CN114681428B

CN114681428B - Delivery system for targeted inhibition of EGFR (epidermal growth factor receptor) and application thereof

Info

Publication number: CN114681428B
Application number: CN202011637605.3A
Authority: CN
Inventors: 陈熹; 张辰宇; 付正; 郭宏源; 苏媛媛
Original assignee: Institute Of Artificial Intelligence Biomedical Technology Nanjing University
Current assignee: Institute Of Artificial Intelligence Biomedical Technology Nanjing University
Priority date: 2020-12-31
Filing date: 2020-12-31
Publication date: 2024-03-12
Anticipated expiration: 2040-12-31
Also published as: CN114681428A

Abstract

The application provides a delivery system for targeted inhibition of EGFR and application thereof. Wherein the delivery system comprises: the EGFR gene expression inhibition kit comprises RNA capable of inhibiting EGFR gene expression, a targeting element and a delivery vector, wherein the delivery vector carrying the RNA capable of inhibiting EGFR gene expression and the targeting element are self-assembled in organ tissues of mammals to form a composite structure, and the composite structure searches and sends required delivery RNA into target tissues through the targeting element to inhibit EGFR expression in the target tissues. The delivery system for targeted inhibition of EGFR can accurately treat specific diseases, and has good treatment effect and high efficiency.

Description

Delivery system for targeted inhibition of EGFR (epidermal growth factor receptor) and application thereof

Technical Field

The application relates to the technical field of biomedicine, in particular to a delivery system for targeted inhibition of EGFR and application thereof.

Background

Lung cancer is one of the most serious malignant tumors with highest morbidity and mortality and greatest threat to human health and life. In recent 50 years, many countries report that the incidence and death rate of lung cancer are obviously increased, the incidence and death rate of lung cancer in men are the first place of all malignant tumors, the incidence rate in women is the second place, and the death rate is the second place. The development of specific targeted drugs for lung cancer has great significance for clinical treatment.

The Epidermal Growth Factor Receptor (EGFR) is an expression product of a proto-oncogene C-erbB-1, is a transmembrane protein, and is a 1 st member of the epidermal growth factor receptor family. Mutations in the EGFR protein are closely related to about 50% of intermediate and late stage non-small cell lung cancers, and are a lung cancer treatment target with a very good application prospect. At present, the clinical medicines aiming at EGFR mutant lung cancer are all Tyrosine Kinase Inhibitors (TKI), the action mode of the medicines takes protein as a target point, and the EGFR mutant lung cancer cannot be thoroughly cured due to the secondary drug resistance problem in the clinical treatment.

Currently, the selection of "personalized therapies" for molecular targeted drugs based on the genotype of lung cancer has become a common therapeutic approach in clinic. How to improve the curative effect on mutant genes and reduce toxic and side effects is also a main direction of lung cancer treatment research. Along with the deep research, the development and application of novel targeted drugs are endless, but most EGFR-TKI treatment-effective lung cancer patients can show EGFR-TKI treatment resistance after 9-14 months. Although some researches indicate that a combined treatment means (such as afatinib combined trastuzumab (Cetuxumab)) can achieve a treatment effect on the drug-resistant NSCLC, the drug-resistant NSCLC cannot be fundamentally solved, and the drug-resistant NSCLC has very obvious side effects, so that the clinical application potential of the drug-resistant NSCLC is greatly limited, and the drug-resistant NSCLC becomes a problem to be solved urgently.

Disclosure of Invention

In view of the foregoing, embodiments of the present application provide a delivery system for targeted inhibition of EGFR and application thereof, so as to solve the technical drawbacks in the prior art.

One of the inventive aspects of the present application is to provide a delivery system targeted to inhibit EGFR, the delivery system comprising: RNA and delivery vectors capable of inhibiting EGFR gene expression;

the delivery vector carrying the RNA capable of inhibiting EGFR gene expression is self-assembled with a targeting element in mammalian organ tissue to form a composite structure, and the composite structure searches for and sends the RNA capable of inhibiting EGFR gene expression into target tissue through the targeting element to inhibit EGFR expression in the target tissue.

Further, the RNA capable of inhibiting EGFR gene expression comprises: a promoter element, and at least one of an siRNA capable of inhibiting EGFR gene expression, and an encoded siRNA.

Further, the nucleotide sequence of the siRNA capable of inhibiting EGFR gene expression is as follows:

5’-TGTTGCTTCTGTTAATTCCT-3’；

the nucleotide sequence of the encoding siRNA sense strand capable of inhibiting EGFR gene expression is as follows:

5’-GGATCCTGGAGGCTTGCTGAAGGCTGTATGCTGAATTCTGTTGCTTCTCTTAATTCCTGTTTTGGCCACTGACTGACAGGAATTAAGAAGCAACAACCGGTCAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCAGATCTGGCCGCACTCGAG-3’；

the nucleotide sequence of the encoded siRNA antisense strand capable of inhibiting EGFR gene expression is as follows:

5’-CTCGAGTGCGGCCAGATCTGGGCCATTTGTTCCATGTGAGTGCTAGTAACAGGCCTTGTGTCCTGACCGGTTGTTGCTTCTTAATTCCTGTCAGTCAGTGGCCAAAACAGGAATTAAGAGAAGCAACAGAATTCAGCATACAGCCTTCAGCAAGCCTCCAGGATCC-3’。

further, the composite structure is an exosome.

Further, the targeting element comprises one, two or more targeting sequences.

Further, if the targeting element comprises a targeting sequence, the targeting sequence is selected from the group consisting of GE11 sequences;

if the targeting element comprises two targeting sequences, the targeting sequences are selected from the group consisting of a GE11 sequence and a combination of targeting PTP1B siRNA encoding sequences.

Further, the targeting PTP1B siRNA coding sequence is selected from the group consisting of SEQ ID NO:1.

further, the delivery vector is selected from the group consisting of a plasmid vector and a viral vector.

Further, the viral vector includes at least one of a retrovirus vector, a lentiviral vector, an adenovirus vector, and an adeno-associated virus vector.

Another object of the present application is to provide a use of the EGFR-targeted inhibition delivery system of any of the preceding paragraphs for the preparation of an anti-tumor product.

Further, the anti-tumor product comprises an agent for inhibiting cancer cells or preventing EGFR gene expression, and a drug having a preventive and/or therapeutic effect on tumors.

Further, the tumor comprises at least one of breast cancer, lung cancer, gastric cancer, intestinal cancer, bladder cancer and ovarian cancer.

The technical effect of this application is:

the delivery system for targeted EGFR inhibition comprises RNA capable of inhibiting EGFR gene expression and a delivery carrier, wherein the delivery carrier carries the RNA capable of inhibiting EGFR gene expression and a targeting element are self-assembled in organ tissues of mammals to form a composite structure, and the composite structure searches and sends the RNA capable of inhibiting EGFR gene expression into target tissues through the targeting element to inhibit EGFR expression in the target tissues.

The delivery system is based on a synthetic biological element, utilizes a mammalian self organ as a natural bioreactor, self-assembles a targeting element and RNA capable of inhibiting EGFR gene expression into a composite structure capable of targeted treatment of EGFR mutant diseases in a mammalian body and excretes the composite structure into a circulatory system, and the composite structure directionally transports the RNA into cells requiring treatment such as tumor cells under the action of the targeting element, thereby exerting the treatment effect, having high treatment efficiency and good effect, and particularly having excellent treatment effect on EGFR mutant lung cancer.

The EGFR-targeted delivery system provided herein relies on naturally occurring secretion mechanisms, thus avoiding toxicity from the use of other vectors. The targeting element can efficiently deliver RNA to the tissue to be treated, and has high delivery efficiency and almost no side reaction.

The EGFR-targeted inhibition delivery system provided by the application is established based on a plasmid vector, is easy for industrial production and mass purification, and greatly reduces the production difficulty and the production cost compared with other siRNA delivery modes.

The EGFR targeted inhibition delivery system provided by the application is applied to anti-tumor products, has no toxic or side effect, quick response and good curative effect, and is suitable for large-scale popularization and use. In addition, the targeting element and the targeting gene can be adjusted according to the treatment requirements of different diseases so as to provide personalized treatment for different diseases.

Drawings

FIG. 1 is a diagram of a plasmid backbone provided in an embodiment of the present application;

FIG. 2 is a graph showing comparison of the expression levels of related RNAs and proteins provided in one embodiment of the present application;

FIG. 3 is a metabolic profile of siRNA in mice provided in one embodiment of the present application;

FIG. 4 is a graph comparing therapeutic effects of different delivery systems provided in an embodiment of the present application on a mouse lung cancer model;

FIG. 5 is a graph showing the pathological analysis of mouse lung tissue and the detection of protein expression level according to one embodiment of the present application;

FIG. 6 is a trace of the in vitro and in vivo secretion of a mouse according to one embodiment of the present application;

FIG. 7 is a graph comparing therapeutic effects of different delivery systems provided in an embodiment of the present application on a mouse lung cancer model;

fig. 8 is a comparison of drug delivery safety profile provided in one embodiment of the present application.

Detailed Description

The following describes specific embodiments of the present application with reference to the drawings.

In the present invention, unless otherwise indicated, scientific and technical terms used herein have the meanings commonly understood by one of ordinary skill in the art. Also, reagents, materials, and procedures used herein are reagents, materials, and conventional procedures widely used in the corresponding field.

Example 1

The present embodiment provides a delivery system for targeted inhibition of EGFR, the delivery system comprising: RNA and delivery vectors capable of inhibiting EGFR gene expression.

The delivery vector carrying the RNA capable of inhibiting EGFR gene expression is self-assembled with a targeting element in mammalian organ tissue to form a composite structure, which is searched by the targeting element and delivers the desired delivery RNA (the RNA capable of inhibiting EGFR gene expression) into the target tissue, inhibiting EGFR expression in the target tissue.

Specifically, the delivery vehicle carries an RNA capable of inhibiting EGFR gene expression and is capable of being enriched in mammalian organ tissue in which a complex structure containing the above-described RNA and a targeting element is spontaneously formed endogenously, and the complex structure searches for and binds to a target tissue through the targeting element, and feeds the desired delivery RNA into the target tissue, thereby inhibiting EGFR expression.

Wherein the complex structure is preferably an exosome, and the target tissue is preferably an EGFR mutated/EGFR-expressing cancer cell.

The RNA capable of inhibiting EGFR gene expression comprises a promoter element and at least one of siRNA and encoding siRNA capable of inhibiting EGFR gene expression. For example, the RNA may be a promoter element+an siRNA capable of inhibiting EGFR gene expression, or a promoter element+an siRNA encoding EGFR gene expression.

Wherein, the nucleotide sequence of the siRNA capable of inhibiting EGFR gene expression is preferably:

5’-TGTTGCTTCTGTTAATTCCT-3’。

the siRNA/encoded siRNA can be specifically combined with EGFR mRNA and degrade the EGFR mRNA, so that the EGFR mRNA expression is inhibited.

The targeting element may comprise one, two or more targeting sequences. If the targeting element comprises a targeting sequence, the targeting sequence is preferably a GE11 sequence; if the targeting element comprises two targeting sequences, the targeting sequence is preferably a combination of the GE11 sequence and the targeting PTP1B siRNA encoding sequence. The targeted PTP1B siRNA has a coding sequence shown in SEQ ID NO:1.

The delivery vector is selected from the group consisting of a plasmid vector and a viral vector. Wherein the viral vector comprises at least one of a retroviral vector, a lentiviral vector, an adenoviral vector, and an adeno-associated viral vector.

The delivery vector is preferably a plasmid vector, in which case the delivery system described above can be regarded as a plasmid molecule.

Specifically, the plasmid carries an siRNA capable of inhibiting EGFR gene expression, and the plasmid molecule is capable of enriching in mammalian organ tissues and spontaneously forming, endogenously in said mammalian organ tissues, exosomes with the targeting element GE11 or ge11+ encoding PTP1B siRNA, which deliver the siRNA into cells undergoing EGFR mutation via the targeting element GE11 or ge11+ encoding PTP1B siRNA, thereby inhibiting EGFR expression.

The delivery system formed based on the plasmid vector is easier for large-scale industrialized production and purification, and compared with other siRNA delivery systems, the production difficulty and the production cost are greatly reduced.

In practical application, we construct delivery systems (plasmid molecules) for EGFR gene, and connect promoter elements in series with siRNA capable of inhibiting EGFR gene expression to construct siR ^E And respectively connected with a framework carrier, the GE11-SiR ^E The plasmid backbone structure is shown in FIG. 1.

Plasmids of different interference sequences were constructed according to the method shown in FIG. 1, plasmid molecules were transfected into human embryonic kidney cell 293T cell lines, and mRNA and protein expression levels of EGFR genes in the cells were detected by qRT-PCR and Western blotting experiments after 36 hours. Here we set up Mock control, NC control, siR ^E Test group and GE11-SiR ^E Test groups and the results are shown in FIG. 2.

FIG. 2A is a graph showing the comparison of the expression levels of four groups of EGFR siRNA, and it can be seen from FIG. 2A that the Mock control group and the NC control group do not detect the expression of EGFR siRNA, whereas in the other two groups, GE11-SiR ^E The relevant EGFR siRNA expression level of the test group is higher than that of SiR ^E Test group.

FIG. 2BFor comparison of four sets of related GE11 mRNA expression levels, the Mock control, NC control and SiR can be seen in FIG. 2B ^E None of the test groups detected the expression of the related GE11 mRNA, only GE11-SiR ^E The test group had GE11 mRNA and the expression level of the GE11 targeting peptide was higher.

Fig. 2C is a comparison of four sets of related EGFR mRNA expression levels, the ordering of which can be seen in fig. 2C is: NC control group > Mock control group > SiR ^E Test group > GE11-SiR ^E Test group.

FIG. 2D is a western blot diagram showing expression levels of four groups of EGFR proteins, the ordering of which can be seen in FIG. 2D as: mock control > NC control > SiR ^E Test group > GE11-SiR ^E Test group.

As can be seen, the results of fig. 2 demonstrate that the EGFR-targeted delivery system provided herein is capable of effectively inhibiting EGFR gene expression in cell lines.

Therefore, the delivery system for targeted EGFR inhibition provided in this embodiment uses the self organ of mammal as natural bioreactor based on the synthetic biological element, self-assembles the targeted element and the RNA capable of inhibiting EGFR gene expression in the mammal to be exosomes capable of targeted treatment of EGFR mutant diseases and excreted to the circulatory system, and the exosomes directionally transport the RNA to the cells waiting for treatment of tumor cells under the action of the targeted element, thereby achieving the therapeutic effect, good therapeutic effect and high efficiency.

Especially for EGFR mutant lung cancer, the delivery system can accurately and rapidly target and transport related RNA into cancer cells, inhibit EGFR expression in the cancer cells, and further has an effect of inhibiting tumors, and has an excellent effect.

Example 2

Based on example 1, this example provides an application of a delivery system for targeted inhibition of EGFR in the preparation of anti-tumor products.

The medicament of this embodiment may further include a pharmaceutically acceptable carrier, including but not limited to diluents, buffers, emulsions, encapsulants, excipients, fillers, binders, sprays, transdermal absorbents, humectants, disintegrants, absorption promoters, surfactants, colorants, flavoring agents, adjuvants, desiccants, adsorption carriers, and the like, in addition to the above-described delivery system.

The dosage form of the medicine provided by the embodiment can be tablets, capsules, powder, granules, pills, suppositories, ointments, solutions, suspensions, lotions, gels, pastes and the like.

The medicine of the embodiment has good treatment effect on tumor and tumor related diseases. The tumor-associated disease may be a disease generated during the course of tumor formation/treatment or a disease having a certain correlation with tumor such as complications and sequelae caused by tumor.

The medicine of the embodiment can also be used in combination with other therapeutic medicines or therapeutic means with anti-tumor effect to treat patients with depression so as to improve the therapeutic effect.

For example, if the tumor is breast cancer, the tumor can be combined with medicines such as paclitaxel, cyclophosphamide, fluorouracil, tamoxifen, letrozole, herceptin and the like; if the tumor is lung cancer, the medicine can be combined with medicines such as easy ruisha, taroki and the like; if the tumor is gastric cancer, the medicine can be combined with medicines such as herceptin, apatinib and the like; if the tumor is intestinal cancer, the medicine can be combined with medicines such as erbitux, epirubicin, doxorubicin, daunorubicin, mitomycin, fluorouracil deoxynucleus and the like; if the tumor is bladder cancer, it can be combined with medicines such as epirubicin, doxorubicin, pirarubicin, mitomycin, hydroxycamptothecin, gemcitabine, BCG vaccine, interferon, interleukin-2, gemcitabine, cisplatin, paclitaxel, docetaxel, etc.; if the tumor is ovarian cancer, it can be combined with cisplatin, carboplatin, paclitaxel, cyclophosphamide, etc. In addition, the medical treatment can be used, and meanwhile, surgical treatment, radiation treatment and the like can be performed simultaneously, so that the curative effect is enhanced.

The EGFR targeted inhibition delivery system provided by the application is applied to anti-tumor products, has no toxic or side effect, quick response and good curative effect, and is suitable for large-scale popularization and use.

Test example 1

The test example sets SiR ^E Test group, GE11-SiR ^E Test group and scrR test group. The three test groups described above each expressed the gene loops (siR ^E 、GE11-siR ^E And scrR) tail vein injection was performed on the same number of normal mice at a dose of 10 mg/kg.

One mouse was randomly selected from each group after 1, 3, 6, 9, 12, 24, 48 hours of injection, and serum thereof was taken to measure the expression level of siRNA, and the results are shown in FIG. 3A. As can be seen in FIG. 3A, siR ^E Test group, GE11-SiR ^E Mice of the test group and the scrR test group were injected with siR ^E 、GE11-siR ^E And scrR, there was no significant difference in serum siRNA expression.

One mouse was randomly selected from each group to be sacrificed 9 hours after injection, and the lung tissue of the mouse was taken to detect the siRNA level, and the results are shown in fig. 3B. As can be seen from FIG. 3B, no relevant siRNA, GE11-siR, was detected in lung tissue of mice in the scrR test group ^E The expression level of siRNA in lung tissue of mice in test group is far higher than that of SiR ^E Test group.

The above results indicate that, in vivo injection of a gene loop (siR) capable of expressing siRNA into mice ^E 、GE11-siR ^E And scrR), the siRNA can be detected in the serum of the mice and exists mainly in the form of exosome encapsulation, and the serum siRNA concentration peaks 9 hours after injection. And the gene loop to which the GE11 targeting element was added (GE 11-siR) ^E ) Can obviously raise the expression level of siRNA in lung tissue of mouse.

Test example 2

To further confirm the therapeutic effect of EGFR-targeted delivery systems in vivo, we utilized B6/JGpt-H11 ^{em1Cin(CAG-LSL-EGFR-(Exon19 del))} /Gpt rotationGene lung cancer mouse model as the experimental object (lung spontaneously generated tumor after 30 days DOX induction), confirmation of GE11-SiR ^E Therapeutic effects of delivery systems on lung tumors.

We randomly divided the successfully modeled mice into 4 groups-PBS, scrR, and siR ^E Group, GE 11-sR ^E Group, PBS control plasmid, scrR plasmid, and siR were injected at a dose of 10mg/kg, respectively ^E Plasmid, GE 11-sR ^E Plasmid treatment. Once every two days, the total treatment is 10 times for 20 days. And detecting the lung tumor change condition by using a CT imaging mode before and after treatment, and counting the survival condition of the mice.

As shown in fig. 4, fig. 4A is a comparative CT image of lung tumor of mice before and after treatment, and fig. 4B is a comparative CT image of lung tumor volume change of mice before and after treatment (in fig. 4B, "pre" indicates before treatment and "post" indicates after treatment). The results show that GE11-SiR injection was performed before and after treatment ^E Mouse lung tumor volume of plasmid is obviously reduced, and SiR is injected ^E The tumor volume of mice on the plasmid increased slowly, while the tumor volumes of both PBS and scrR mice increased significantly.

The lung tissues of the four groups of mice after treatment were subjected to HE staining, IHC-EGFR/pAKT/pERK, and protein expression level analysis and detection, and the results are shown in FIG. 5. FIG. 5A is a graph showing comparison of HE staining results of four groups of mice, and can be seen as GE11-SiR ^E Group mice had the best lung tissue. FIGS. 5B and 5C are graphs comparing the detection and statistical analysis of EGFR protein expression levels in mice, and it can be seen that EGFR protein expression levels are highest in PBS group mice and scrR group mice, followed by siR ^E Group of mice having lower EGFR protein expression levels, GE11-SiR ^E The group mice had the lowest EGFR protein expression level, comparable to normal mice. FIG. 5D shows the results of immunohistochemistry for EGFR, phosphorylated AKT, phosphorylated ERK in four groups of mice, showing that GE11-SiR alone ^E The group mice are best. The above results further demonstrate that GE11-siR ^E Good therapeutic effect in the treatment group.

Test example 3

In this test example, PKH 26-stained exosomes SiR were used separately ^E 、GE11-siR ^E Injecting into wild mice and mice with EGFR over-expression, taking lung tissues of the mice for frozen section, and detecting fluorescent signals. As a result, as shown in FIG. 6, it can be seen from FIG. 6 that GE11 modified exosomes GE11-siR ^E Relative to exosomes siR without added targeting element ^E In other words, the EGFR-expressing lung tissue can be transmitted to the EGFR-expressing lung tissue more efficiently.

Test example 4

This test example investigated the GE11-siRE plasmid pair B6/JGpt-H11 ^{em1Cin(CAG-LSL-EGFR(T790M L858R))} Therapeutic effect of Gpt transgenic mice model for lung cancer (lung spontaneously developed tumor after 60 days of DOX induction), and verification of GE11-SiR ^E Therapeutic effects of delivery systems on drug resistant mutant mouse lung cancer.

After CT imaging is utilized to verify that the transgenic mice are successfully modeled, the mice are randomly divided into 4 groups, namely PBS group, scrR group and siR group ^E Group, GE 11-sR ^E Groups, PBS, scrR and GE11-siR were injected at a dose of 10mg/kg, respectively ^E Delivery system (plasmid). Once every two days, the medicine is treated for 20 days, the lung tumor change condition is detected by using a CT imaging mode before and after treatment, and the survival condition of the mice is counted.

As shown in fig. 7, fig. 7A is a comparative CT image of lung tumor of mice before and after treatment, and fig. 7B is a comparative CT image of lung tumor volume change of mice before and after treatment (in fig. 7B, "pre" indicates before treatment and "post" indicates after treatment). The results show that GE11-SiR injection was performed before and after treatment ^E Mouse lung tumor volume of plasmid is obviously reduced, and SiR is injected ^E The lung tumor volume of mice with both plasmid and scrR plasmid increased partially, while the tumor volume of mice in PBS group increased significantly.

To test the safety of the treatment, PBS group and SiR group ^E Group, GE 11-sR ^E And detecting the level of biochemical indexes such as glutamic pyruvic transaminase, glutamic oxaloacetic transaminase, total bilirubin, urea, alkaline phosphatase, creatinine and the like in serum of the mice in the group. As a result, FIG. 8A shows glutamic pyruvic transaminase (ALT), glutamic oxaloacetic transaminase (AST), total Bilirubin (TBIL), total urea nitrogen (BUN), serum alkaline phosphatase (ALP), creatinine (CR) in serum of each group of miceEA) content comparison graph, injection siR ^E 、GE11-siR ^E Mice with plasmid molecules have no obvious differences between the above indexes and the control group; FIG. 8B is a chart of histological staining of mice in each group. As can be seen, sections of the liver, lung, kidney, spleen of mice indicate that the tail vein was injected with SiR ^E 、GE11-siR ^E The plasmid does not cause tissue damage and is a safe administration mode.

In this document, "upper", "lower", "front", "rear", "left", "right", and the like are used merely to indicate relative positional relationships between the relevant portions, and do not limit the absolute positions of the relevant portions.

Herein, "first", "second", etc. are used only for distinguishing one another, and do not denote any order or importance, but rather denote a prerequisite of presence.

Herein, "equal," "same," etc. are not strictly mathematical and/or geometric limitations, but also include deviations that may be appreciated by those skilled in the art and allowed by fabrication or use, etc.

Unless otherwise indicated, numerical ranges herein include not only the entire range within both of its endpoints, but also the several sub-ranges contained therein.

The preferred embodiments and examples of the present application have been described in detail with reference to the accompanying drawings, but the present application is not limited to the embodiments and examples described above, and various changes may be made within the knowledge of those skilled in the art without departing from the spirit of the present application.

SEQUENCE LISTING

<110> university of Nanjing institute of artificial intelligence biological medicine technology

<120> a delivery system for targeted inhibition of EGFR and uses thereof

<160> 1

<170> PatentIn version 3.5

<210> 1

<211> 1305

<212> DNA

<213> artificial sequence

<400> 1

atgtgcctct ctccggttaa aggcgcaaag ctcatcctga tctttctgtt cctaggagcc 60

gttcagtcca atgcattgat agttaatttg acagattcaa agggtacttg cctttatgct 120

cgataccact ggtacggcta taccccccag aacgtgatct ccggaggtgc agaatgggag 180

atgaatttca caataacata tgaaactaca aaccaaacca ataaaactat aaccattgca 240

gtacctgaca aggcgacaca cgatggaagc agttgtgggg atgaccggaa tagtgccaaa 300

ataatgatac aatttggatt cgctgtctct tgggctgtga attttaccaa ggaagcatct 360

cattattcaa ttcatgacat cgtgctttcc tacaacacta gtgatagcac agtatttcct 420

ggtgctgtag ctaaaggagt tcatactgtt aaaaatcctg agaatttcaa agttccattg 480

gatgtcatct ttaagtgcaa tagtgtttta acttacaacc tgactcctgt cgttcagaaa 540

tattggggta ttcacctgca agcttttgtc caaaatggta cagtgagtaa aaatgaacaa 600

gtgtgtgaag aagaccaaac tcccaccact gtggcaccca tcattcacac cactgccccg 660

tcgactacaa ctacactcac tccaacttca acacccactc caactccaac tccaactcca 720

accgttggaa actacagcat tagaaatggc aatactacct gtctgctggc taccatgggg 780

ctgcagctga acatcactga ggagaaggtg cctttcattt ttaacatcaa ccctgccaca 840

accaacttca ccggcagctg tcaacctcaa agtgctcaac ttaggctgaa caacagccaa 900

attaagtatc ttgactttat ctttgctgtg aaaaatgaaa aacggttcta tctgaaggaa 960

gtgaatgtct acatgtattt ggctaatggc tcagctttca acatttccaa caagaacctt 1020

agcttctggg atgcccctct gggaagttct tatatgtgca acaaagagca ggtgctttct 1080

gtgtctagag cgtttcagat caacaccttt aacctaaagg tgcaaccttt taatgtgaca 1140

aaaggacagt attctacagc ccaggagtgt tcgctggatg atgacaccat tctaatacca 1200

attatagttg gtgctggtct ttcaggcttg attatcgtta tagtgattgc ttacctaatt 1260

ggcagaagaa agacctatgc tggatatcag actctgtaac actaa 1305

Claims

1. A delivery system for targeted inhibition of EGFR, the delivery system comprising: RNA and delivery vectors capable of inhibiting EGFR gene expression;

self-assembling a delivery vector carrying RNA capable of inhibiting EGFR gene expression and a targeting element in organ tissues of mammals to form a composite structure, wherein the composite structure searches for and sends the RNA capable of inhibiting EGFR gene expression into target tissues through the targeting element, and inhibits EGFR expression in the target tissues;

the targeting element comprises one, two or more targeting sequences;

if the targeting element comprises a targeting sequence, the targeting sequence is selected from the group consisting of a GE11 sequence;

if the targeting element comprises two targeting sequences, the targeting sequences are selected from the group consisting of a combination of a GE11 sequence and a targeting PTP1B siRNA coding sequence;

the targeted PTP1B siRNA coding sequence is selected from SEQ ID NO:1.

2. the EGFR-targeted inhibition delivery system of claim 1, wherein the RNA capable of inhibiting EGFR gene expression comprises: a promoter element, and at least one of an siRNA capable of inhibiting EGFR gene expression, and an encoded siRNA.

3. The EGFR-targeted delivery system of claim 2, wherein the siRNA capable of inhibiting EGFR gene expression has a nucleotide sequence of:

5’-TGTTGCTTCTGTTAATTCCT-3’；

5’-GGATCCTGGAGGCTTGCTGAAGGCTGTATGCTGAATTCTGTTGCT TCTCTTAATTCCTGTTTTGGCCACTGACTGACAGGAATTAAGAAGCAACAA CCGGTCAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCC CAGATCTGGCCGCACTCGAG-3’；

5’-CTCGAGTGCGGCCAGATCTGGGCCATTTGTTCCATGTGAGTGCTA GTAACAGGCCTTGTGTCCTGACCGGTTGTTGCTTCTTAATTCCTGTCAGTC AGTGGCCAAAACAGGAATTAAGAGAAGCAACAGAATTCAGCATACAGCC TTCAGCAAGCCTCCAGGATCC-3’。

4. the EGFR-targeted inhibition delivery system of claim 1, wherein the composite structure is an exosome.

5. The EGFR-targeted inhibition delivery system of claim 1, wherein the delivery vector is a plasmid vector or a viral vector.

6. The EGFR-targeted inhibitory delivery system of claim 5, wherein the viral vector comprises at least one of a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno-associated viral vector.

7. Use of the EGFR-targeted inhibition delivery system of any one of claims 1-6 for the preparation of an anti-tumor product.

8. The use according to claim 7, wherein the anti-tumor product comprises an agent that inhibits cancer cells or prevents EGFR gene expression, a drug that has a prophylactic and/or therapeutic effect on tumors.

9. The use according to claim 8, wherein the tumor comprises at least one of breast cancer, lung cancer, stomach cancer, intestinal cancer, bladder cancer, ovarian cancer.