WO2022206779A1 - Rna delivery system for treating obesity - Google Patents

Abstract

Provided is an RNA delivery system for treating obesity. The system comprises a viral vector, wherein the viral vector carries an RNA fragment capable of treating obesity and can be enriched in organ tissues of a host, and endogenously and spontaneously forms, in the organ tissues of the host, a composite structure containing the RNA fragment capable of treating obesity. The composite structure can deliver the RNA fragment into target tissue to realize the treatment of obesity.

Description

An RNA delivery system for the treatment of obesity technical field

The present application relates to the field of biomedical technology, in particular to an RNA delivery system for treating obesity.

Background technique

Obesity is a group of common metabolic disorders. When the human body eats more calories than it consumes, the excess calories are stored in the body in the form of fat, and the amount exceeds the normal physiological requirement, and when it reaches a certain value, it evolves into obesity. Normal male adult adipose tissue weight accounts for 15% to 18% of body weight, and female adipose tissue accounts for 20% to 25%. With age, the percentage of body fat increases accordingly. If there is no obvious cause, it is called simple obesity, and if there is a clear cause, it is called secondary obesity.

RNA interference (RNAi) therapy has been considered a promising strategy for the treatment of human diseases since its invention, but many problems have been encountered during clinical practice, and the development of this therapy has lagged far behind expectations.

It is generally believed that RNA cannot exist stably outside the cell for a long time, because RNA will be degraded into fragments by RNases rich in extracellular, so it is necessary to find a method that can make RNA stable outside the cell and can enter specific tissues in a targeted manner. Highlight the effect of RNAi therapy.

At present, there are many patents related to siRNA, mainly focusing on the following aspects: 1. Designing siRNA with medical effects. 2. Chemical modification of siRNA to improve the stability of siRNA in vivo and increase the yield. 3. Improve the design of various artificial carriers (such as lipid nanoparticles, cationic polymers and viruses) to improve the efficiency of siRNA delivery in vivo. Among them, there are many patents in the third aspect. The fundamental reason is that researchers have realized that there is currently a lack of suitable siRNA delivery systems to safely, precisely and efficiently deliver siRNA to target tissues. This problem has become the core restricting RNAi therapy. question.

Virus (Biological virus) is a small individual, simple structure, containing only one nucleic acid (DNA or RNA), must be parasitic in living cells and replicated non-cellular organisms. Viral vectors can bring genetic material into cells. The principle is to use the molecular mechanism of viruses to transmit their genomes into other cells for infection. It can occur in a complete living body (in vivo) or cell culture (in vitro), mainly used in Basic research, gene therapy or vaccines. However, there are few related studies on the use of viruses as vectors to deliver RNA, especially siRNA, using a special self-assembly mechanism.

The Chinese Patent Publication No. CN108624590A discloses a siRNA capable of inhibiting the expression of DDR2 gene; the Chinese Patent Publication No. CN108624591A discloses a siRNA capable of silencing the ARPC4 gene, and the siRNA is modified with α-phosphorus-selenium; The Chinese Patent Publication No. CN108546702A discloses a siRNA targeting long-chain non-coding RNA DDX11-AS1. The Chinese Patent Publication No. CN106177990A discloses a siRNA precursor that can be used for various tumor treatments. These patents design specific siRNAs to target certain diseases caused by genetic changes.

Chinese Patent Publication No. CN108250267A discloses a polypeptide, polypeptide-siRNA induced co-assembly, using polypeptide as a carrier of siRNA. The Chinese Patent Publication No. CN108117585A discloses a polypeptide for promoting apoptosis of breast cancer cells through targeted introduction of siRNA, and the polypeptide is also used as the carrier of siRNA. The Chinese Patent Publication No. CN108096583A discloses a nanoparticle carrier, which can be loaded with siRNA with breast cancer curative effect while containing chemotherapeutic drugs. These patents are all inventions and creations in terms of siRNA vectors, but their technical solutions have a common feature, that is, the vectors and siRNA are pre-assembled in vitro and then introduced into the host. In fact, this is the case with most of the delivery technologies currently designed. However, this type of delivery system has a common problem, that is, these synthetic exogenous delivery systems are easily cleared by the host's circulatory system, may also cause immunogenic responses, and may even be toxic to specific cell types and tissues.

The research team of the present invention found that endogenous cells can selectively encapsulate miRNAs into exosomes, and exosomes can deliver miRNAs to recipient cells, which secrete miRNAs at relatively low concentrations , which can effectively block the expression of target genes. Exosomes are biocompatible with the host immune system and possess the innate ability to protect and transport miRNAs across biological barriers in vivo, thus being a potential solution to overcome problems associated with siRNA delivery. For example, the Chinese Patent Publication No. CN110699382A discloses a method for preparing siRNA-delivering exosomes, and discloses the technology of separating exosomes from plasma and encapsulating siRNA into exosomes by electroporation .

However, such techniques of in vitro isolation or preparation of exosomes often require obtaining a large amount of exosomes through cell culture, coupled with the step of siRNA encapsulation, which makes the clinical cost of large-scale application of this product very high. Patients cannot afford it; more importantly, the complex production/purification process of exosomes makes it almost impossible to comply with GMP standards.

So far, drugs with exosomes as active ingredients have never been approved by the CFDA. The core problem is that the consistency of exosome products cannot be guaranteed, and this problem directly leads to the inability of such products to obtain drug production licenses. If this problem can be solved, it will be of great significance to promote RNAi therapy for obesity.

Therefore, the development of a safe, precise and efficient siRNA delivery system is a crucial part of improving the effect of RNAi therapy and advancing RNAi therapy.

SUMMARY OF THE INVENTION

In view of this, the embodiments of the present application provide an RNA delivery system for treating obesity and its application, so as to solve the technical defects existing in the prior art.

One of the inventions of the present application is to provide an RNA delivery system for treating obesity, the system comprising a viral vector carrying an RNA fragment capable of treating obesity, and the viral vector can be used in the organ tissue of a host. It is enriched in the host organ tissue and endogenously and spontaneously forms a composite structure containing fragments of the RNA capable of treating obesity, and the composite structure can deliver the RNA fragments into target tissues to achieve obesity. disease treatment. Among them, the target tissue is the brain.

Further, the viral vector is an adenovirus-associated virus.

Further, the adenovirus-associated virus is adenovirus-associated virus type 5, adenovirus-associated virus type 8 or adenovirus-associated virus type 9.

Further, the RNA fragment comprises one, two or more specific RNA sequences with medical significance, and the RNA sequences are siRNA, shRNA or miRNA with medical significance.

Further, the viral vector comprises a promoter and a targeting tag, the targeting tag can form the targeting structure of the composite structure in the organ tissue of the host, the targeting structure is located on the surface of the composite structure, the The complex structure is capable of finding and binding to the target tissue through the targeting structure, delivering the RNA fragment into the target tissue.

Further, the viral vector includes any one of the following circuits or a combination of several circuits: promoter-RNA fragment, promoter-targeting tag, promoter-RNA fragment-targeting tag; each of the viral vectors including at least one RNA segment and one targeting tag, the RNA segment and targeting tag are located in the same circuit or are located in different circuits.

Further, the viral vector also includes a flanking sequence, a compensation sequence and a loop sequence that can make the circuit fold into a correct structure and express, and the flanking sequence includes a 5' flanking sequence and a 3' flanking sequence;

The viral vector includes any one of the following lines or a combination of several lines: 5'-promoter-5' flanking sequence-RNA fragment-loop sequence-compensating sequence-3' flanking sequence, 5'-promoter-target To tag, 5'-promoter-targeting tag-5'flanking sequence-RNA fragment-loop sequence-compensating sequence-3'flanking sequence.

Further, the 5' flanking sequence is ggatcctggaggcttgctgaaggctgtatgctgaattc or a sequence whose homology is greater than 80%;

The loop sequence is gttttggccactgactgac or a sequence whose homology is greater than 80%;

The 3' flanking sequence is accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag or a sequence whose homology is greater than 80%;

The compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-5 bases are deleted. The purpose of deleting bases 1-5 of the reverse complement of the RNA is to make the sequence unexpressed.

Preferably, the compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-3 bases are deleted.

More preferably, the compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-3 consecutive bases are deleted.

Most preferably, the compensation sequence is the reverse complement of the RNA fragment, and the 9th and/or 10th bases are deleted.

Further, when there are at least two lines in the viral vector, adjacent lines are connected by a sequence composed of sequences 1-3 (sequence 1-sequence 2-sequence 3);

Wherein, sequence 1 is CAGATC, sequence 2 is a sequence consisting of 5-80 bases, and sequence 3 is TGGATC.

Further, when there are at least two lines in the viral vector, adjacent lines are connected by sequence 4 or a sequence with more than 80% homology to sequence 4;

Wherein, sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC.

Further, the organ tissue is liver, and the composite structure is exosome.

Further, the targeting tag is selected from targeting peptides or targeting proteins with targeting function.

Further, the targeting peptides include RVG targeting peptides, GE11 targeting peptides, PTP targeting peptides, TCP-1 targeting peptides, and MSP targeting peptides;

The targeting proteins include RVG-LAMP2B fusion protein, GE11-LAMP2B fusion protein, PTP-LAMP2B fusion protein, TCP-1-LAMP2B fusion protein, and MSP-LAMP2B fusion protein.

Further, the length of the RNA sequence is 15-25 nucleotides. For example, the length of the RNA sequence can be 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 nucleotides. Preferably, the RNA sequence is 18-22 nucleotides in length.

Further, the RNA capable of treating obesity is selected from siRNA of the PTP1B gene, or an RNA sequence with a homology of more than 80% to the above sequence, or a nucleic acid molecule encoding the above RNA. It should be noted that the RNA sequences in the "nucleic acid molecules encoding the above RNA sequences" here also include RNA sequences with a homology of more than 80% of each RNA.

The siRNA of PTP1B gene includes UGAUAUAGUCAUUAUCUUCUU, UCCAUUUUUUAUCAAACUAGCG, AUUGUUUAAAUAAAUAUGGAG, AAUUUUAAUACAUUAUUGGUU, UUUAUUAUUGUACUUUUUGAU, other sequences that inhibit the expression of PTP1B gene, and sequences with more than 80% homology to the above sequences.

It should be noted that the above-mentioned "sequences with more than 80% homology" may be 85%, 88%, 90%, 95%, 98%, etc. homology.

Optionally, the RNA fragment includes an RNA sequence ontology and a modified RNA sequence obtained by modifying the RNA sequence ontology with ribose sugar. That is, the RNA fragment can be composed of only at least one RNA sequence ontology, or only at least one modified RNA sequence, and can also be composed of RNA sequence ontology and modified RNA sequence.

In the present invention, the isolated nucleic acid also includes its variants and derivatives. The nucleic acid can be modified by one of ordinary skill in the art using general methods. Modification methods include (but are not limited to): methylation modification, hydrocarbyl modification, glycosylation modification (such as 2-methoxy-glycosyl modification, hydrocarbyl-glycosyl modification, sugar ring modification, etc.), nucleic acid modification, peptide modification Segment modification, lipid modification, halogen modification, nucleic acid modification (such as "TT" modification) and the like. In one of the embodiments of the present invention, the modification is an internucleotide linkage, for example selected from: phosphorothioate, 2'-O methoxyethyl (MOE), 2'-fluoro, phosphine Acid alkyl esters, phosphorodithioates, alkyl phosphorothioates, phosphoramidates, carbamates, carbonates, phosphoric triesters, acetamidates, carboxymethyl esters, and combinations thereof. In one of the embodiments of the present invention, the modification is a modification of nucleotides, such as selected from: peptide nucleic acid (PNA), locked nucleic acid (LNA), arabinose-nucleic acid (FANA), analogs, derivatives objects and their combinations. Preferably, the modification is a 2' fluoropyrimidine modification. 2'Fluoropyrimidine modification is to replace the 2'-OH of pyrimidine nucleotides on RNA with 2'-F. 2'-F can make RNA not easily recognized by RNase in vivo, thereby increasing the stability of RNA fragment transmission in vivo. sex.

Further, the delivery system is a delivery system for use in mammals including humans.

Another inventive point of the present application is to provide the application of the above-mentioned RNA delivery system for treating obesity in medicine.

Further, the administration modes of the drug include oral, inhalation, subcutaneous injection, intramuscular injection, and intravenous injection. Intravenous injection is preferred.

Further, the medicine includes the above-mentioned viral vector, specifically, the viral vector here means a viral vector carrying an RNA fragment, or carrying an RNA fragment and a targeting tag, and can enter the host and can be enriched in the liver. , self-assembled to form a composite structure exosome, the composite structure can deliver RNA fragments to the target tissue, so that the RNA fragments are expressed in the target tissue, and then inhibit the expression of matching genes to achieve the purpose of treating diseases.

The dosage forms of the drug can be tablets, capsules, powders, granules, pills, suppositories, ointments, solutions, suspensions, lotions, gels, pastes and the like.

The technical effects of this application are:

The RNA delivery system for the treatment of obesity provided by this application uses a virus as a vector, and the virus vector is used as a mature injection, and its safety and reliability have been fully verified, and the drugability is very good. The final effective RNA sequence is packaged and delivered by endogenous exosomes, and there is no immune response, so there is no need to verify the safety of the exosomes. The delivery system can deliver all kinds of small molecule RNAs, and has strong versatility. And the preparation of viral vectors is much cheaper and more economical than the preparation of exosomes or proteins, polypeptides and other substances. The RNA delivery system for the treatment of obesity provided by this application can be tightly combined with AGO ₂ and enriched into a complex structure (exosome) after self-assembly in vivo, which can not only prevent its premature degradation, but also maintain its circulation in the circulation. It is stable, and facilitates uptake by recipient cells, intracytoplasmic release and lysosomal escape, and requires a low dose.

The application of the RNA delivery system for the treatment of obesity provided in this application to medicines provides a drug delivery platform, which can greatly improve the therapeutic effect of obesity, and can also form the basis for the research and development of more RNA drugs through this platform. It has greatly promoted the development and use of RNA drugs.

Description of drawings

Fig. 1 is the comparison diagram of the mouse obesity treatment situation provided by an embodiment of the present application;

FIG. 2 is a comparison diagram of various obesity indicators in mice provided in an embodiment of the present application.

Fig. 3 is an RNA delivery system constructed with adenovirus and lentivirus as viral vectors provided in an embodiment of the present application, and has a detection diagram of in vivo enrichment effect. In the figure, A is the detection of siRNA content in blood after injection of the delivery system As a result, B is the detection result of the siRNA content in the hypothalamus after injection of the delivery system.

FIG. 4 is a detection diagram of an RNA delivery system constructed with adenovirus and lentivirus as viral vectors provided by another embodiment of the present application, and has an enrichment effect in vivo. The figure shows that after injection of the delivery system, blood exosomes Detection results of siRNA content.

Fig. 5 is an RNA delivery system constructed with adenovirus and lentivirus as viral vectors provided by an embodiment of the present application, and has a detection diagram of in vivo self-assembly effect and obesity treatment effect, and A in the figure is the detection result of the mRNA content of PTP1B , B is the detection result of protein content of PTP1B, C is the change value of body weight with the increase of days.

Fig. 6 is the detection result of in vivo enrichment, self-assembly and treatment effect for obesity when the viral vector system provided by an embodiment of the present application carries a variety of different RNA fragments, A in the figure is the relative mRNA of PTP1B Quantitative detection results, B is the detection results of the relative amount of PTP1B protein.

7 is a graph showing the detection results of in vivo enrichment, self-assembly and obesity treatment effects when the adenoviral vector delivery system provided by an embodiment of the present application contains multiple RNA fragments and multiple targeting tags, wherein targeting The label is RVG, and the RNA fragments are siRNA-1, siRNA-2, siRNA-1+siRNA-2. In the figure, A is the detection result of the relative amount of mRNA of PTP1B, B is the detection result of the relative amount of protein of PTP1B, and C is the number of days Change in weight gain.

8 is a graph showing the detection results of in vivo enrichment when three 5' flanking sequences/loop sequences/3' flanking sequences with homology greater than 80% are included in the adenovirus vector delivery system provided in an example of the present application (shown as siRNA content in blood).

Fig. 9 is a structure constructed when the adenovirus vector provided in an embodiment of the present application carries multiple lines, and adjacent lines are connected by sequence 1-sequence 2-sequence 3, wherein sequence 2 contains multiple bases. The delivery system has a graph of in vivo enrichment assays (shown as siRNA levels in blood).

Fig. 10 is a graph showing the detection results of in vivo enrichment of the delivery system constructed by the linker sequence provided by an embodiment of the present application as sequence 4 and a sequence with more than 80% homology to sequence 4 (based on the siRNA content in blood show).

Figure 11 is a graph of the detection results of the delivery system constructed when the lengths of RNA sequences provided in an embodiment of the present application are respectively 18, 20, and 21, and has the effect of treating obesity. In the figure, A is the relative PTP1B mRNA of RNA sequences of different lengths. Quantitative detection results, B is the relative detection results of PTP1B protein of different length RNA sequences.

Detailed ways

The specific embodiments of the present application will be described below with reference to the accompanying drawings.

First, technical terms, test methods, etc. related to the present invention are explained.

The detection of the siRNA level, the protein content and the mRNA content involved in the present invention is to establish the mouse stem cell in vitro model by injecting the RNA delivery system into the mouse. The expression levels of mRNA and siRNA in cells and tissues were detected by qRT-PCR. Absolute quantification of siRNA was determined by plotting a standard curve using the standards. The expression level of each siRNA or mRNA relative to the internal control can be represented by 2-ΔCT, where ΔCT=C sample-C internal control. When amplifying siRNA, the internal reference gene is U6snRNA (in tissue) or miR-16 (in serum, exosomes), and when amplifying mRNA, the gene is GAPDH or 18s RNA. Western blotting was used to detect protein expression levels in cells and tissues, and ImageJ software was used for protein quantitative analysis.

In the present invention, unless otherwise specified, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. In addition, the reagents, materials and operation steps used herein are the reagents, materials and conventional steps widely used in the corresponding fields.

Example 1

This embodiment provides an RNA delivery system for treating obesity, the system comprising a viral vector carrying an RNA fragment capable of treating obesity, and the viral vector can be enriched in the organ tissue of a host, And endogenously and spontaneously form a composite structure containing fragments of the RNA capable of treating obesity in the host organ tissue, and the composite structure sends the RNA fragments into the target tissue (brain) to achieve obesity. treat.

Both adenovirus and lentivirus can be used as viral vectors, and the RNA delivery systems constructed by them have in vivo enrichment, self-assembly and therapeutic effects on obesity, as shown in Figure 3-5.

In this embodiment, the viral vector also includes a promoter and a targeting tag. The viral vector includes any one of the following circuits or a combination of several circuits: promoter-RNA sequence, promoter-targeting tag, promoter-RNA sequence-targeting tag, and each of the viral vectors includes at least one RNA fragments and a targeting tag, either in the same circuit or in different circuits. In other words, the viral vector may only include a promoter-RNA sequence-targeting tag, or may include a combination of a promoter-RNA sequence, a promoter-targeting tag, or a promoter-targeting tag, a promoter A combination of RNA-seq-targeting tags.

When the adenovirus vector delivery system contains multiple RNA fragments and multiple targeting tags, it has in vivo enrichment, self-assembly and obesity treatment effects, as shown in Figure 7, where the targeting tag is RVG, and the RNA fragment is siRNA-1, siRNA-2, siRNA-1+siRNA-2.

Further, the viral vector may also include a flanking sequence, a compensation sequence and a loop sequence that can make the circuit fold into a correct structure and express, and the flanking sequence includes a 5' flanking sequence and a 3' flanking sequence; the viral vector Including any one of the following lines or a combination of several lines: 5'-promoter-5' flanking sequence-RNA fragment-loop sequence-compensating sequence-3' flanking sequence, 5'-promoter-targeting tag, 5' - Promoter - Targeting Tag - 5' Flanking Sequence - RNA Fragment - Loop Sequence - Compensation Sequence - 3' Flanking Sequence.

Wherein, the 5' flanking sequence is preferably ggatcctggaggcttgctgaaggctgtatgctgaattc or a sequence with a homology greater than 80%, including a sequence with 85%, 90%, 92%, 95%, 98%, 99% homology with ggatcctggaggcttgctgaaggctgtatgctgaattc, etc.

The loop sequence is preferably gttttggccactgactgac or a sequence with more than 80% homology thereto, including sequences with 85%, 90%, 92%, 95%, 98%, 99% homology with gttttggccactgactgac, and the like.

The 3' flanking sequence is preferably accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag or a sequence with a homology greater than 80%, including a sequence with 85%, 90%, 92%, 95%, 98%, 99% homology with accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag, etc.

The compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-5 bases are deleted. When the RNA fragment contains only one RNA sequence, the compensation sequence can be the reverse complementary sequence of the RNA sequence by deleting any 1-5 bases therein.

Preferably, the compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-3 bases are deleted. When the RNA fragment contains only one RNA sequence, the compensation sequence can be the reverse complementary sequence of the RNA sequence by deleting any 1-3 bases therein.

More preferably, the compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-3 consecutive bases are deleted. When the RNA fragment contains only one RNA sequence, the compensation sequence may be the reverse complementary sequence of the RNA sequence by deleting any 1-3 consecutively arranged bases.

Most preferably, the compensation sequence is the reverse complement of the RNA fragment, and the 9th and/or 10th bases are deleted. When the RNA fragment contains only one RNA sequence, the compensation sequence may be the reverse complementary sequence of the 9th position and/or the 10th position in the deletion of the RNA sequence. Deleting bases 9 and 10 works best.

It should be noted that the above-mentioned flanking sequences, compensation sequences and loop sequences are not randomly selected, but are determined based on a large number of theoretical studies and experiments. increase the expression rate of RNA fragments.

In the case of adenovirus vectors containing 3 homologous sequences, they also have in vivo enrichment, self-assembly and obesity treatment effects, as shown in Figure 8, the sequences are grouped as follows:

1. 3 5' flanking sequences with more than 80% homology;

2. 3 loop sequences with more than 80% homology;

3. Three 3' flanking sequences with more than 80% homology.

The specific sequence is shown in Table 2 below.

In the case that the viral vector carries two or more lines, the adjacent lines can be connected by sequence 1-sequence 2-sequence 3; wherein, sequence 1 is preferably CAGATC, and sequence 2 can be composed of 5-80 bases Sequence of bases, such as 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75 bases The sequence of 10-50 bases is preferable, and the sequence of 20-40 bases is more preferable. Sequence 3 is preferably TGGATC.

When the adenovirus vector carries multiple lines, the adjacent lines are connected by sequence 1-sequence 2-sequence 3, wherein sequence 2 contains multiple bases, and the constructed delivery system also has in vivo enrichment, self-assembly and obesity. The treatment effect of the disease is shown in Figure 9.

Sequence 2 is specifically shown in Table 3 below.

More preferably, when the viral vector carries two or more lines, adjacent lines are connected by sequence 4 or a sequence with more than 80% homology to sequence 4; wherein, sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC.

When the connecting sequence is sequence 4 and a sequence with more than 80% homology to sequence 4, the constructed delivery system also has in vivo enrichment, self-assembly and obesity treatment effects, as shown in Figure 10, sequence 4-1 in Figure 10 That is, the sequence 4, the sequence 4-2/4-3/4-4 is the homologous sequence of the sequence 4-1, and the sequence is specifically shown in Table 4 below.

Sequence 4-1	CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC
Sequence 4-2	CAGATCTGGCCGCACTCGTAGAGGTGAGTCGACCAGTGGATC
Sequence 4-3	CAGATCTGGCACCCGTCGAGGTAGTGAGTCGACCAGTGGATC
Sequence 4-4	CAGATCTGGCCGCACAGGTCGTAGTGAGTCGACCAGTGGATC

The above-mentioned RNA fragments comprise one, two or more specific RNA sequences of medical significance, the RNA sequences can be expressed in the target receptor, and the compensatory sequence cannot be expressed in the target receptor. The RNA sequence can be an siRNA sequence, a shRNA sequence or a miRNA sequence, preferably an siRNA sequence.

The length of an RNA sequence is 15-25 nucleotides (nt), preferably 18-22nt, such as 18nt, 19nt, 20nt, 21nt, and 22nt. This range of sequence lengths was not chosen arbitrarily, but was determined through trial and error. A large number of experiments have proved that when the length of the RNA sequence is less than 18nt, especially less than 15nt, the RNA sequence is mostly invalid and will not play a role. The cost of the line is greatly increased, and the effect is not better than the RNA sequence with a length of 18-22nt, and the economic benefit is poor. Therefore, when the length of the RNA sequence is 15-25nt, especially 18-22nt, the cost and the effect can be taken into account, and the effect is the best.

When the RNA sequence lengths were 18, 20, and 21, respectively, the constructed delivery system also had in vivo enrichment, self-assembly, and therapeutic effects on obesity, as shown in Figure 11 , and the specific sequences as shown in Table 5.

21nt sequence	CTAACTTCAGTGTCTGGGACTC
20nt sequence	CTAACTTCAGTGTCTGGGACT
18nt sequence	CTAACTTCAGTGTCTGGA

The RNA capable of treating obesity is selected from the siRNA of the PTP1B gene or the nucleic acid molecule encoding the above RNA.

The number of RNA effective sequences capable of treating obesity is one, two or more.

Taking the combined use of "siRNA1" and "siRNA2" on the same viral vector as an example, the functional structural region of the viral vector can be expressed as: (promoter-siRNA1)-connector sequence-(promoter-siRNA2)-connector sequence- (promoter-targeting tag), or (promoter-targeting tag-siRNA1)-linker-(promoter-targeting tag-siRNA2), or (promoter-siRNA1)-linker-(promoter- Targeting tag-siRNA2) etc.

More specifically, the functional structural region of the viral vector can be expressed as: (5'-promoter-5'flanking sequence-siRNA1-loop sequence-compensating sequence-3'flanking sequence)-connector sequence-(5'-promoter - 5' flanking sequence - siRNA2-loop sequence - compensation sequence - 3' flanking sequence) - linking sequence - (5'-promoter-targeting tag), or (5'-promoter-targeting tag-5' flanking sequence-siRNA1-loop sequence-compensation sequence-3' flanking sequence)-linker sequence-(5'-promoter-targeting tag-5'flanking sequence-siRNA2-loop sequence-compensating sequence-3'flanking sequence), or (5'-promoter-5'flanking sequence-siRNA1-loop sequence-compensating sequence-3'flanking sequence)-linking sequence-(5'-promoter-targeting tag-5'flanking sequence-siRNA2-loop sequence- Compensation sequence-3'flanking sequence), (5'-promoter-targeting tag-5'flanking sequence-siRNA1-siRNA2-loop sequence-compensating sequence-3'flanking sequence), etc. Other situations can be deduced by analogy, and details are not repeated here. The above connecting sequence can be "sequence 1-sequence 2-sequence 3" or "sequence 4", and a bracket indicates a complete circuit.

Preferably, the above RNA can also be obtained by ribose modification of the RNA sequence (siRNA, shRNA or miRNA) therein, preferably 2' fluoropyrimidine modification. 2'Fluoropyrimidine modification is to replace the 2'-OH of pyrimidine nucleotides on siRNA, shRNA or miRNA with 2'-F. 2'-F can make it difficult for RNase in the human body to recognize siRNA, shRNA or miRNA, so it can Increases the stability of RNA transport in vivo.

Specifically, the liver will phagocytose exogenous viruses, and up to 99% of the exogenous viruses will enter the liver. Therefore, when viruses are used as vectors, they can be enriched in liver tissue without specific design. After being opened, RNA molecules (siRNA, shRNA, or miRNA) are released, and liver tissue spontaneously wraps the above RNA molecules into exosomes, and these exosomes become RNA delivery mechanisms.

Preferably, in order to make the RNA delivery mechanism (exosome) have the ability of "precision guidance", we design a targeting tag in the viral vector injected into the body, and the targeting tag will also be assembled into exosomes by liver tissue In particular, when certain specific targeting tags are selected, the targeting tags can be inserted into the surface of exosomes to become targeting structures that can guide exosomes, which greatly improves the RNA delivery of the present invention. The accuracy of the mechanism, on the one hand, can greatly reduce the amount of viral vector that needs to be introduced, and on the other hand, greatly improves the efficiency of potential drug delivery.

The targeting tag is selected from one of the peptides, proteins or antibodies with targeting function. The selection of the targeting tag is a process that requires creative work. On the one hand, the available targeting tags need to be selected according to the target tissue, and on the other hand It is ensured that the targeting tag can stably appear on the surface of exosomes, so as to achieve the targeting function. Targeting tags that have been screened include targeting peptides, targeting proteins, and antibodies. Wherein, targeting peptides include but are not limited to RVG targeting peptide (nucleotide sequence shown in SEQ ID No: 1), GE11 targeting peptide (nucleotide sequence shown in SEQ ID No: 2), PTP targeting peptide Peptide (nucleotide sequence shown in SEQ ID No: 3), TCP-1 targeting peptide (nucleotide sequence shown in SEQ ID No: 4), MSP targeting peptide (nucleotide sequence shown in SEQ ID No: 4) : 5); targeting proteins include but are not limited to RVG-LAMP2B fusion protein (nucleotide sequence shown in SEQ ID No: 6), GE11-LAMP2B fusion protein (nucleotide sequence shown in SEQ ID No: 7) shown), PTP-LAMP2B fusion protein (nucleotide sequence shown in SEQ ID No: 8), TCP-1-LAMP2B fusion protein (nucleotide sequence shown in SEQ ID No: 9), MSP-LAMP2B fusion protein (The nucleotide sequence is shown in SEQ ID No: 10).

In addition, in order to achieve the purpose of precise delivery, we have experimented with a variety of viral vector loading schemes, and came up with another optimized scheme: the viral vector can also be composed of multiple viruses with different structures, one of which contains a promoter promoters and targeting tags, other viruses contain promoters and RNA segments. Loading the targeting tag and RNA fragment into different viral vectors, and injecting the two viral vectors into the body, the targeting effect is no worse than the targeting effect produced by loading the same targeting tag and RNA fragment into one viral vector .

More preferably, when two different viral vectors are injected into the host, the viral vector containing the RNA sequence can be injected first, and then the viral vector containing the targeting tag can be injected after 1-2 hours, so that a better target can be achieved. to the effect.

The delivery systems described above can all be used in mammals, including humans.

The RNA delivery system for the treatment of obesity provided in this example uses a virus as a vector, and the virus vector is used as a mature injection. Its safety and reliability have been fully verified, and the drugability is very good. The final effective RNA sequence is packaged and delivered by endogenous exosomes, and there is no immune response, so there is no need to verify the safety of the exosomes. The delivery system can deliver all kinds of small molecule RNAs, and has strong versatility. And the preparation of viral vectors is much cheaper and more economical than the preparation of exosomes or proteins, polypeptides and other substances. The RNA delivery system for the treatment of obesity provided in this example can be tightly combined with AGO ₂ and enriched into a composite structure (exosome) after self-assembly in vivo, which can not only prevent its premature degradation, but also maintain its circulation in the circulation. It is stable, and is beneficial to receptor cell uptake, intracytoplasmic release and lysosomal escape, and the required dose is low.

Example 2

On the basis of Embodiment 1, this embodiment provides a medicine. The medicament comprises a viral vector carrying an RNA fragment capable of treating obesity, the viral vector being capable of enriching in the organ tissue of a host, and endogenously and spontaneously forming in the organ tissue of the host an RNA fragment capable of treating obesity A complex structure of fragments of the RNA for the treatment of obesity, the complex structure being capable of entering and binding to a target tissue, delivering the RNA fragments into the target tissue.

Further, the RNA capable of treating obesity is one or more of siRNA, shRNA and miRNA having medical significance and capable of inhibiting or hindering the development of obesity.

When the viral vector system carries a variety of different RNA fragments, it has in vivo enrichment, self-assembly and therapeutic effects on obesity, as shown in Figure 6, where the RNA fragments are grouped as follows:

1. Six kinds of RNA are used alone: siRNA-1 alone, siRNA-2 alone, shRNA-1 alone, shRNA-2 alone, miRNA-1 alone, miRNA-2 alone;

2. Any two of the six RNA sequences are combined into RNA fragments: siRNA-1+siRNA-2, shRNA-1+shRNA-2, miRNA-1+miRNA-2;

3. Any 3 of the 6 RNA sequences are combined into RNA fragments: siRNA-1+siRNA-2+shRNA-1, siRNA-1+siRNA-2+shRNA-2, siRNA-1+siRNA-2+miRNA- 1. siRNA-1+siRNA-2+miRNA-2.

The RNA sequences are specifically shown in Table 1 below.

Further, the viral vector comprises a promoter and a targeting tag, the targeting tag can form the targeting structure of the composite structure in the organ tissue of the host, the targeting structure is located on the surface of the composite structure, the The complex structure is capable of finding and binding to the target tissue through the targeting structure, delivering the RNA fragment into the target tissue.

Further, the viral vector includes any one of the following circuits or a combination of several circuits: promoter-RNA fragment, promoter-targeting tag, promoter-RNA fragment-targeting tag; each of the viral vectors including at least one RNA segment and one targeting tag, the RNA segment and targeting tag are located in the same circuit or are located in different circuits.

The viral vector further comprises a flanking sequence, a compensation sequence and a loop sequence that can fold the circuit into a correct structure and express, and the flanking sequence includes a 5' flanking sequence and a 3' flanking sequence;

The viral vector includes any one of the following lines or a combination of several lines: 5'-promoter-5' flanking sequence-RNA fragment-loop sequence-compensating sequence-3' flanking sequence, 5'-promoter-target To tag, 5'-promoter-targeting tag-5'flanking sequence-RNA fragment-loop sequence-compensating sequence-3'flanking sequence.

The 5' flanking sequence is ggatcctggaggcttgctgaaggctgtatgctgaattc or a sequence whose homology is greater than 80%;

The loop sequence is gttttggccactgactgac or a sequence whose homology is greater than 80%;

The 3' flanking sequence is accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag or a sequence whose homology is greater than 80%;

The compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-5 bases are deleted.

When there are at least two lines in the viral vector, adjacent lines are connected by a sequence consisting of sequences 1-3;

Wherein, sequence 1 is CAGATC, sequence 2 is a sequence consisting of 5-80 bases, and sequence 3 is TGGATC.

When there are at least two lines in the viral vector, adjacent lines are connected by sequence 4 or a sequence with more than 80% homology to sequence 4;

Wherein, sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC.

Further, the organ tissue is liver, and the composite structure is exosome.

Further, the targeting tag is selected from targeting peptides or targeting proteins with targeting function. , the targeting structure is located on the surface of the composite structure.

The targeting peptides include RVG targeting peptides, GE11 targeting peptides, PTP targeting peptides, TCP-1 targeting peptides, and MSP targeting peptides;

The targeting proteins include RVG-LAMP2B fusion protein, GE11-LAMP2B fusion protein, PTP-LAMP2B fusion protein, TCP-1-LAMP2B fusion protein, and MSP-LAMP2B fusion protein.

The RNA sequence is 15-25 nucleotides in length.

Further, the targeting tag is RVG-LAMP2B fusion protein, or GE11-LAMP2B fusion protein.

Further, the number of RNA effective sequences capable of treating obesity is one, two or more.

Further, the medicament can be used in mammals including humans.

Further, the RNA capable of treating obesity is selected from the siRNA of the PTP1B gene or the nucleic acid molecule encoding the above RNA.

After the drug can be administered orally, inhaled, subcutaneously injected, intramuscularly injected or intravenously injected into the human body, it can be delivered to the target tissue through the RNA delivery system described in Example 1 to exert a therapeutic effect.

The drug can also be used in combination with other obesity treatment drugs to enhance the treatment effect, such as orlistat, metformin, liraglutide, etc.

The medicine of this embodiment may also include a pharmaceutically acceptable carrier, which includes but is not limited to diluents, buffers, emulsions, encapsulation agents, excipients, fillers, adhesives, sprays, transdermal absorption Agents, wetting agents, disintegrating agents, absorption enhancers, surfactants, coloring agents, flavoring agents, adjuvants, desiccants, adsorption carriers, etc.

The dosage forms of the medicine provided in this embodiment can be tablets, capsules, powders, granules, pills, suppositories, ointments, solutions, suspensions, lotions, gels, pastes, and the like.

The medicine provided in this example uses the virus as the carrier and the virus carrier as the mature injection, and its safety and reliability have been fully verified, and the druggability is very good. The final effective RNA sequence is packaged and delivered by endogenous exosomes, and there is no immune response, so there is no need to verify the safety of the exosomes. The drug can deliver various kinds of small molecule RNAs and has strong versatility. And the preparation of viral vectors is much cheaper and more economical than the preparation of exosomes or proteins, polypeptides and other substances. The drug provided in this application can be closely combined with AGO ₂ and enriched into a composite structure (exosome) after self-assembly in vivo, which can not only prevent its premature degradation and maintain its stability in circulation, but also benefit the receptor. Cellular uptake, intracytoplasmic release and lysosomal escape require low doses.

Example 3

On the basis of Embodiment 1 or 2, this embodiment provides an application of an RNA delivery system for treating obesity in medicine, and the medicine is a medicine for treating obesity. This example specifically describes the application of the RNA delivery system in obesity treatment in conjunction with the following experiments.

The PTP1B siRNA system (AAV-CMV-siR ^P /AAV-CMV-RVG- ^siRP ) was encapsulated by the high-affinity AAV-5 adeno-associated virus in the liver, and 100 μL of AAV solution with a titer of 10 ¹² Vg/ml was injected into the tail vein. into mice. The in vivo expression of the AAV system was monitored by small animals. After 3 weeks, it was found that the AAV system was stably expressed in vivo, especially in the liver.

C57BL/6 mice were selected and injected with PBS buffer/AAV-CMV-scrR/AAV-CMV- ^siRP /AAV-CMV-RVG- ^siRP after 12 weeks to form PBS group/AAV-CMV-scrR group/AAV -CMV- ^siRP group/AAV-CMV-RVG- ^siRP group and injected every two days for 24 days. Changes in body weight, weight of covered fat pads, initial food intake, serum leptin content, blood glucose content, basal glucose content, serum total cholesterol (TC), triglyceride (TG), low-density lipid The detection and statistics of protein (LDL), body length and food intake, the results are as follows.

As shown in Figure 1A, which is a comparison chart of the body weight of mice in each group, it can be seen that the body weight of mice in the AAV-CMV-RVG- ^siRP group is the most stable.

As shown in Figure 1B, which is a comparison chart of the weight of the epididymal fat pad of the mice in each group, it can be seen that the weight of the epididymal fat pad of the mice in the AAAV-CMV-RVG- ^siRP group is the lightest.

As shown in Figure 1C, the figure is a comparison chart of the initial food intake curves of mice in each group. As can be seen, the mice in the AAV-CMV-RVG- ^siRP group had the least food intake.

As shown in Figure 1D, the figure is a comparison chart of serum leptin content of mice in each group. It can be seen that the serum leptin content of mice in the AAV-CMV-RVG- ^siRP group was the lowest.

As shown in Figure 1E, the figure is a comparison chart of blood glucose change curves of mice in each group. It can be seen that the blood glucose content of mice in the AAV-CMV-RVG- ^siRP group was the lowest.

As shown in Figure 1F, the figure is a comparison chart of the basal glucose change curves of mice in each group. It can be seen that the mice in the AAV-CMV-RVG- ^siRP group had the lowest basal glucose content.

As shown in Figure 2A-Figure 2C, the three pictures are the comparison charts of serum total cholesterol (TC), triglyceride (TG), and low density lipoprotein (LDL) of mice in each group. It can be seen that AAV-CMV -RVG- ^siRP group had the lowest TC, TG and LDL.

As shown in Figure 2D, which is a comparison chart of the body lengths of the mice in each group, it can be seen that the body lengths of the four groups of mice are almost the same.

As shown in Figure 2E, which is a comparison chart of the HFD food intake of the mice in each group, it can be seen that the HFD food intake of the four groups of mice is also similar.

The above experiments can show that AAV-CMV- ^siRP and AAV-CMV-RVG- ^siRP have a certain degree of inhibitory effect on obesity.

In this document, "upper", "lower", "front", "rear", "left", "right", etc. are only used to indicate the relative positional relationship between related parts, rather than limit the absolute positions of these related parts .

In this document, "first", "second", etc. are only used to distinguish each other, but do not indicate the degree of importance and order, and the premise of mutual existence.

In this paper, "equal", "same" and the like are not limitations in strict mathematical and/or geometric senses, and also include errors that can be understood by those skilled in the art and allowed by manufacturing or use.

Unless otherwise indicated, numerical ranges herein include not only the entire range between its two endpoints, but also several subranges subsumed therein.

The preferred specific embodiments and embodiments of the present application have been described in detail above in conjunction with the accompanying drawings, but the present application is not limited to the above-mentioned embodiments and embodiments. Various changes are made under the premise of the application concept.

Claims (19)

1. An RNA delivery system for the treatment of obesity, characterized in that the system comprises a viral vector, the viral vector carries an RNA fragment capable of treating obesity, and the viral vector can be enriched in the organ tissue of a host, And endogenously and spontaneously form a composite structure containing the RNA fragment capable of treating obesity in the host organ tissue, and the composite structure can send the RNA fragment into the target tissue to achieve obesity treatment.
2. The RNA delivery system for treating obesity according to claim 1, wherein the viral vector is an adenovirus-associated virus.
3. The RNA delivery system for treating obesity according to claim 2, wherein the adenovirus-associated virus is adeno-associated virus type 5, adenovirus-associated virus type 8 or adenovirus-associated virus type 9.
4. The RNA delivery system for treating obesity according to claim 1, wherein the RNA fragment comprises one, two or more specific RNA sequences with medical significance, and the RNA sequences are of medical significance siRNA, shRNA or miRNA.
5. The RNA delivery system for treating obesity according to claim 1, wherein the viral vector comprises a promoter and a targeting tag, and the targeting tag can form the complex structure in the organ tissue of the host The targeting structure is located on the surface of the composite structure, and the composite structure can find and bind to the target tissue through the targeting structure, and deliver the RNA fragment into the target tissue.
6. The RNA delivery system for treating obesity according to claim 5, wherein the viral vector comprises any one of the following lines or a combination of several lines: promoter-RNA fragment, promoter-targeting Tag, promoter-RNA segment-targeting tag; each of the viral vectors includes at least one RNA segment and one targeting tag, and the RNA segment and targeting tag are located in the same line or in different lines.
7. The RNA delivery system for treating obesity according to claim 6, wherein the viral vector further comprises a flanking sequence, a compensation sequence and a loop sequence capable of folding the circuit into a correct structure and expressing it, and the Flanking sequences include 5' flanking sequences and 3' flanking sequences;

   The viral vector includes any one of the following lines or a combination of several lines: 5'-promoter-5' flanking sequence-RNA fragment-loop sequence-compensating sequence-3' flanking sequence, 5'-promoter-target To tag, 5'-promoter-targeting tag-5'flanking sequence-RNA fragment-loop sequence-compensating sequence-3'flanking sequence.
8. The RNA delivery system for treating obesity according to claim 7, wherein the 5' flanking sequence is ggatcctggaggcttgctgaaggctgtatgctgaattc or a sequence whose homology is greater than 80%;

   The loop sequence is gttttggccactgactgac or a sequence whose homology is greater than 80%;

   The 3' flanking sequence is accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag or a sequence whose homology is greater than 80%;

   The compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-5 bases are deleted.
9. The RNA delivery system for treating obesity according to claim 6, characterized in that, when there are at least two circuits in the viral vector, adjacent circuits are connected by a sequence consisting of sequences 1-3;

   Wherein, sequence 1 is CAGATC, sequence 2 is a sequence consisting of 5-80 bases, and sequence 3 is TGGATC.
10. The RNA delivery system for treating obesity according to claim 9, characterized in that, when there are at least two lines in the viral vector, adjacent lines pass through sequence 4 or homology with sequence 4 More than 80% of the sequences are connected;

    Wherein, sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC.
11. The RNA delivery system for treating obesity according to claim 1, wherein the organ tissue is liver, and the composite structure is exosome.
12. The RNA delivery system for treating obesity according to claim 5, wherein the targeting tag is selected from targeting peptides or targeting proteins with targeting function.
13. The RNA delivery system for treating obesity according to claim 12, wherein the targeting peptide comprises RVG targeting peptide, GE11 targeting peptide, PTP targeting peptide, TCP-1 targeting peptide, MSP targeting peptide targeting peptide;

    The targeting proteins include RVG-LAMP2B fusion protein, GE11-LAMP2B fusion protein, PTP-LAMP2B fusion protein, TCP-1-LAMP2B fusion protein, and MSP-LAMP2B fusion protein.
14. The RNA delivery system for treating obesity according to claim 5, wherein the length of the RNA sequence is 15-25 nucleotides.
15. The RNA delivery system for treating obesity according to claim 14, wherein the RNA capable of treating obesity is selected from siRNA of PTP1B gene, or an RNA sequence with a homology of more than 80% to the above sequence, or nucleic acid molecules encoding the above RNA sequences.
16. The RNA delivery system for treating obesity according to claim 15, wherein the siRNA of the PTP1B gene comprises UGAUAUAGUCAUUAUCUUCUU, UCCAUUUUUAUCAAACUAGCG, AUUGUUUAAAUAAAUAUGGAG, AAUUUUAAUACAUUAUUGGUU, UUUAUUAUUGUACUUUUUGAU, and other sequences that inhibit the expression of the PTP1B gene and are homologous to the above sequences Sequences with sex greater than 80%.
17. The RNA delivery system for treating obesity of claim 1, wherein the delivery system is a delivery system for use in mammals including humans.
18. A use of the RNA delivery system for treating obesity according to any one of claims 1-17 in medicine.
19. The application according to claim 18, wherein the administration mode of the drug comprises oral administration, inhalation, subcutaneous injection, intramuscular injection, and intravenous injection.

Images