DEPTOR protein of the present invention, or the method of measuring the expression level of the mSIN1 protein can be usefully used for screening candidates for treatment of infertility or abortion.

Hereinafter, the present invention will be described in detail by examples.

However, the following examples are merely illustrative of the present invention, and the contents of the present invention are not limited by the following examples.

Experimental Example 1. Control of decidualization by mTORC1 (mammalian target of rapamycin complex 1) and mTORC2 (mTOR complex 2)

1-1. Changes in expression and activity of mTORC constituent proteins during deciduous membrane

It was confirmed whether the expression of the mTORC constituent protein and the mTOR kinase activity-related protein was changed in the process of decidualization.

First, human endometrial stromal cells (hES) were isolated from the endometrium of a 40 to 45 year old premenopausal woman who had undergone hysterectomy, and dispensed into a tissue culture dish to 1 g/ DMEM (Dulbecco's modified Eagle's medium) medium containing L glucose and 10% FBS (fetal bovine serum) was added and cultured in an environment of 37°C and 5% CO2 until 100% concentration. Here, a DMEM medium containing 0.5 mM 8-Br-cAMP was treated to induce deciduous membrane formation, and a new medium was replaced once a day for 4 days. Cells are obtained on the 0, 2, or 4 days after induction of decidualization, dissolved in lysis buffer (Cell Signaling Technology, Cat# 9803, USA), and then used for 10 minutes at 13000 g with a microcentrifugation. During separation, a supernatant was obtained. The obtained supernatant was boiled in SDS (sodium dodecyl sulfate) sample buffer for 5 minutes, electrophoresed on SDS polyacrylamide gel, and then transferred to a polyvinylidene fluoride membrane. Western blot was performed. Primary antibodies include anti-mTOR antibody (Santa Cruz Biotechnology, Cat# 2972, USA), anti-raptor antibody (Bethyl Laboratories, Cat# A300-553A, USA), anti-rictor antibody (Bethyl Laboratories, Cat# A300- 459A, USA), and an anti-p2481-mTOR antibody (Cell Signaling Technology, Cat# 2974, USA), and as a secondary antibody, Goat anti-rabbit IgG (H+L) (Jackson ImmunoResearch Laboratories Inc., Cat# 711 -515-152, USA) was used.

Meanwhile, the supernatant obtained by the same method as described above was treated with an anti-raptor antibody or an anti-rictor antibody and G protein agarose at 4° C. for 1 hour. After centrifugation at 10000 g to obtain protein G agarose, Western blot was performed in the same manner as above. The lysis buffer for the immunoprecipitation method of raptor is 40 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (pH 7.4), 120 mM NaCl, 10 mM pyrophosphate, 50 mM NaF, 10 mM β- A buffer containing glycerophosphate, 2 mM EDTA, a protease inhibitor cocktail (Sigma-Aldrich, USA), and 0.3% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate was used. Primary antibodies include anti-mTOR antibody (Cell signaling technology, Cat# 2972, USA), anti-raptor antibody (Bethyl Laboratories, Cat# A300-553A, USA), anti-rictor antibody (Bethyl Laboratories, Cat# A300- 459A, USA), and an anti-p2481-mTOR antibody (Cell Signaling Technology, Cat# 2974, USA), and as a secondary antibody, Goat anti-rabbit IgG (H+L) (Jackson ImmunoResearch Laboratories Inc., Cat# 711 -515-152, USA) was used.

As a result, as shown in Figure 1, the expression of mTOR, raptor, and rictor proteins did not change during the process of decidualization, but phosphorylation of mTOR protein was increased in S2481 in mTORC1 including raptor, and in mTORC2 including rictor In S2481, the phosphorylation of mTOR protein was decreased.

1-2. Changes in the number of differentiated cells and expression of a marker gene for decidualization by knock down of mTORC1 or mTORC2

It was confirmed whether mTORC1 or mTORC2 changes the expression of the decidualization marker gene and the number of differentiated cells in the process of decidualization.

Different shRNA targeting rictor or raptor (short hairpin RNA, Addgene), and scrambled shRNA packaged lentivirus containing 8 μg/mL of polybrene The medium was infected with hES, and the infected cells were treated with 2 μg/mL puromycin to select (selection). The selected cells were dispensed into 12 well-plates and differentiated for 2 days in DMEM medium containing 0.5 mM of 8-Br-cAMP. Total RNA was extracted from the differentiated cells according to the manufacturer's protocol using TRIzol reagent (Thermo Fisher Scientific, USA). After cDNA was synthesized according to the manufacturer's protocol from 1 μg of RNA extracted using TOPscriptTM RT DryMIX kit (dT18 plus) (Enzynomics, Korea), TOPrealTMqPCR2×PreMIX(SYBR Green with high ROX)(Enzynomics, Korea) and CFX384 C1000 Thermal A quantitative real-time polymerase chain reaction (qRT-PCR) was performed using Cycler (Bio-Rad, USA). Gene expression was normalized with human GAPDH (glyceraldehyde 3-phophate dehydrogenase) gene, and the primer sequences used in the experiment are shown in Table 1 below.

Primer name Sequence (5'-3') Sequence number PRL F GGAGCAAGCCCAACAGATGAA 5 PRL R GGCTCATTCCAGGATCGCAAT 6 GAPDH F GGAGCGAGATCCCTCCAAAAT 7 GAPDH R GGCTGTTGTCATACTTCTCATGG 8

Meanwhile, by observing the shape of the differentiated cells, the ratio of the differentiated form of round-shaped cells was calculated. Anti-raptor antibody (Bethyl Laboratories, Cat# A300-553A, USA) and anti-rictor antibody (Bethyl Laboratories, Cat# A300-459A, USA) as primary antibody, and Goat anti-rabbit IgG as secondary antibody (H+L) (Jackson ImmunoResearch Laboratories Inc., Cat# 711-515-152, USA) was used. As a result, as shown in Figs. 2 and 3, prolactin (PRL) gene, which is a deciduous marker gene The expression of and the number of round decidual cells decreased in the process of decidualization of hES in which the raptor was knocked down, but increased in the process of decidualization of hES in which the rictor was knocked down.

Experimental Example 2. Confirmation of increase of IRS-1 (insulin receptor substrate-1) protein phosphorylation by mTORC1 in the process of deciduous membrane formation

2-1. Changes in phosphorylation of S6K1 (p70S6 kinase 1) protein and S6 protein during decidualization

It was confirmed that mTORC1 increased the phosphorylation of S6K1 protein and S6 protein during decidualization.

Specifically, Western blot was performed in the same manner as in Experimental Example 1-1. Primary antibodies include anti-S6K1 antibody (Cell Signaling Technology, Cat# 9234, USA), anti-pT389-S6K1 antibody (Cell Signaling Technology, Cat# 9202, USA), anti-S6 antibody (Cell Signaling Technology, Cat # 2217, USA), and anti-S235/236-S6 antibody (Cell Signaling Technology, Cat# 2211, USA), and as a secondary antibody, Goat anti-rabbit IgG(H+L) (Jackson Immuno Research Laboratories Inc., Cat#711-515-152, USA) was used.

As a result, as shown in Fig. 4, there was no change in phosphorylation of T389-S6K1 and phosphorylation of S235/236-S6 in the process of deciding.

2-2. Expression of PRL gene by S6K1 protein inhibition

In the process of decidualization, it was confirmed whether inhibition of the S6K1 protein reduced the expression of the PRL gene.

On the second day of differentiation, cells were differentiated in the same manner as in Experimental Example 1-1, except that PF-4708671, an S6K1 protein inhibitor, was treated at a concentration of 15 μM, and then cells were obtained on day 0 or 2, and Experimental Example 1- QRT-PCR was performed in the same manner as in 2, and Western blot was performed in the same manner as in Experimental Example 1-1. As the primary antibody, anti-S6 antibody (Cell Signaling Technology, Cat# 2217, USA), and anti-S235/236-S6 antibody (Cell Signaling Technology, Cat# 2211, USA) as the secondary antibody, Goat anti -rabbit IgG (H+L) (Jackson Immuno Research Laboratories Inc., Cat# 711-515-152, USA) was used.

As a result, as shown in FIG. 5, even if the S6K1 protein was suppressed in the process of deciding, the expression of the PRL gene was unchanged. From this, it was found that mTORC1 regulates the activity of proteins other than S6K1 in the process of decidualization.

2-3. Phosphorylation of IRS-1 protein during decidualization

In the process of decidualization, a site where mTORC1 increases phosphorylation of IRS-1 protein was identified.

Specifically, for various serine residues of the IRS-1 protein, cells were differentiated in the same manner as in Experimental Example 1-1, and then cells were obtained on day 0, 2, or 4 to perform Western blot. . Primary antibodies include anti-IRS1 antibody (Cell Signaling Technology, Cat# 2382, USA), anti-pS636/639-IRS1 antibody (Cell Signaling Technology, Cat# 2388, USA), and anti-pS1101-IRS1 antibody (Cell Signaling Technology, Cat# 2385, USA), and an anti-pS307-IRS1 antibody (Cell Signaling Technology, Cat# 2381, USA), and as a secondary antibody, Goat anti-rabbit IgG (H+L) (Jackson ImmunoResearch Laboratories Inc. , Cat# 711-515-152, USA) was used.

As a result, as shown in FIG. 6, phosphorylation of IRS-1 protein was increased in the process of deciding, and phosphorylation of IRS-1 protein was significantly increased in S636/639 compared to S307 or S1101. From this, it was found that mTORC1 increased the phosphorylation of S636/639-IRS-1 in the process of deciding.

2-4. Expression of PRL gene by inhibition of mTOR protein

In the process of decidualization, it was confirmed whether inhibition of mTOR protein reduced the expression of the PRL gene.

Specifically, cells were differentiated in the same manner as in Experimental Example 1-1, except that the mTOR protein inhibitor rapamycin was treated at a concentration of 100 nM on the second day of differentiation, and then the cells were obtained on the second day. Thus, qRT-PCR was performed in the same manner as in Experimental Example 1-2.

As a result, as shown in FIG. 7, suppressing the mTOR protein in the process of decidualization did not increase the expression of the PRL gene.

2-5. Phosphorylation of IRS-1 protein by knockdown of mTORC1

It was confirmed that the knockdown of mTORC1 reduced the phosphorylation of the IRS-1 protein in the process of deciding.

Specifically, hES cultured by knocking down the raptor in the same manner as in Experimental Example 1-2 was prepared, and Western blot was performed in the same manner as in Experimental Example 1-1. Anti-IRS1 antibody (Cell Signaling Technology, Cat# 2382, USA) and anti-pS636/639-IRS1 antibody (Cell Signaling Technology, Cat# 2388, USA) as the primary antibody, and Goat anti- rabbit IgG (H+L) (Jackson ImmunoResearch Laboratories Inc., Cat#711-515-152, USA) was used.

As a result, as shown in FIG. 8, phosphorylation of IRS-1 protein in S636/639 was decreased in the process of deciding hES in which raptor was knocked down.

From the above results, it was found that mTORC1 increased the phosphorylation of IRS-1 protein in S636/639 in the process of decidualization.

Experimental Example 3. Displacement of DEPTOR (DEP domain-containing mTOR-interacting protein) protein from mTORC1, and interaction of raptor protein and IRS-1 protein

3-1. Expression of DEPTOR protein and gene in the process of decidualization

It was confirmed by Western blot and qRT-PCR whether the expression of the DEPTOR protein and gene was decreased during the deciduous process.

Specifically, after differentiating hES in the same manner as in Experimental Example 1-1, cells on day 0, 2, or 4 were obtained, and Western blot was performed in the same manner as in Experimental Example 1-1, and in the same manner as in Experimental Example 1-2. QRT-PCR was performed. The primer sequences used in the experiment are shown in Table 2 below. Anti-DEPTOR antibody (Novus Biologicals, Cat# NBP1-49674, USA) as the primary antibody, and Goat anti-rabbit IgG (H+L) as the secondary antibody (Jackson ImmunoResearch Laboratories Inc., Cat# 711-515 -152, USA) was used.

Primer name Sequence (5'-3') Sequence number DEPTOR F CTCAGGCTGCACGAAGAAAAG 9 DEPTOR R TTGCGACAAAACAGTTTGGGT 10 GAPDH F GGAGCGAGATCCCTCCAAAAT 7 GAPDH R GGCTGTTGTCATACTTCTCATGG 8

As a result, as shown in FIG. 9, the expression of the DEPTOR protein and gene was decreased in the process of deciding.

3-2. Changes in the amount of DEPTOR protein forming mTORC1 or mTORC2, and interaction between raptor protein and IRS-1 protein in mTORC1

It was confirmed that the amount of DEPTOR protein present in the form of a complex in the process of decidualization and the interaction between the raptor protein and the IRS-1 protein in mTORC1 increased.

Specifically, immunoprecipitation and Western blot were performed in the same manner as in Experimental Example 1-1. Primary antibodies include anti-mTOR antibodies (Cell signaling technology, Cat# 2972, USA), anti-raptor antibodies (Bethyl Laboratories, Cat# A300-553A, USA), anti-rictor antibodies (Bethyl Laboratories, Cat# A300 -459A, USA), anti-DEPTOR antibody (Novus Biologicals, Cat# NBP1-49674, USA), and anti-IRS-1 antibody (Cell Signaling Technology, Cat# 2382, USA), and as a secondary antibody, Goat anti -rabbit IgG (H+L) (Jackson Immuno Research Laboratories Inc., Cat# 711-515-152, USA) was used.

As a result, as shown in FIG. 10, the amount of DEPTOR protein that binds to mTOR or forms mTORC1 in the process of decidualization decreased, but the amount of DEPTOR protein forming mTORC2 did not change. In addition, the interaction between the raptor protein and the IRS-1 protein was increased in differentiation-induced cells. From this, it was found that the amount of DEPTOR protein forming mTORC1 decreased during the decidual process, and thus the interaction between the raptor protein and the IRS-1 protein increased.

3-3. Expression of DEPTOR protein by phosphatidic acid (PA), and change of interaction between raptor protein and IRS-1 protein

By treatment with phosphatidic acid, which is known to displace DEPTOR from mTORC1, it was confirmed that the expression of DEPTOR protein in mTORC1 was reduced and the interaction of the raptor protein with the IRS-1 protein was increased.

Specifically, hES was treated with 300 μM 1,2-dioctanoyl-sn-glycero-3-PA (Avanti Polar Lipids, USA) for 30 minutes, and immunoprecipitation and Western blot in the same manner as in Experimental Example 1-1. Was performed. Primary antibodies include anti-mTOR antibody (Cell signaling technology, Cat# 2972, USA), anti-raptor antibody (Bethyl Laboratories, Cat# A300-553A, USA), and anti-DEPTOR antibody (Novus Biologicals, Cat# NBP1- 49674, USA), and an anti-IRS-1 antibody (Cell Signaling Technology, Cat# 2382, USA), and as a secondary antibody, Goat anti-rabbit IgG (H+L) (Jackson ImmunoResearch Laboratories Inc., Cat# 711). -515-152, USA) was used.

As a result, as shown in FIG. 11, the binding of the DEPTOR protein of mTORC1 was decreased by phosphatidic acid, and the interaction between the raptor protein and the IRS-1 protein was increased. From this, it was found that the DEPTOR protein was separated from mTORC1 by phosphatidic acid, and thus the interaction between the raptor protein and the IRS-1 protein was increased.

Experimental Example 4. Confirmation of negative control of deciduous membrane by DPETOR

It was confirmed that DEPTOR is a negative regulator that inhibits decidualization.

4-1. Changes in IRS-1 protein phosphorylation and PRL gene expression by DEPTOR knockdown

It was confirmed whether the knockdown of DEPTOR changes the phosphorylation of the IRS-1 protein, the expression of the PRL gene, and the expression of the IGFBP1 gene and the number of differentiated cells in the process of decidualization.

Specifically, DEPTOR in the same manner as in Experimental Example 1-2, except that two different shRNAs targeting DEPTOR (Sigma-Aldrich, Clone ID: DEPTOR-1, TRCN0000168212; DEPTOR-2, TRCN0000240949) were used. After preparing the hES knocked down, Western blot was performed in the same manner as in Experimental Example 1-1, and after differentiating the cells for 2 days in the same manner as in Experimental Example 1-2, qRT-PCR was performed. Meanwhile, by observing the shape of the differentiated cells, the ratio of the differentiated round shape cells was calculated. Primary antibodies include anti-DEPTOR antibody (Novus Biologicals, Cat# NBP1-49674, USA), anti-IRS-1 antibody (Cell Signaling Technology, Cat# 2382, USA), anti-pS636/639-IRS-1 antibody (Cell Signaling Technology, Cat# 2388, USA), anti-S6K1 antibody (Cell Signaling Technology, Cat# 9234, USA), and anti-pT389-S6K1 antibody (Cell Signaling Technology, Cat# 9202, USA), secondary As an antibody, Goat anti-rabbit IgG (H+L) (Jackson ImmunoResearch Laboratories Inc., Cat# 711-515-152, USA) was used. The primer sequences used in the experiment are shown in Tables 1 and 2 and Table 3 below.

Primer name Sequence (5'-3') Sequence number IGFBP1 F TTGGGACGCCATCAGTACCTA 11 IGFBP1 R TTGGCTAAACTCTCTACGACTCT 12

As a result, as shown in FIGS. 12 and 13, phosphorylation of IRS-1 protein, PRL gene expression, and IGFBP1 gene expression in S636/639 were increased in the process of deciding hES in which DEPTOR was knocked down, and rounded dropout The number of membrane cells increased.

4-2. Changes in IRS-1 Protein Phosphorylation and PRL Gene Expression by DEPTOR Overexpression

It was confirmed whether overexpression of DEPTOR changes the phosphorylation of IRS-1 protein and expression of the PRL gene in the process of decidualization.

Specifically, a vector capable of expressing Flag-DEPTOR was transfected into hES according to the manufacturer's protocol using TransIT-LT1 (Mirus Bio LLC, USA), and then in the same manner as in Experimental Example 1-1. Western blot was performed. In addition, qRT-PCR was performed by differentiating the transduced cells for 2 days in the same manner as in Experimental Example 1-2. Primary antibodies include anti-Flag-DEPTOR antibody (Sigma, Cat# F1804, USA), anti-IRS-1 antibody (Cell Signaling Technology, Cat# 2382, USA), anti-pS636/639-IRS-1 antibody ( Cell Signaling Technology, Cat# 2388, USA), anti-S6K1 antibody (Cell Signaling Technology, Cat# 9234, USA), and anti-pT389-S6K1 antibody (Cell Signaling Technology, Cat# 9202, USA), secondary antibody Goat anti-rabbit IgG (H+L) (Jackson ImmunoResearch Laboratories Inc., Cat# 711-515-152, USA) was used as the furnace. The primer sequences used in the experiment are shown in Table 1 and Table 2 above.

As a result, as shown in FIGS. 14 and 15, phosphorylation of IRS-1 protein and expression of PRL gene were decreased in S636/639 in the process of deciding hES overexpressing DEPTOR.

From the above results, it was found that DEPTOR negatively regulates deciduous membrane formation by inhibiting the kinase activity of mTORC1 phosphorylating IRS-1 protein in S636/639.

Experimental Example 5. Reduction of phosphorylation of Akt protein and FOX O1 (Forkhead box O1) protein in the regulation of decidualization by mTORC1 and mTORC2

In the process of differentially controlling decidualization of mTORC1 and mTORC2 from each other, it was confirmed whether phosphorylation of Akt protein and FOX O1 protein decreased.

5-1. Phosphorylation of Akt protein and expression and phosphorylation of FOX O1 protein during decidualization

It was confirmed whether the expression of the Akt protein and the expression and phosphorylation of the FOX O1 protein, which is a target location of the Akt protein and a decidualization marker, are changed during the decidualization process.

Specifically, after differentiating hES in the same manner as in Experimental Example 1-1, cells on day 0, 2, or 4 were obtained, and Western blot was performed in the same manner as in Experimental Example 1-1. Primary antibodies include anti-Akt antibody (Cell Signaling Technology, Cat# 9272, USA), anti-pT308-Akt antibody (Cell Signaling Technology, Cat# 9275, USA), anti-pS473-Akt antibody (Cell Signaling Technology, Cat# 4051, USA), anti-FOXO1 antibody (Cell Signaling Technology, Cat# 2880, USA), and anti-pS256-FOXO1 antibody (Cell Signaling Technology, Cat# 9461, USA), as a secondary antibody, Goat anti -mouse IgG (H+L) (Jackson ImmunoResearch Laboratories Inc., Cat#715-485-150, USA) was used.

As a result, as shown in FIG. 16, phosphorylation of Akt protein in the process of decidualization was decreased in both T308, which is the action site of mTORC1, and S473, which is the action site of mTORC2. The expression of the FOX O1 protein was increased, and the phosphorylation of the FOX O1 protein was not changed at S256, but the relative ratio of the FOX O1 protein phosphorylated at S256 to the FOX O1 protein decreased. From this, it was found that Akt was inactivated by mTORC1 and mTORC2 during the deciduous process, and thus phosphorylation of the FOX O1 protein was reduced in S256.

5-2. Expression of mSIN1 (mammalian stress-activated protein kinase interacting protein 1) protein in mTORC2

It was confirmed whether the expression of the mSIN1 protein, a constituent protein of mTORC2, was decreased during the process of decidualization.

Specifically, after differentiating hES in the same manner as in Experimental Example 1-1, cells were obtained on day 0, 2, or 4, and Western Bolot, and cells on day 0 or 2 were obtained in the same manner as in Experimental Example 1-1. Immunoprecipitation was performed in the same manner as in Example 1-1. Primary antibodies include anti-mTOR antibody (Cell signaling technology, Cat# 2972, USA), anti-rictor antibody (Bethyl Laboratories, Cat# A300-459A, USA), and anti-mSIN1 antibody (Bethyl Laboratories, Cat# A300 -910A, USA), and Goat anti-rabbit IgG (H+L) (Jackson ImmunoResearch Laboratories Inc., Cat# 711-515-152, USA) as a secondary antibody.

As a result, as shown in Figs. 17 and 18, the expression of mSIN1 protein was decreased in the process of deciding. From this, it was found that the expression of mSIN1 protein, a positive regulator of mTORC2, decreased during the process of deciduous membrane formation, resulting in a decrease in mTORC2 activity.

5-3. Phosphorylation of Akt protein and FOX O1 protein by knockdown of mTORC2

It was confirmed by Western blot whether knockdown of mTORC2 reduces phosphorylation of Akt protein and FOX O1 protein during decidualization.

Specifically, hES cultured by knocking down rictor in the same manner as in Experimental Example 1-2 was prepared, and cells were obtained on day 0 or 2 after induction of decidualization, and Western blot was performed in the same manner as in Experimental Example 1-1. Primary antibodies include anti-rictor antibody (Bethyl Laboratories, Cat# A300-459A, USA), anti-Akt antibody (Cell Signaling Technology, Cat# 9272, USA), anti-pS473-Akt antibody (Cell Signaling Technology, Cat # 4051, USA), anti-FOXO1 antibody (Cell Signaling Technology, Cat# 2880, USA), and anti-pS256-FOXO1 antibody (Cell Signaling Technology, Cat# 9461, USA), as a secondary antibody Goat anti- Mouse IgG (H+L) (Jackson Immuno Research Laboratories Inc., Cat# 715-485-150, USA) was used.

As a result, as shown in FIG. 19, phosphorylation of Akt protein in S473 and phosphorylation of FOX O1 protein in S256 were decreased in the process of deciding hES in which rictor was knocked down.

* 5-4. Phosphorylation of Akt protein by knockdown of mTORC1

It was confirmed that knockdown of mTORC1 reduced the phosphorylation of Akt protein during the process of decidualization.

Specifically, hES cultured by knocking down the raptor in the same manner as in Experimental Example 1-2 was prepared, and cells were obtained on day 0 or 2 after induction of decidualization, and Western blot was performed in the same manner as in Experimental Example 1-1. Primary antibodies include anti-raptor antibody (Bethyl Laboratories, Cat# A300-553A, USA), anti-Akt antibody (Cell Signaling Technology, Cat# 9272, USA), and anti-pS473-Akt antibody (Cell Signaling Technology, Cat# 4051, USA), and Goat anti-mouse IgG (H+L) (Jackson ImmunoResearch Laboratories Inc., Cat# 715-485-150, USA) as a secondary antibody.

As a result, as shown in FIG. 20, phosphorylation of Akt protein in S473 was increased in the process of deciding hES in which raptor was knocked down.

5-5. Phosphorylation of Akt protein and FOX O1 protein by knockdown of DEPTOR

It was confirmed that the knockdown of DEPTOR reduced the phosphorylation of Akt protein and FOX O1 protein in the process of decidualization.

Specifically, hES cultured by knocking down DEPTOR in the same manner as in Experimental Example 4-1 was prepared, and cells were obtained on the second day after induction of decidualization, and Western blot was performed in the same manner as in Experimental Example 1-1. Primary antibodies include anti-DEPTOR antibody (Novus Biologicals, Cat# NBP1-49674, USA), anti-Akt antibody (Cell Signaling Technology, Cat# 9272, USA), anti-pT308-Akt antibody (Cell Signaling Technology, Cat # 9275, USA), anti-pS473-Akt antibody (Cell Signaling Technology, Cat# 4051, USA), anti-FOXO1 antibody (Cell Signaling Technology, Cat# 2880, USA), and anti-pS256-FOXO1 antibody (Cell Signaling Technology, Cat# 9461, USA), and as secondary antibodies, Goat anti-mouse IgG (H+L) (Jackson ImmunoResearch Laboratories Inc., Cat# 715-485-150, USA) and goat anti-rabbit IgG (H +L) (Jackson Immuno Research Laboratories Inc., Cat#711-515-152, USA) was used.

As a result, as shown in FIG. 21, phosphorylation of Akt protein in T308 and S473, and phosphorylation of FOX O1 protein in S256 were decreased in the process of deciding hES in which DEPTOR was knocked down.

5-6. Phosphorylation of Akt protein and FOX O1 protein by overexpression of DEPTOR

It was confirmed whether overexpression of DEPTOR increases phosphorylation of Akt protein and FOX O1 protein in the process of decidualization.

Specifically, hES cultured by overexpressing DEPTOR in the same manner as in Experimental Example 4-2 was prepared, and cells were obtained on the 0th or 2nd day after induction of decidualization, and Western blot was performed in the same manner as in Experimental Example 1-1. Primary antibodies include anti-Flag-DEPTOR antibody (Sigma, Cat# F1804, USA), anti-Akt antibody (Cell Signaling Technology, Cat# 9272, USA), anti-pT308-Akt antibody (Cell Signaling Technology, Cat# 9275, USA), anti-pS473-Akt antibody (Cell Signaling Technology, Cat# 4051, USA), anti-FOXO1 antibody (Cell Signaling Technology, Cat# 2880, USA), and anti-pS256-FOXO1 antibody (Cell Signaling Technology , Cat# 9461, USA), as secondary antibodies goat anti-mouse IgG (H+L) (Jackson ImmunoResearch Laboratories Inc., Cat# 715-485-150, USA) and Goat anti-rabbit IgG (H+ L) (Jackson Immuno Research Laboratories Inc., Cat# 711-515-152, USA) was used.

As a result, as shown in FIG. 22, phosphorylation of Akt protein in T308 and S473, and phosphorylation of FOX O1 protein in S256 were increased in the process of deciding hES overexpressing DEPTOR.

From the above results, it was found that mTORC1 increased the activity, and mTORC2 decreased the activity, thereby reducing the phosphorylation of Akt protein and FOX O1 protein to induce deciduous membrane formation.

<110> Gachon University of Industry-Academic cooperation Foundation <120> Pharmaceutical composition for preventing or treating infertility or abortion comprising inhibitors of mSIN1 protein as an active ingredient <130> 2020p-05-031 <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 1230 <212> DNA <213> Homo sapiens <400> 1 atggaggagg gcggcagcac tggcagtgct ggcagtgaca gcagcaccag cgggagtggc 60 ggggcgcagc aaagggagct ggagcgcatg gctgaggtct tggtcaccgg ggaacagcta 120 cggctcaggc tgcacgaaga aaaggttatt aaagatagac gtcatcatct caagacctac 180 ccaaactgtt ttgtcgcaaa agaactgatt gactggctga ttgaacacaa agaggcttct 240 gacagagaga cggcaattaa actcatgcag aaattagcag accggggcat tattcaccat 300 gtgtgtgatg agcataagga attcaaggat gtcaaactct tctaccgctt tagaaaggat 360 gacggcacct tcccattgga taatgaagtg aaggccttta tgagaggaca gaggctatat 420 gaaaagctga tgagccctga aaacacactc ctgcagccca gggaggagga aggggtcaag 480 tatgagcgca ccttcatggc atctgaattc ctggactggc tggttcagga aggtgaggcc 540 accacgagga aagaggcaga gcagctttgc caccggctta tggagcatgg catcatccag 600 catgtgtcca acaagcaccc atttgtggac agcaatcttc tctaccagtt cagaatgaac 660 ttccggcgga ggcgaagact gatggagctg ctcaatgaaa agtccccctc ctcccaggaa 720 actcatgaca gtcccttctg cctgaggaag cagagccatg acaatcggaa atctaccagc 780 tttatgtcag tgagccccag caaggagatc aagatcgtgt ctgcagtgag gagaagcagc 840 atgagcagct gtggcagcag cggctacttc agcagcagcc ccaccctcag cagcagcccc 900 cctgtgctct gcaaccccaa gtccgtgctg aagagacctg tcacctctga ggaactcctt 960 actcccgggg ctccgtatgc aaggaagaca ttcacgattg ttggtgacgc ggttggctgg 1020 ggttttgtgg tgcgaggaag taagccatgc cacatccagg ctgtagaccc cagtggccct 1080 gcagccgcag caggaatgaa ggtctgtcag tttgtcgtct ctgtcaacgg gctcaatgtc 1140 ctgcatgtag actaccggac cgtgagcaat ctgattctga cgggcccacg gacgattgtc 1200 atggaagtca tggaggagtt agagtgctga 1230 <210> 2 <211> 409 <212> PRT <213> Homo sapiens <400> 2 Met Glu Glu Gly Gly Ser Thr Gly Ser Ala Gly Ser Asp Ser Ser Thr 1 5 10 15 Ser Gly Ser Gly Gly Ala Gln Gln Arg Glu Leu Glu Arg Met Ala Glu 20 25 30 Val Leu Val Thr Gly Glu Gln Leu Arg Leu Arg Leu His Glu Glu Lys 35 40 45 Val Ile Lys Asp Arg Arg His His Leu Lys Thr Tyr Pro Asn Cys Phe 50 55 60 Val Ala Lys Glu Leu Ile Asp Trp Leu Ile Glu His Lys Glu Ala Ser 65 70 75 80 Asp Arg Glu Thr Ala Ile Lys Leu Met Gln Lys Leu Ala Asp Arg Gly 85 90 95 Ile Ile His His Val Cys Asp Glu His Lys Glu Phe Lys Asp Val Lys 100 105 110 Leu Phe Tyr Arg Phe Arg Lys Asp Asp Gly Thr Phe Pro Leu Asp Asn 115 120 125 Glu Val Lys Ala Phe Met Arg Gly Gln Arg Leu Tyr Glu Lys Leu Met 130 135 140 Ser Pro Glu Asn Thr Leu Leu Gln Pro Arg Glu Glu Glu Gly Val Lys 145 150 155 160 Tyr Glu Arg Thr Phe Met Ala Ser Glu Phe Leu Asp Trp Leu Val Gln 165 170 175 Glu Gly Glu Ala Thr Thr Arg Lys Glu Ala Glu Gln Leu Cys His Arg 180 185 190 Leu Met Glu His Gly Ile Ile Gln His Val Ser Asn Lys His Pro Phe 195 200 205 Val Asp Ser Asn Leu Leu Tyr Gln Phe Arg Met Asn Phe Arg Arg Arg 210 215 220 Arg Arg Leu Met Glu Leu Leu Asn Glu Lys Ser Pro Ser Ser Gln Glu 225 230 235 240 Thr His Asp Ser Pro Phe Cys Leu Arg Lys Gln Ser His Asp Asn Arg 245 250 255 Lys Ser Thr Ser Phe Met Ser Val Ser Pro Ser Lys Glu Ile Lys Ile 260 265 270 Val Ser Ala Val Arg Arg Ser Ser Met Ser Ser Cys Gly Ser Ser Gly 275 280 285 Tyr Phe Ser Ser Ser Pro Thr Leu Ser Ser Ser Pro Pro Val Leu Cys 290 295 300 Asn Pro Lys Ser Val Leu Lys Arg Pro Val Thr Ser Glu Glu Leu Leu 305 310 315 320 Thr Pro Gly Ala Pro Tyr Ala Arg Lys Thr Phe Thr Ile Val Gly Asp 325 330 335 Ala Val Gly Trp Gly Phe Val Val Arg Gly Ser Lys Pro Cys His Ile 340 345 350 Gln Ala Val Asp Pro Ser Gly Pro Ala Ala Ala Ala Gly Met Lys Val 355 360 365 Cys Gln Phe Val Val Ser Val Asn Gly Leu Asn Val Leu His Val Asp 370 375 380 Tyr Arg Thr Val Ser Asn Leu Ile Leu Thr Gly Pro Arg Thr Ile Val 385 390 395 400 Met Glu Val Met Glu Glu Leu Glu Cys 405 <210> 3 <211> 1461 <212> DNA <213> Homo sapiens <400> 3 atggccttct tggacaatcc aactatcatt ctagctcata ttcgacagtc acatgtgacc 60 agtgatgaca cgggaatgtg tgagatggtt ctcattgatc atgatgttga cctagagaag 120 attcatcctc cttcaatgcc tggagacagt gggtcagaaa ttcagggaag caatggtgag 180 actcagggct atgtatatgc ccagtcagtc gatattacct caagttggga ctttggtatt 240 agaagacgct caaacacagc tcaaagatta gaacgactcc gaaaagagag acaaaaccag 300 atcaaatgca aaaatattca gtggaaagaa agaaattcta agcaatcagc ccaggagtta 360 aagtcactgt ttgaaaaaaa atctctcaaa gagaagcctc caatttctgg gaagcagtcg 420 atattatctg tacgcctaga acagtgccct ctgcagctga ataacccttt taacgagtat 480 tccaaatttg atggcaaggg tcatgtaggt acaacagcaa ccaagaagat cgatgtctac 540 ctccctctgc actcgagcca ggacagactg ctgccaatga ccgtggtgac aatggccagc 600 gccagggtgc aggacctgat cgggctcatc tgctggcagt atacaagcga aggacgggag 660 ccgaagctca atgacaatgt cagtgcctac tgcctgcata ttgctgagga tgatggggag 720 gtggacaccg atttcccccc gctggattcc aatgagccca ttcataagtt tggcttcagt 780 actttggccc tggttgaaaa gtactcatct cctggtctga catccaaaga gtcactcttt 840 gttcgaataa atgctgctca tggattctcc cttattcagg tggacaacac aaaggttacc 900 atgaaggaaa tcttactgaa ggcagtgaag cgaagaaaag gatcccagaa agtttcaggt 960 tcaagggcag acggggtttt tgaggaggat tcgcaaattg acatagccac agtacaggat 1020 atgcttagca gccaccatta caagtcattc aaagtcagca tgatccacag actgcgattc 1080 acaaccgacg tacagctagg tatctctgga gacaaagtag agatagaccc tgttacgaat 1140 cagaaagcca gcactaagtt ttggattaag cagaaaccca tctcaatcga ttccgacctg 1200 ctctgtgcct gtgaccttgc tgaagagaaa agccccagtc acgcaatatt taaactcacg 1260 tatctaagca atcacgacta taaacacctc tactttgaat cggacgctgc taccgtcaat 1320 gaaattgtgc tcaaggttaa ctacatcctg gaatcgcgag ctagcactgc ccgggctgac 1380 tactttgctc aaaaacaaag aaaactgaac agacgtacga gcttcagctt ccagaaggag 1440 aagaaatccg ggcagcagtg a 1461 <210> 4 <211> 486 <212> PRT <213> Homo sapiens <400> 4 Met Ala Phe Leu Asp Asn Pro Thr Ile Ile Leu Ala His Ile Arg Gln 1 5 10 15 Ser His Val Thr Ser Asp Asp Thr Gly Met Cys Glu Met Val Leu Ile 20 25 30 Asp His Asp Val Asp Leu Glu Lys Ile His Pro Pro Ser Met Pro Gly 35 40 45 Asp Ser Gly Ser Glu Ile Gln Gly Ser Asn Gly Glu Thr Gln Gly Tyr 50 55 60 Val Tyr Ala Gln Ser Val Asp Ile Thr Ser Ser Trp Asp Phe Gly Ile 65 70 75 80 Arg Arg Arg Ser Asn Thr Ala Gln Arg Leu Glu Arg Leu Arg Lys Glu 85 90 95 Arg Gln Asn Gln Ile Lys Cys Lys Asn Ile Gln Trp Lys Glu Arg Asn 100 105 110 Ser Lys Gln Ser Ala Gln Glu Leu Lys Ser Leu Phe Glu Lys Lys Ser 115 120 125 Leu Lys Glu Lys Pro Pro Ile Ser Gly Lys Gln Ser Ile Leu Ser Val 130 135 140 Arg Leu Glu Gln Cys Pro Leu Gln Leu Asn Asn Pro Phe Asn Glu Tyr 145 150 155 160 Ser Lys Phe Asp Gly Lys Gly His Val Gly Thr Thr Ala Thr Lys Lys 165 170 175 Ile Asp Val Tyr Leu Pro Leu His Ser Ser Gln Asp Arg Leu Leu Pro 180 185 190 Met Thr Val Val Thr Met Ala Ser Ala Arg Val Gln Asp Leu Ile Gly 195 200 205 Leu Ile Cys Trp Gln Tyr Thr Ser Glu Gly Arg Glu Pro Lys Leu Asn 210 215 220 Asp Asn Val Ser Ala Tyr Cys Leu His Ile Ala Glu Asp Asp Gly Glu 225 230 235 240 Val Asp Thr Asp Phe Pro Pro Leu Asp Ser Asn Glu Pro Ile His Lys 245 250 255 Phe Gly Phe Ser Thr Leu Ala Leu Val Glu Lys Tyr Ser Ser Pro Gly 260 265 270 Leu Thr Ser Lys Glu Ser Leu Phe Val Arg Ile Asn Ala Ala His Gly 275 280 285 Phe Ser Leu Ile Gln Val Asp Asn Thr Lys Val Thr Met Lys Glu Ile 290 295 300 Leu Leu Lys Ala Val Lys Arg Arg Lys Gly Ser Gln Lys Val Ser Gly 305 310 315 320 Ser Arg Ala Asp Gly Val Phe Glu Glu Asp Ser Gln Ile Asp Ile Ala 325 330 335 Thr Val Gln Asp Met Leu Ser Ser His His Tyr Lys Ser Phe Lys Val 340 345 350 Ser Met Ile His Arg Leu Arg Phe Thr Thr Asp Val Gln Leu Gly Ile 355 360 365 Ser Gly Asp Lys Val Glu Ile Asp Pro Val Thr Asn Gln Lys Ala Ser 370 375 380 Thr Lys Phe Trp Ile Lys Gln Lys Pro Ile Ser Ile Asp Ser Asp Leu 385 390 395 400 Leu Cys Ala Cys Asp Leu Ala Glu Glu Lys Ser Pro Ser His Ala Ile 405 410 415 Phe Lys Leu Thr Tyr Leu Ser Asn His Asp Tyr Lys His Leu Tyr Phe 420 425 430 Glu Ser Asp Ala Ala Thr Val Asn Glu Ile Val Leu Lys Val Asn Tyr 435 440 445 Ile Leu Glu Ser Arg Ala Ser Thr Ala Arg Ala Asp Tyr Phe Ala Gln 450 455 460 Lys Gln Arg Lys Leu Asn Arg Arg Thr Ser Phe Ser Phe Gln Lys Glu 465 470 475 480 Lys Lys Ser Gly Gln Gln 485 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PRL F <400> 5 ggagcaagcc caacagatga a 21 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PRL R <400> 6 ggctcattcc aggatcgcaa t 21 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GAPDH F <400> 7 ggagcgagat ccctccaaaa t 21 <210> 8 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> GAPDH R <400> 8 ggctgttgtc atacttctca tgg 23 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> DEPTOR F <400> 9 ctcaggctgc acgaagaaaa g 21 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> DEPTOR R <400> 10 ttgcgacaaa acagtttggg t 21 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> IGFBP1 F <400> 11 ttgggacgcc atcagtacct a 21 <210> 12 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> IGFBP1 R <400> 12 ttggctaaac tctctacgac tct 23

Claims (5)

1) treating the test material to the cell line expressing the DEPTOR protein;
2) measuring the expression level of the DEPTOR protein in the cell line; And
3) A method for screening a candidate substance for infertility or abortion treatment, comprising the step of selecting a test substance whose expression level of the DEPTOR protein is reduced compared to a control without treatment with the test substance.
The method of claim 1, wherein the test substance in step 1) is at least one selected from the group consisting of peptides, proteins, non-peptidic compounds, active chemicals, fermentation products, cell extracts, plant extracts, animal tissue extracts, and blood serum. A method for screening candidates for infertility or abortion treatment.
The method of claim 1, wherein the expression level of the protein in step 2) is an enzyme-linked immunosorbent assay (ELISA), a radioimmunoassays, a sandwich enzyme immunoassay, a western blot, and an immunoprecipitation method. (immunoprecipitation), immunohistochemical staining (immunohistochemistry), fluorescence immunoassay (fluoroimmunoassay), and flow cytometry (FACS), characterized in that it is measured by any one or more methods selected from the group consisting of, screening for infertility or abortion treatment candidates Way.
1) treating the test substance on the DEPTOR protein;
2) measuring the degree of activity of the DEPTOR protein; And
3) selecting a test substance whose degree of activity of the DEPTOR protein is reduced compared to the control without treatment with the test substance
Characterized in that it comprises a, infertility or abortion treatment candidates screening method.
The method of claim 4, wherein the degree of activity of the protein in step 2) is selected from the group consisting of enzyme immunoassay, fluorescent immunoassay, SDS-PAGE, mass spectrometry, and protein chip. Characterized in that measured as, infertility or abortion treatment candidates screening method.

Images