CN114681428A

CN114681428A - Delivery system for targeted inhibition of EGFR (epidermal growth factor receptor) and application thereof

Info

Publication number: CN114681428A
Application number: CN202011637605.3A
Authority: CN
Inventors: 陈熹; 张辰宇; 付正; 郭宏源; 苏媛媛
Original assignee: Institute Of Artificial Intelligence Biomedical Technology Nanjing University
Current assignee: Institute Of Artificial Intelligence Biomedical Technology Nanjing University
Priority date: 2020-12-31
Filing date: 2020-12-31
Publication date: 2022-07-01
Anticipated expiration: 2040-12-31
Also published as: CN114681428B

Abstract

The application provides a delivery system for targeted inhibition of EGFR and application thereof. Wherein the delivery system comprises: the RNA capable of inhibiting the expression of the EGFR gene, the targeting element and the delivery vector, wherein the delivery vector carrying the RNA capable of inhibiting the expression of the EGFR gene and the targeting element are self-assembled in the organ tissues of the mammal to form a composite structure, and the composite structure is searched by the targeting element and sends the required delivery RNA into the target tissues to inhibit the expression of the EGFR gene in the target tissues. The delivery system for targeted inhibition of EGFR can be used for accurately treating specific diseases, and is good in treatment effect and high in efficiency.

Description

Delivery system for targeted inhibition of EGFR (epidermal growth factor receptor) and application thereof

Technical Field

The application relates to the technical field of biomedicine, in particular to a delivery system for targeted inhibition of EGFR and application thereof.

Background

Lung cancer is one of the most common malignancies with the highest morbidity and mortality rates and the greatest threat to human health and life. In many countries, the incidence and mortality of lung cancer have been reported to be significantly higher in recent 50 years, with lung cancer incidence and mortality in men accounting for the first of all malignancies, in women accounting for the second, and mortality accounting for the second. The development of specific targeted drugs aiming at lung cancer has great significance for clinical treatment.

Epidermal Growth Factor Receptor (EGFR) is an expression product of protooncogene C-erbB-1, is a transmembrane protein, and is the 1 st member of epidermal growth factor receptor family. The mutation of the EGFR protein is closely related to about 50 percent of middle and advanced non-small cell lung cancer, and is a lung cancer treatment target with a very promising application prospect. At present, clinical treatment medicines aiming at EGFR mutant lung cancer are Tyrosine Kinase Inhibitors (TKI), the action mode of the TKI takes protein as a target spot, secondary drug resistance is often accompanied in clinical treatment, and EGFR mutant lung cancer cannot be completely cured.

At present, the individual treatment of molecular targeted drugs selected according to the lung cancer genotype becomes a clinical common treatment means. How to improve the curative effect of the mutant gene and reduce the toxic and side effects is also the main direction of the research on the treatment of lung cancer. With the progress of research, the development and application of novel targeted drugs are endless, but most of lung cancer patients with effective EGFR-TKI treatment have EGFR-TKI treatment resistance after 9-14 months. Although some studies show that a combination therapy (such as afatinib combined with trastuzumab (Cetuxumab)) can achieve a therapeutic effect on the drug-resistant NSCLC, the drug-resistant NSCLC cannot fundamentally solve the drug resistance problem and has very obvious side effects, so that the clinical application potential of the NSCLC is greatly limited, and the combination therapy becomes a problem to be solved urgently.

Disclosure of Invention

In view of the above, embodiments of the present application provide a delivery system for targeted EGFR inhibition and applications thereof, so as to solve the technical defects in the prior art.

One aspect of the present invention is to provide a delivery system for targeted inhibition of EGFR, comprising: RNA and delivery vectors capable of inhibiting EGFR gene expression;

the delivery vector carrying the RNA capable of inhibiting the expression of the EGFR gene and the targeting element are self-assembled in the organ tissues of the mammal to form a composite structure, the composite structure is searched by the targeting element, the RNA capable of inhibiting the expression of the EGFR gene is sent into the target tissues, and the expression of the EGFR gene in the target tissues is inhibited.

Further, the RNA capable of inhibiting EGFR gene expression includes: a promoter element, and at least one of siRNA and encoding siRNA capable of inhibiting EGFR gene expression.

Further, the nucleotide sequence of the siRNA capable of inhibiting the expression of the EGFR gene is as follows:

5’-TGTTGCTTCTGTTAATTCCT-3’；

the coding siRNA sense strand nucleotide sequence capable of inhibiting EGFR gene expression is as follows:

5’-GGATCCTGGAGGCTTGCTGAAGGCTGTATGCTGAATTCTGTTGCTTCTCTTAATTCCTGTTTTGGCCACTGACTGACAGGAATTAAGAAGCAACAACCGGTCAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCAGATCTGGCCGCACTCGAG-3’；

the coding siRNA antisense strand nucleotide sequence capable of inhibiting EGFR gene expression is as follows:

5’-CTCGAGTGCGGCCAGATCTGGGCCATTTGTTCCATGTGAGTGCTAGTAACAGGCCTTGTGTCCTGACCGGTTGTTGCTTCTTAATTCCTGTCAGTCAGTGGCCAAAACAGGAATTAAGAGAAGCAACAGAATTCAGCATACAGCCTTCAGCAAGCCTCCAGGATCC-3’。

further, the composite structure is an exosome.

Further, the targeting element comprises one, two or more targeting sequences.

Further, if the targeting element comprises a targeting sequence, the targeting sequence is selected from the group consisting of GE11 sequences;

if the targeting element comprises two targeting sequences, the targeting sequences are selected from the group consisting of the GE11 sequence and the targeted PTP1B siRNA coding sequence.

Further, the coding sequence of the targeting PTP1B siRNA is selected from SEQ ID NO: 1.

further, the delivery vector is selected from the group consisting of a plasmid vector and a viral vector.

Further, the viral vector includes at least one of a retroviral vector, a lentiviral vector, an adenoviral vector, and an adeno-associated viral vector.

Another aspect of the present invention is to provide a use of the delivery system for targeted EGFR inhibition as described in any of the above paragraphs in the preparation of an anti-tumor product.

Further, the antitumor product includes an agent for inhibiting cancer cells or preventing the expression of EGFR gene, a drug having preventive and/or therapeutic effects on tumors.

Further, the tumor includes at least one of breast cancer, lung cancer, stomach cancer, intestinal cancer, bladder cancer, and ovarian cancer.

The technical effects of this application do:

the delivery system comprises RNA capable of inhibiting EGFR gene expression and a delivery vector, wherein the delivery vector carries the RNA capable of inhibiting EGFR gene expression and a targeting element to self-assemble in organ tissues of mammals to form a composite structure, and the composite structure searches through the targeting element and sends the RNA capable of inhibiting EGFR gene expression into target tissues to inhibit EGFR gene expression in the target tissues.

The delivery system is based on a synthetic biological element, utilizes the self organs of mammals as natural bioreactors, self-assembles the targeting element and RNA capable of inhibiting the expression of EGFR genes into a composite structure capable of targeting and treating EGFR mutant diseases in the bodies of the mammals, and secretes the composite structure to a circulatory system, and the composite structure directionally transports the RNA to cells which need treatment urgently, such as tumor cells and the like under the action of the targeting element, thereby exerting the treatment effect, having high treatment efficiency and good effect, and particularly having excellent treatment effect on EGFR mutant lung cancer.

The delivery system for targeted inhibition of EGFR provided herein takes advantage of naturally occurring secretion mechanisms and thus avoids toxicity associated with the use of other vectors. The targeting element can effectively deliver RNA to tissues needing treatment, and has high delivery efficiency and almost no side effect.

The delivery system for targeted inhibition of EGFR is established based on a plasmid vector, is easy for industrial production and large-scale purification, and greatly reduces the production difficulty and the production cost compared with other siRNA delivery modes.

The delivery system for targeted inhibition of EGFR provided by the application is applied to anti-tumor products, has no toxic or side effect, takes effect quickly, has good curative effect and is suitable for large-scale popularization and use. In addition, the targeting element and the targeting gene can be adjusted according to the requirements of different disease treatments, so that personalized treatment can be provided for different diseases.

Drawings

FIG. 1 is a diagram of a plasmid backbone provided in an embodiment of the present application;

FIG. 2 is a graph comparing the expression levels of related RNAs and proteins provided in an embodiment of the present application;

FIG. 3 is a graph of the metabolic profile of siRNA provided in one embodiment of the present application in mice;

FIG. 4 is a graph comparing the therapeutic effect of different delivery systems provided by one embodiment of the present application on a mouse lung cancer model;

FIG. 5 is a graph showing pathological analysis and protein expression detection of mouse lung tissues according to an embodiment of the present application;

FIG. 6 is a tracer plot of exosomes in mice provided by an embodiment of the present application;

FIG. 7 is a graph comparing the therapeutic effect of different delivery systems provided by one embodiment of the present application on a mouse lung cancer model;

figure 8 is a graph comparing the safety of administration provided by one embodiment of the present application.

Detailed Description

The following description of specific embodiments of the present application refers to the accompanying drawings.

In the present invention, unless otherwise specified, scientific and technical terms used herein have the meanings that are commonly understood by those skilled in the art. Also, the reagents, materials and procedures used herein are those that are widely used in the corresponding fields.

Example 1

The present embodiments provide a delivery system targeted to inhibit EGFR, the delivery system comprising: RNA and delivery vectors capable of inhibiting EGFR gene expression.

The delivery vector carrying the RNA capable of inhibiting the expression of the EGFR gene and the targeting element are self-assembled in the organ tissues of the mammal to form a composite structure, and the composite structure searches through the targeting element and sends the required delivery RNA (RNA capable of inhibiting the expression of the EGFR gene) into the target tissues to inhibit the expression of the EGFR gene in the target tissues.

Specifically, the delivery vector carries RNA capable of inhibiting EGFR gene expression and can be enriched in organ tissues of mammals, a composite structure containing the RNA and a targeting element is formed endogenously and spontaneously in the organ tissues of the mammals, the composite structure searches and is combined with target tissues through the targeting element, the required delivery RNA is sent into the target tissues, and the expression of EGFR is inhibited.

Among them, the complex structure is preferably an exosome, and the target tissue is preferably a cancer cell which has an EGFR mutation and has EGFR expression.

The RNA capable of inhibiting the expression of the EGFR gene comprises a promoter element and at least one of siRNA and coded siRNA capable of inhibiting the expression of the EGFR gene. For example, the RNA may be a promoter element + siRNA capable of inhibiting EGFR gene expression, or may be a promoter element + coding siRNA capable of inhibiting EGFR gene expression.

Wherein, the nucleotide sequence of the siRNA capable of inhibiting the expression of EGFR gene is preferably:

5’-TGTTGCTTCTGTTAATTCCT-3’。

the siRNA/coding siRNA can be specifically combined with and degraded by EGFR mRNA, thereby playing a role in inhibiting the expression of EGFR.

The targeting element may comprise one, two or more targeting sequences. If the targeting element comprises a targeting sequence, the targeting sequence is preferably a GE11 sequence; if the targeting element includes two targeting sequences, the targeting sequences are preferably a combination of the GE11 sequence and the targeting PTP1B siRNA coding sequence. The coding sequence of the targeting PTP1B siRNA is shown in SEQ ID NO: 1 is shown.

The delivery vector is selected from the group consisting of a plasmid vector and a viral vector. Wherein the viral vector comprises at least one of a retroviral vector, a lentiviral vector, an adenoviral vector, and an adeno-associated viral vector.

The delivery vector is preferably a plasmid vector, in which case the delivery vector is a plasmid vector, the delivery system described above can be considered as a plasmid molecule.

Specifically, the plasmid carries an siRNA capable of inhibiting EGFR gene expression, the plasmid molecule is capable of enriching in mammalian organ tissue and spontaneously forming an exosome endogenously in said mammalian organ tissue with the targeting element GE11 or GE11+ encoding PTP1B siRNA, which exosome, via the targeting element GE11 or GE11+ encoding PTP1B siRNA, delivers the siRNA into cells undergoing EGFR mutation, thereby inhibiting EGFR expression.

The delivery system formed based on the plasmid vector is more easy for large-scale industrial production and purification, and compared with other siRNA delivery systems, the production difficulty and the production cost are greatly reduced.

In practical application, we constructed a delivery system (plasmid molecule) for EGFR gene separately, and combined the promoter element with the ability to inhibitsiRNA tandem of EGFR gene expression constructs siR^EAnd separately incorporated into a backbone support, the GE11-SiR^EThe plasmid backbone structure is shown in FIG. 1.

Plasmids with different interference sequences are constructed according to the method shown in figure 1, plasmid molecules are transfected into a 293T cell line of a human embryonic kidney cell, and the mRNA and protein expression levels of the EGFR gene in the cell are detected by utilizing qRT-PCR and Western blotting experiments after 36 hours. Here we set Mock control, NC control, siR^ETest group and GE11-SiR^EThe results of the test groups are shown in FIG. 2.

FIG. 2A is a graph comparing the expression levels of four groups of related EGFR siRNAs, and it can be seen from FIG. 2A that the Mock control group and NC control group did not detect the expression of related EGFR siRNAs, while the GE11-SiR in the other two groups^EThe relevant EGFR siRNA expression level of the test group is higher than that of the siR^ETest group.

FIG. 2B is a graph comparing the expression levels of four groups of related GE11 mRNAs, and the Mock control, NC control and siR can be seen in FIG. 2B^ENo related GE11 mRNA expression could be detected in all the groups, only GE11-SiR^EThe test group had GE11 mRNA present and the expression level of GE11 targeting peptide was higher.

Fig. 2C is a graph comparing the expression levels of four groups of related EGFR mrnas, and the ranking of the expression levels of four groups of related EGFR mrnas can be seen in fig. 2C as: NC control > Mock control > SiR^ETest group > GE11-SiR^ETest group.

FIG. 2D is a western blot showing the expression levels of four groups of EGFR proteins, and the ranking of the expression levels of four groups of EGFR proteins can be seen in FIG. 2D as: mock control > NC control > SiR^ERun > GE11-siR^ETest group.

As can be seen, the results in fig. 2 demonstrate that the delivery system targeted for EGFR inhibition provided herein is capable of effectively inhibiting the expression of the EGFR gene in a cell line.

Therefore, the delivery system for targeted EGFR inhibition provided in this embodiment uses a synthetic biological element as a basis, and uses a mammalian organ as a natural bioreactor, and self-assembles the targeting element and RNA capable of inhibiting EGFR gene expression in a mammalian body to form an exosome capable of targeted treatment of EGFR mutant diseases, and secretes the exosome into the circulatory system, and the exosome directionally transports the RNA to cells to be treated of tumor cells under the action of the targeting element, thereby exerting a therapeutic effect, with good therapeutic effect and high efficiency.

Particularly for EGFR mutant lung cancer, the delivery system can accurately and quickly target and transport related RNA to cancer cells, inhibit the expression of EGFR in the cancer cells, further play a role in inhibiting tumors, and has excellent effect.

Example 2

Based on example 1, this example provides the application of a delivery system for targeted inhibition of EGFR in the preparation of anti-tumor products.

The medicament of this embodiment may further include a pharmaceutically acceptable carrier, including but not limited to diluents, buffers, emulsions, encapsulating agents, excipients, fillers, adhesives, sprays, transdermal absorbents, humectants, disintegrating agents, absorption promoters, surfactants, colorants, flavors, adjuvants, desiccants, adsorptive carriers, and the like, in addition to the delivery system described above.

The dosage form of the medicine provided by the embodiment can be tablets, capsules, powder, granules, pills, suppositories, ointments, solutions, suspensions, lotions, gels, pastes and the like.

The medicine of the embodiment has good treatment effect on tumors and tumor-related diseases. The tumor-related diseases can be diseases generated in the process of forming/treating tumors or diseases which have certain relevance with the tumors, such as complications, sequelae and the like caused by the tumors.

The medicament of the embodiment can also be used for treating depression patients by combining with other treatment medicaments or treatment means with anti-tumor effect so as to improve the treatment effect.

For example, if the tumor is breast cancer, the tumor can be used together with paclitaxel, cyclophosphamide, fluorouracil, tamoxifen, letrozole, herceptin and other drugs; if the tumor is lung cancer, the medicine can be used together with medicines such as Iressa and Tarceva; if the tumor is gastric cancer, it can be combined with herceptin, apatinib, etc.; if the tumor is intestinal cancer, it can be used in combination with erbitux, epirubicin, adriamycin, daunorubicin, mitomycin, fluorouracil deoxynucleus, etc.; if the tumor is bladder cancer, the tumor can be used together with epirubicin, adriamycin, pirarubicin, mitomycin, hydroxycamptothecin, gemcitabine, BCG, interferon, interleukin-2, gemcitabine, cisplatin, paclitaxel, docetaxel and other drugs; if the tumor is ovarian cancer, it can be combined with cisplatin, carboplatin, paclitaxel, cyclophosphamide, etc. In addition, when the medicine is used for treatment, operation treatment, radiation treatment and the like can be performed at the same time so as to enhance the curative effect.

The delivery system for targeted inhibition of EGFR provided by the application is applied to anti-tumor products, has no toxic or side effect, takes effect quickly, has good curative effect and is suitable for large-scale popularization and use.

Test example 1

This test example set up siR^ETest group, GE11-SiR^ETest group and scrR test group. The three test groups described above will express the gene loop (siR) of siRNA separately^E、GE11-siR^EAnd scrR) the same number of normal mice were injected tail vein at a dose of 10 mg/kg.

After 1, 3, 6, 9, 12, 24 and 48 hours of injection, one mouse was randomly selected from each group, and serum thereof was taken to detect the expression level of siRNA, and the results are shown in fig. 3A. As can be seen in FIG. 3A, the siR^ETest group, GE11-SiR^EExperimental and scrR experimental mice injected with siR^E、GE11-siR^EAnd after scrR, there was no significant difference in serum siRNA expression.

At 9 hours after injection, one mouse was randomly selected from each group and sacrificed, and the lung tissue of the mice was taken to detect the siRNA level and the junctionAs shown in fig. 3B. As can be seen in FIG. 3B, no relevant siRNA, GE11-siR, was detected in lung tissue of the scrR test group mice^EThe expression quantity of siRNA in lung tissues of the mice in the test group is far higher than that of SiR^ETest group.

The above results indicate that the injection of a gene loop (siR) capable of expressing siRNA into mice^E、GE11-siR^EAnd scrR), siRNA could be detected in the mouse serum and mainly in exosome-encapsulated form, with peak serum siRNA concentrations 9 hours after injection. And a gene loop with a GE11 targeting element (GE 11-siR)^E) And the siRNA expression level of the lung tissue of the mouse can be obviously increased.

Test example 2

To further confirm the therapeutic efficacy of the delivery system targeting the inhibition of EGFR in vivo, we utilized B6/JGpt-H11^{em1Cin(CAG-LSL-EGFR-(Exon19 del))}The transgenic lung cancer mouse model of/Gpt was used as an experimental subject (30 days after DOX induction, lung spontaneously develops tumor), and GE11-siR was confirmed^ETherapeutic effect of the delivery system on lung tumors.

We randomly divided the mice successfully modeled into 4 groups-PBS group, scrR group, siR group^EGroup, GE11-siR^EGroups, PBS control plasmid, scrR plasmid, siR were injected at a dose of 10mg/kg, respectively^EPlasmid, GE11-siR^EThe plasmid is used for treatment. The medicine is administered once every two days for 10 times, and the treatment period is 20 days. Before and after treatment, lung tumor change conditions are detected by using a CT imaging mode, and the survival condition of the mouse is counted.

As shown in FIG. 4, FIG. 4A is a CT contrast chart of the lung tumor of the mouse before and after the treatment, and FIG. 4B is a contrast chart of the lung tumor volume change of the mouse before and after the treatment (in FIG. 4B, "pre" indicates before the treatment, and "post" indicates after the treatment). The results show that GE11-siR was injected before and after treatment^EThe tumor volume of the lung of the plasmid mouse is obviously reduced, and the siR is injected^EThe lung tumor volume of the plasmid mice grew slowly, while the tumor volume of the PBS and scrR groups of mice increased significantly.

Lung tissue from four mice after treatment was HE stained, IHC-EGFR/pAKT/pERK andthe results of protein expression analysis are shown in FIG. 5. FIG. 5A is a graph comparing the results of HE staining in four groups of mice, and GE11-siR can be seen^EThe best lung tissue was obtained in the group mice. FIGS. 5B and 5C are comparative graphs of the detection and statistical analysis of the expression level of the EGFR protein in mice, and it can be seen that the expression level of the EGFR protein is highest in the mice of the PBS group and the mice of the scrR group, followed by the sirs^EGroup, mice of this group, having lower levels of EGFR protein expression, GE11-siR^EThe group mice expressed the lowest level of EGFR protein, comparable to normal mice. FIG. 5D shows the immunohistochemical results of EGFR, phosphorylated AKT, and phosphorylated ERK in four groups of mice, except GE11-siR^EThe best is the case of the group mice. The above results further confirmed GE11-siR^EGood treatment effect of the treatment group.

Test example 3

In this test example, the exosome siR after PKH26 staining was separately prepared^E、GE11-siR^EInjecting the mixture into wild mice and EGFR over-expression mice, taking lung tissues of the mice to carry out frozen sections, and detecting fluorescent signals. The results are shown in FIG. 6, and it can be seen from FIG. 6 that the GE11 modified exosome GE11-siR^ERelative to exosome siR without added targeting element^EIn other words, it can be more efficiently delivered to lung tissues with high EGFR expression.

Test example 4

This experimental example investigated the GE11-siRE plasmid pair B6/JGpt-H11^{em1Cin(CAG-LSL-EGFR(T790M L858R))}The treatment effect of a/G pt transgenic lung cancer mouse model (after 60 days of DOX induction, lung spontaneously generates tumor) is verified, and GE11-siR^ETherapeutic efficacy of the delivery system against lung cancer in drug-resistant mutant mice.

After the success of the modeling of the transgenic mice is verified by CT imaging, the mice are randomly divided into 4 groups, namely PBS group, scrR group and siR group^EGroup, GE11-siR^EGroups, PBS, scrR and GE11-siR were injected at a dose of 10mg/kg^EDelivery systems (plasmids). The drug is taken once every two days for 20 days, the change condition of the lung tumor is detected by using a CT imaging mode before and after treatment, and the survival condition of the mouse is counted.

As shown in FIG. 7, FIG. 7A isCT contrast of tumor in mouse lung before and after treatment, and FIG. 7B is contrast of change in tumor volume in mouse lung before and after treatment (in FIG. 7B, "pre" means before treatment and "post" means after treatment). The results show that GE11-siR was injected before and after treatment^EThe tumor volume of the lung of the plasmid mouse is obviously reduced, and the siR is injected^EBoth the plasmid and the scrR plasmid showed a partial increase in lung tumor volume in mice, whereas the PBS group showed a significant increase in tumor volume in mice.

To test the safety of this treatment, the PBS group, the siR, were tested^EGroup, GE11-siR^EThe serum levels of glutamic-pyruvic transaminase, glutamic-oxalacetic transaminase, total bilirubin, urea, alkaline phosphatase, creatinine and other biochemical indexes of the group of mice are detected. The results are shown in FIG. 8, in which FIG. 8A is a graph comparing the serum contents of alanine transaminase (ALT), aspartate transaminase (AST), Total Bilirubin (TBIL), total urea nitrogen (BUN), serum alkaline phosphatase (ALP) and Creatinine (CREA) in mice of each group, and siR is injected^E、GE11-siR^EThe above indexes of the plasmid molecule mouse have no obvious difference with the control group; FIG. 8B is a staining chart of the tissue structure of each group of mice. As can be seen, the section of liver, lung, kidney and spleen of the mouse shows that siR is injected into tail vein^E、GE11-siR^EThe plasmid can not cause tissue damage, and is a safe administration mode.

In this document, "upper", "lower", "front", "rear", "left", "right", and the like are used only to indicate relative positional relationships between relevant portions, and do not limit absolute positions of the relevant portions.

In this document, "first", "second", and the like are used only for distinguishing one from another, and do not indicate the degree and order of importance, the premise that each other exists, and the like.

In this context, "equal", "same", etc. are not strictly mathematical and/or geometric limitations, but also include tolerances as would be understood by a person skilled in the art and allowed for manufacturing or use, etc.

Unless otherwise indicated, numerical ranges herein include not only the entire range within its two endpoints, but also several sub-ranges subsumed therein.

The preferred embodiments and examples of the present application have been described in detail with reference to the accompanying drawings, but the present application is not limited to the embodiments and examples described above, and various changes can be made within the knowledge of those skilled in the art without departing from the concept of the present application.

SEQUENCE LISTING

<110> Nanjing university institute of artificial intelligence biomedical technology

<120> delivery system for targeted inhibition of EGFR and application thereof

<160> 1

<170> PatentIn version 3.5

<210> 1

<211> 1305

<212> DNA

<213> Artificial sequence

<400> 1

atgtgcctct ctccggttaa aggcgcaaag ctcatcctga tctttctgtt cctaggagcc 60

gttcagtcca atgcattgat agttaatttg acagattcaa agggtacttg cctttatgct 120

cgataccact ggtacggcta taccccccag aacgtgatct ccggaggtgc agaatgggag 180

atgaatttca caataacata tgaaactaca aaccaaacca ataaaactat aaccattgca 240

gtacctgaca aggcgacaca cgatggaagc agttgtgggg atgaccggaa tagtgccaaa 300

ataatgatac aatttggatt cgctgtctct tgggctgtga attttaccaa ggaagcatct 360

cattattcaa ttcatgacat cgtgctttcc tacaacacta gtgatagcac agtatttcct 420

ggtgctgtag ctaaaggagt tcatactgtt aaaaatcctg agaatttcaa agttccattg 480

gatgtcatct ttaagtgcaa tagtgtttta acttacaacc tgactcctgt cgttcagaaa 540

tattggggta ttcacctgca agcttttgtc caaaatggta cagtgagtaa aaatgaacaa 600

gtgtgtgaag aagaccaaac tcccaccact gtggcaccca tcattcacac cactgccccg 660

tcgactacaa ctacactcac tccaacttca acacccactc caactccaac tccaactcca 720

accgttggaa actacagcat tagaaatggc aatactacct gtctgctggc taccatgggg 780

ctgcagctga acatcactga ggagaaggtg cctttcattt ttaacatcaa ccctgccaca 840

accaacttca ccggcagctg tcaacctcaa agtgctcaac ttaggctgaa caacagccaa 900

attaagtatc ttgactttat ctttgctgtg aaaaatgaaa aacggttcta tctgaaggaa 960

gtgaatgtct acatgtattt ggctaatggc tcagctttca acatttccaa caagaacctt 1020

agcttctggg atgcccctct gggaagttct tatatgtgca acaaagagca ggtgctttct 1080

gtgtctagag cgtttcagat caacaccttt aacctaaagg tgcaaccttt taatgtgaca 1140

aaaggacagt attctacagc ccaggagtgt tcgctggatg atgacaccat tctaatacca 1200

attatagttg gtgctggtct ttcaggcttg attatcgtta tagtgattgc ttacctaatt 1260

ggcagaagaa agacctatgc tggatatcag actctgtaac actaa 1305

Claims

1. A delivery system for targeted inhibition of EGFR, comprising: RNA and delivery vectors capable of inhibiting EGFR gene expression;

the delivery vector carrying the RNA capable of inhibiting the expression of the EGFR gene and the targeting element are self-assembled in organ tissues of mammals to form a composite structure, and the composite structure is searched by the targeting element and sends the RNA capable of inhibiting the expression of the EGFR gene into target tissues to inhibit the expression of the EGFR in the target tissues.

2. The EGFR-targeted inhibition delivery system according to claim 1, wherein the RNA capable of inhibiting EGFR gene expression comprises: a promoter element, and at least one of siRNA and encoding siRNA capable of inhibiting EGFR gene expression.

3. The delivery system for targeted inhibition of EGFR according to claim 2, wherein the nucleotide sequence of the siRNA capable of inhibiting the expression of EGFR gene is:

5’-TGTTGCTTCTGTTAATTCCT-3’；

4. the EGFR-targeted inhibition delivery system according to claim 1, wherein the complex structure is an exosome.

5. The EGFR-targeted inhibition delivery system according to claim 1, wherein the targeting element comprises one, two or more targeting sequences.

6. The EGFR-targeting inhibition delivery system according to claim 5,

if the targeting element comprises a targeting sequence, the targeting sequence is selected from the group consisting of the GE11 sequences;

if the targeting element includes two targeting sequences, the targeting sequences are selected from the group consisting of the GE11 sequence and the targeted PTP1B siRNA coding sequence.

7. The EGFR-targeting delivery system according to claim 6, wherein the targeting PTP1B siRNA coding sequence is selected from the group consisting of SEQ ID NO: 1.

8. the EGFR-targeting inhibition delivery system according to claim 1, wherein the delivery vector is a plasmid vector or a viral vector.

9. The delivery system for targeted inhibition of EGFR according to claim 8, wherein the viral vector comprises at least one of a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno-associated viral vector.

10. Use of the delivery system of any one of claims 1 to 9 for targeted EGFR inhibition in the preparation of an anti-tumor product.

11. Use according to claim 10, wherein the anti-tumor product comprises an agent inhibiting cancer cells or preventing the expression of the EGFR gene, a medicament having a preventive and/or therapeutic effect on tumors.

12. The use of claim 11, wherein the tumor comprises at least one of breast cancer, lung cancer, stomach cancer, intestinal cancer, bladder cancer, and ovarian cancer.