CN115054694B - Use of CREPT in the treatment of prostate cancer - Google Patents

Use of CREPT in the treatment of prostate cancer Download PDF

Info

Publication number
CN115054694B
CN115054694B CN202210770054.0A CN202210770054A CN115054694B CN 115054694 B CN115054694 B CN 115054694B CN 202210770054 A CN202210770054 A CN 202210770054A CN 115054694 B CN115054694 B CN 115054694B
Authority
CN
China
Prior art keywords
crept
prostate cancer
gene
expression product
expression
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202210770054.0A
Other languages
Chinese (zh)
Other versions
CN115054694A (en
Inventor
常智杰
任芳丽
王银银
马丹辉
田野
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tsinghua University
Original Assignee
Tsinghua University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tsinghua University filed Critical Tsinghua University
Publication of CN115054694A publication Critical patent/CN115054694A/en
Priority to PCT/CN2023/094835 priority Critical patent/WO2023231780A1/en
Application granted granted Critical
Publication of CN115054694B publication Critical patent/CN115054694B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5011—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing antineoplastic activity
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57434—Specifically defined cancers of prostate
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/106—Plasmid DNA for vertebrates
    • C12N2800/107—Plasmid DNA for vertebrates for mammalian
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
    • G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value
    • G01N2500/10—Screening for compounds of potential therapeutic value involving cells

Abstract

The present disclosure provides the use of CREPT in the treatment of prostate cancer. In particular, the present disclosure provides the use of a CREPT gene or its expression product as a target in the manufacture of a medicament for the treatment of prostate cancer; use of an agent that targets the CREPT gene or its expression product in the manufacture of a medicament for the treatment of prostate cancer; and the use of CREPT gene or its expression product as target in preparing medicine screening apparatus for treating prostate cancer. The present disclosure finds that CREPT can be applied to the treatment of prostate cancer, and can inhibit proliferation of prostate cancer cells, inhibit clone formation of prostate cancer, inhibit tumorigenesis of prostate cancer and inhibit tumor growth of prostate cancer by inhibiting CREPT expression, and has great significance for the treatment of prostate cancer.

Description

Use of CREPT in the treatment of prostate cancer
Technical Field
The present disclosure relates to the field of tumor treatment technology, in particular to the use of CREPT in the treatment of prostate cancer.
Background
Prostate cancer is a common disease in older men, and according to the national tumor institute and national health statistics center data, the incidence of prostate cancer has exceeded lung cancer in 2012, with male malignancy being the first place. Although the incidence of prostate cancer in China is lower, with the continuous increase of life span of people in China, the incidence of prostate cancer is in an increased situation in recent years due to the change of dietary structures and the improvement of diagnosis technologies.
For early stage prostate cancer, the tumor is less invasive and the best treatment is surgical excision when the cancerous lesion is localized within the prostate. However, early-stage prostate cancer has no obvious symptoms, has no great influence on normal life, and is not easy to be found by means such as B ultrasonic and CT.
Non-surgical treatments for prostate cancer include androgen-deprivation therapy (ADT), radiation therapy (radiation therapy, RT), ablative therapy, chemotherapy, and emerging immunotherapy. Androgen Deprivation Therapy (ADT) has been the primary treatment for advanced prostate cancer. Typically refers to the reduction of serum testosterone levels below castration levels, either by surgical or pharmacological castration, or by individual or combined use of androgen receptor (androgen receptor, AR) antagonists. However, castration-resistant prostate cancer (Castration Resistant Prostate Cancer, CRPC) patients are not sensitive to androgen deprivation therapy, and these drugs eventually develop resistance, leading to disease progression.
Citation 1 (D Lu et al CREPT accelerates tumorigenesis by regulating the transcription of cell-cycle related genes. Cancer cell.21:92-104,2012) discloses that tumor cell cycle associated proteins (CREPT) are highly expressed in prostate cancer tissue compared to paracancerous tissue, and studies have also found that CREPT interacts with AR to promote the occurrence and metastasis of prostate cancer by regulating the transcriptional activity of the AR signaling pathway.
However, the occurrence and development of prostate cancer involve complex signaling pathways or mechanisms, and knowledge of the function of a molecule on a signaling pathway cannot predict that the molecule can be applied to diagnosis and treatment of diseases. Moreover, no research has been reported to achieve the aim of treating prostate cancer by controlling CREPT.
Disclosure of Invention
Problems to be solved by the invention
Based on the above-mentioned problems of the prior art, it is an object of the present disclosure to provide the use of CREPT in the treatment of prostate cancer.
Solution for solving the problem
In some aspects of the disclosure, any one of the following (i) - (iii) is provided:
(i) Use of a CREPT gene or an expression product thereof as a target in the manufacture of a medicament for the treatment of prostate cancer;
(ii) Use of an agent that targets the CREPT gene or its expression product in the manufacture of a medicament for the treatment of prostate cancer;
(iii) The use of a CREPT gene or an expression product thereof as a target in the manufacture of a drug screening device for screening a drug for the treatment of prostate cancer.
In some embodiments, the expression product of the CREPT gene is selected from the group consisting of: cDNA, mRNA, CREPT precursor protein, mature CREPT protein, and fragments thereof.
In some embodiments, the prostate cancer comprises one or more of adenocarcinoma, ductal adenocarcinoma, urothelial carcinoma, squamous cell carcinoma, and adenosquamous carcinoma.
In some embodiments, the prostate cancer is castration-resistant prostate cancer.
In some embodiments, the treatment comprises one or more of inhibiting proliferation of prostate cancer cells, inhibiting prostate cancer clonogenic, inhibiting prostate tumorigenesis, and inhibiting prostate cancer tumor growth.
In some embodiments, the prostate cancer is prostate cancer in a subject.
In some preferred embodiments, the subject comprises a mammal.
In some more preferred embodiments, the subject is a human.
In some embodiments, the agent that targets the CREPT gene or its expression product is selected from the group consisting of: nucleic acids, polypeptides, ribonucleoprotein complexes or small molecule drugs.
In some preferred embodiments, the polypeptide is selected from an antibody or antigen binding fragment thereof.
In some preferred embodiments, the nucleic acid is selected from DNA, RNA, DNA/RNA.
In some preferred embodiments, the ribonucleoprotein complex is selected from the group consisting of CRISPR/cas systems.
In some more preferred embodiments, the agent that targets the CREPT gene or its expression product is selected from the group consisting of: antisense oligonucleotides, siRNA, dsRNA, ribozymes, esiRNA, shRNA, CRISPR/cas system, small molecule drugs.
In some embodiments, the agent that targets the CREPT gene or its expression product comprises shRNA, the sequence of which is shown as SEQ ID No. 1 or SEQ ID No. 2.
In some specific embodiments, the agent that targets the CREPT gene or its expression product comprises a CRISPR/cas system in which the sgRNA sequence is shown in SEQ ID No. 3.
In some embodiments, the agent that targets the CREPT gene or its expression product comprises a small molecule drug represented by the following formula (I),
in some specific embodiments, the screening device comprises a detection reagent for determining the level or activity of a CREPT gene or its expression product, preferably selected from the group consisting of: primers, probes, antibodies or antigen binding fragments thereof specific for the CREPT gene or its expression product.
In other aspects of the present disclosure, there is provided an agent that targets a CREPT gene or its expression product, which is capable of modulating the level or activity of the CREPT gene or its expression product, wherein: the expression product of the CREPT gene is selected from the group consisting of: cDNA, mRNA, CREPT precursor proteins, mature CREPT proteins, and fragments thereof; the agent targeting the CREPT gene or its expression product is selected from: nucleic acids, polypeptides, ribonucleoprotein complexes or small molecule drugs; preferably, the polypeptide is selected from an antibody or antigen binding fragment thereof; preferably, the nucleic acid is selected from DNA, RNA, DNA/RNA; preferably, the ribonucleoprotein complex is selected from the CRISPR/cas system; more preferably, the agent targeting the CREPT gene or its expression product is selected from the group consisting of: antisense oligonucleotides, siRNA, dsRNA, ribozymes, esiRNA, shRNA, CRISPR/cas system, small molecule drugs.
In some embodiments, the agent that targets the CREPT gene or its expression product comprises an shRNA having a sequence as shown in SEQ ID No. 1 or SEQ ID No. 2.
In some embodiments, the agent that targets the CREPT gene or its expression product comprises a CRISPR/cas system in which the sgRNA sequence is shown in SEQ ID No. 3.
In some embodiments, the agent that targets the CREPT gene or its expression product comprises a small molecule drug of formula (I),
in other aspects of the present disclosure, there is provided an expression vector that modulates the level or activity of a CREPT gene or its expression product, which encodes an agent that targets a CREPT gene or its expression product as described above.
In other aspects of the present disclosure, there is provided a pharmaceutical composition for treating prostate cancer, comprising: the above-described agent targeting the CREPT gene or an expression product thereof; and, optionally, a pharmaceutically acceptable carrier.
In other aspects of the present disclosure, there is provided a method of treating prostate cancer comprising the step of administering a therapeutically effective amount of an agent that targets the CREPT gene or its expression product described above.
In other aspects of the present disclosure, there is provided a method of screening and/or identifying a drug for treating prostate cancer comprising:
Contacting the screened material with prostate cancer cells;
detecting the expression level of CREPT genes or expression products thereof in the prostate cancer cells after the contact with the objects to be screened;
compared with the prostate cancer cells which are not contacted with the object to be screened, the expression level of the CREPT gene or the expression product thereof in the prostate cancer cells contacted with the object to be screened is obviously reduced, and the object to be screened is judged to be an effective medicament for treating the prostate cancer.
ADVANTAGEOUS EFFECTS OF INVENTION
The present disclosure finds that CREPT can be applied to the treatment of prostate cancer, and can inhibit proliferation of prostate cancer cells, inhibit clone formation of prostate cancer, inhibit tumorigenesis of prostate cancer and inhibit tumor growth of prostate cancer by inhibiting CREPT expression, and has great significance for the treatment of prostate cancer.
Drawings
FIG. 1 is a schematic representation of the promotion of proliferation of prostate cancer cells by overexpression of CREPT.
FIG. 2 is a schematic diagram of the promotion of prostate cancer cell clone formation by over-expression of CREPT, wherein A in FIG. 2 is a mirror image and B in FIG. 2 is a statistical result image.
FIG. 3 is a schematic representation of CREPT knockdown to inhibit proliferation of prostate cancer cells.
Fig. 4 is a schematic diagram of CREPT knockdown to inhibit prostate cancer cell clone formation, wherein a in fig. 4 is a scan, and B in fig. 4 is a statistical result.
Fig. 5 is a schematic diagram of the CREPT knockdown to inhibit the formation of prostate cancer cell clones, wherein a in fig. 5 is a scan, and B in fig. 5 is a statistical result.
Fig. 6 is a schematic representation of knock down CREPT inhibiting prostate tumorigenesis, wherein a in fig. 6 is a mirror image and B, C in fig. 6 is a plot of tumor weight and volume statistics, respectively.
Fig. 7 is a schematic representation of knockout of CREPT inhibiting prostate tumor growth.
FIG. 8 is a schematic representation of the knock down of CREPT to inhibit the proliferation of castration resistant prostate cancer cells.
Fig. 9 is a schematic representation of a small molecule inhibitor inhibiting proliferation of prostate cancer cells.
FIGS. 10A-10C show ICs of small molecule inhibitors to inhibit proliferation of prostate cancer cells 50 Schematic diagram, wherein: FIG. 10A is a compound of formula (I); FIG. 10B is a compound of formula (II); FIG. 10C is a compound of formula (III).
FIG. 11 is a schematic representation of the inhibition of the formation of prostate cancer cell clones by small molecule inhibitors.
Detailed Description
The following is a detailed description of the present disclosure. The following description of technical features is made based on representative embodiments and specific examples of the present disclosure, but the present disclosure is not limited to these embodiments and specific examples. It should be noted that:
In the present specification, the numerical range indicated by the term "numerical value a to numerical value B" means a range including the end point numerical value A, B.
In the present specification, the use of "substantially" or "substantially" means that the standard deviation from the theoretical model or theoretical data is within 5%, preferably 3%, more preferably 1%.
In the present specification, the meaning of "can" includes both the meaning of performing a certain process and the meaning of not performing a certain process.
In this specification, "optional" or "optionally" means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where the event occurs and instances where it does not.
Reference throughout this specification to "some specific/preferred embodiments," "other specific/preferred embodiments," "an embodiment," and so forth, means that a particular element (e.g., feature, structure, property, and/or characteristic) described in connection with the embodiment is included in at least one embodiment described herein, and may or may not be present in other embodiments. In addition, it is to be understood that the elements may be combined in any suitable manner in the various embodiments.
The terms "comprising" and "having" and any variations thereof, are intended to cover a non-exclusive inclusion. For example, a process, method, apparatus, article, or device that comprises a list of steps is not limited to the elements or modules listed but may alternatively include additional steps not listed or inherent to such process, method, article, or device.
References to "a plurality" in this disclosure refer to two or more. "and/or", describes an association relationship of an association object, and indicates that there may be three relationships, for example, a and/or B, and may indicate: a exists alone, A and B exist together, and B exists alone. The character "/" generally indicates that the context-dependent object is an "or" relationship.
In the present specification, the term "tumor" or "cancer" refers to any medical condition characterized by neoplastic or malignant cell growth, proliferation or metastasis, including solid cancers and non-solid cancers such as leukemia.
In the present specification, the term "prostate cancer" or "prostate tumor" refers to a cancer or tumor derived from prostate tissue.
In this specification, the term "subject" refers to a human (i.e., male or female of any age group, e.g., pediatric subject (e.g., infant, child, or adolescent) or adult subject (e.g., young, middle-aged, or elderly)) or a non-human animal. In certain embodiments, the non-human animal is a mammal (e.g., primate (e.g., cynomolgus monkey or rhesus monkey), a commercially relevant mammal (e.g., cow, pig, horse, sheep, goat, cat, or dog), or a bird.
The term "administering" refers to implanting, absorbing, ingesting, injecting, inhaling, or otherwise introducing a drug or agent into or onto a subject.
In this specification, the term "treatment" refers to reversing, alleviating, delaying the onset or inhibiting the progression of a disease. In some embodiments, the treatment may be administered after one or more signs or symptoms of the disease have progressed or have been observed. In other embodiments, the treatment may be administered without signs or symptoms of the disease. For example, a treatment may be administered to a susceptible subject prior to onset of symptoms (e.g., based on a history of symptoms). Treatment may also continue after relief of symptoms, for example, to delay and/or prevent recurrence of the disease or disorder.
In the present specification, the term "prophylaxis" refers to prophylactic treatment of a subject who is now and in the past free of disease but at risk of developing disease or who has suffered from disease in the past, now free of disease but at risk of disease recurrence. In certain embodiments, the subject is at a higher risk of developing a disease or a higher risk of disease recurrence than the average healthy member of the population of subjects.
In this specification, an "effective amount" refers to an amount sufficient to elicit the desired biological response. The effective amount may vary depending upon factors such as the desired biological endpoint, pharmacokinetics, the condition being treated, the mode of administration, and the age and health of the subject. In certain embodiments, the effective amount is a therapeutically effective amount. In certain embodiments, the effective amount is a prophylactically effective amount. In certain embodiments, the effective amount is a single dose amount. In certain embodiments, the effective amount is a combined amount of multiple doses.
In this specification, a "therapeutically effective amount" is an amount sufficient to provide a therapeutic benefit in the treatment of a disorder or to delay or minimize one or more symptoms associated with a disorder. A therapeutically effective amount refers to an amount of a therapeutic agent alone or in combination with other therapies that provides a therapeutic benefit in the treatment of a disorder. The term "therapeutically effective amount" may include improving overall therapy; reducing or avoiding symptoms, signs, or causes of the disorder; and/or an amount that enhances the therapeutic efficacy of another therapeutic agent.
In this specification, a "prophylactically effective amount" is an amount sufficient to prevent a disorder or one or more symptoms associated with a disorder or prevent recurrence thereof. A prophylactically effective amount refers to an amount of a therapeutic agent alone or in combination with other agents that provides a prophylactic benefit in preventing a disorder. The term "prophylactically effective amount" may include an amount that improves overall prophylaxis or enhances the prophylactic efficacy of another prophylactic agent.
The term "gene" refers to a nucleic acid fragment that provides a template that can be used to produce a gene product. In certain embodiments, the gene fragment includes regulatory sequences preceding and following the coding sequence.
The terms "nucleic acid" or "nucleic acid sequence", "nucleic acid molecule", "nucleic acid fragment" or "polynucleotide" are used interchangeably. A polynucleotide molecule is a biopolymer made up of nucleotide monomers covalently bonded in a chain. DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are examples of polynucleotides having different biological functions. DNA consists of two polynucleotide strands, each strand being helical. In nature, RNA usually occurs in a single stranded form folded upon itself. Exemplary types of RNAs include double-stranded RNAs (dsRNA), small interfering RNAs (siRNA), short hairpin RNAs (shRNA), micrornas (miRNA), messenger RNAs (mRNA), antisense RNAs, transfer RNAs (tRNA), small nuclear RNAs (snRNA), and ribosomal RNAs (rRNA).
As used in the present disclosure, the terms "polypeptide," "peptide," and "protein" are used interchangeably herein and are polymers of amino acids of any length. The polymer may be linear or branched, it may contain modified amino acids, and it may be interrupted by non-amino acids. The term also includes amino acid polymers that have been modified (e.g., disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component).
An "expression vector" refers to a vector comprising a recombinant polynucleotide comprising an expression control sequence operably linked to a nucleotide sequence to be expressed. The expression vector includes a cis-acting component sufficient for expression; other components for expression may be provided by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes) and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) into which the recombinant polynucleotide is introduced.
The term "pharmaceutically acceptable" (or "pharmacologically acceptable") refers to molecular entities and compositions that do not produce adverse, allergic or other untoward reactions when administered to an animal or human, as appropriate. The term "pharmaceutically acceptable carrier" as used herein encompasses any and all solvents, dispersion media, coatings, antibacterial agents, isotonic and absorption delaying agents, buffers, excipients, binders, lubricants, gels, surfactants and the like which may be used as a medium for pharmaceutically acceptable substances.
It is an object of the present disclosure to provide a novel therapeutic target for prostate cancer. In particular to a novel method for treating the prostate cancer. More specifically, the CREPT gene or the expression product thereof is provided as a target for preparing the medicine for treating the prostatic cancer. Firstly, a prostate cancer cell line for over-expressing and knocking down CREPT is constructed, and a cell proliferation experiment and a clone formation experiment are respectively carried out. It was found that over-expression of CREPT promotes proliferation and clonogenic capacity of prostate cancer cells, and conversely, inhibition of CREPT expression can inhibit proliferation and clonogenic capacity of prostate cancer cells. The subcutaneous tumor-bearing experiments of mice show that after CREPT is knocked down, tumor occurrence is inhibited. Subsequently, spontaneous induction of prostate cancer mice (TRAMP +/- Pbsn-Cr e+/- ) Conditional knockout mice with CREPT (CREPT) f/f ) Crossing to obtain homozygous mice (TRAMP) capable of spontaneously inducing prostate cancer and knocking out CREPT +/- Pbsn-Cre +/- CREPT f/f ). The number of tumors produced by spontaneously induced prostate cancer mice with CREPT knockouts was found to be significantly less than spontaneously induced prostate cancer mice without CREPT knockouts. These evidence suggest that CREPT can be a target for prostate cancer treatment.
The following describes the technical scheme of the present disclosure in detail.
According to some embodiments of the present disclosure, there is provided the use of a CREPT gene or an expression product thereof as a therapeutic target. In particular, the use of CREPT genes or expression products thereof in the manufacture of a medicament for the treatment of prostate cancer is provided. In particular, the application of CREPT gene or its expression product as target point in preparing medicine for curing prostatic cancer is provided.
In some embodiments, the expression product of a CREPT gene refers to various forms of molecules of the CREPT gene in various stages, such as, but not limited to, molecules produced by the CREPT gene during amplification, replication, transcription, splicing, processing, translation, modification processes, such as cDNA, mRNA, precursor proteins, mature proteins, and fragments thereof.
In some embodiments, the sequence of the CREPT gene is described in NCBI database (https:// www.ncbi.nlm.nih.gov /), identified as: gene ID 58490.
In some embodiments, the sequence of the expression product of the CREPT gene (e.g., mature CREPT protein) is described in the database NCBI (https:// www.ncbi.nlm.nih.gov /), identified as: np_067038.1.
In some embodiments, the treatment comprises one or more of inhibiting proliferation of prostate cancer cells, inhibiting prostate cancer clonogenic, inhibiting prostate tumorigenesis, and inhibiting prostate cancer tumor growth.
According to some embodiments of the present disclosure, there is provided the use of an agent that targets a CREPT gene or an expression product thereof in the manufacture of a medicament for the treatment of prostate cancer.
In some embodiments, the agent that targets the CREPT gene or its expression product recognizes and binds to the CREPT gene or its expression product. In some embodiments, the agent that targets the CREPT gene or its expression product is capable of modulating the level or activity of the CREPT gene or its expression product. In some specific embodiments, the agent that targets the CREPT gene or its expression product is capable of reducing the level or activity of the CREPT gene or its expression product. In some specific embodiments, the agent that targets the CREPT gene or its expression product is capable of silencing the CREPT gene or its expression product.
In some embodiments, the agent that targets the CREPT gene or its expression product is selected from: nucleic acids, polypeptides, ribonucleoprotein complexes (RNPs) or small molecule drugs. In some embodiments, the nucleic acid is selected from DNA, RNA, DNA/RNA; the polypeptide is selected from: an antibody or antigen-binding fragment thereof; RNP is selected from: CRISPR/cas system. In some specific embodiments, the agent that targets the CREPT gene or its expression product is selected from the group consisting of: antisense oligonucleotides, siRNA, dsRNA, ribozymes, small interfering RNAs (esirnas) prepared by endoribonuclease III, short hairpin RNAs (shRNA), CRISPR/cas systems, or small molecule drugs.
In some specific embodiments, the agent that targets the CREPT gene or its expression product comprises an shRNA having a sequence as shown in SEQ ID No. 1 or SEQ ID No. 2.
In some specific embodiments, the agent that targets the CREPT gene or its expression product comprises a CRISPR/cas system in which the sgRNA sequence is shown in SEQ ID No. 3.
In some specific embodiments, the agent that targets the CREPT gene or its expression product comprises a small molecule drug that can reduce or silence the level or activity of the CREPT gene or its expression product.
The term "small molecule" refers to a low molecular weight compound that may be synthetically produced or obtained from natural sources and has a molecular weight of less than 2000 daltons (Da), less than 1500Da, less than 1000Da, less than 900Da, less than 800Da, less than 700Da, less than 600Da, or less than 500 Da.
In some embodiments, the small molecule drug may be an organic compound, an inorganic compound, or a combination of organic and/or inorganic compounds. In some specific embodiments, the small molecule drug is a chemically prepared active substance or compound. Typically, these compounds are synthesized in a classical manner by chemical reactions between different organic and/or inorganic compounds.
In some embodiments, the small molecule drug may exert its activity in the form in which it is administered, or the small molecule drug may be a prodrug. Thus, "small molecule drug" encompasses both active forms and prodrugs.
The term "prodrug" refers to a compound or substance that is converted to a therapeutically active agent under physiological conditions. In some embodiments, a prodrug is a compound or substance that is metabolized in a subject to a pharmaceutically active form (e.g., by enzymatic activity in the subject) upon administration.
The term "small molecule drug" also encompasses pharmaceutically acceptable salts thereof. The term "pharmaceutically acceptable salt" refers to any salt form of a small molecule drug that is safe and effective for administration to a subject of interest, and that has a desired biological, pharmaceutical, and/or therapeutic activity. Pharmaceutically acceptable salts include salts of acidic or basic groups. Pharmaceutically acceptable acid addition salts may include, but are not limited to, hydrochloride, hydrobromide, hydroiodide, nitrate, sulfate, bisulfate, phosphate, acidulous phosphate, isonicotinate, acetate, lactate, salicylate, citrate, tartrate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisate, fumarate, gluconate, glucuronate (glucaronate), sucrose salt, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, and pamoate (i.e., 1' -methylene-bis- (2-hydroxy-3-naphthoate)). Suitable base salts may include, but are not limited to, aluminum salts, calcium salts, lithium salts, magnesium salts, potassium salts, sodium salts, zinc salts, and diethanolamine salts.
In some more specific embodiments, the agent that targets the CREPT gene or its expression product comprises a small molecule drug represented by the following formula (I),
in some specific embodiments, the use of a CREPT gene or expression product thereof as a therapeutic target means that the CREPT gene or expression product thereof is targeted (e.g., by RNA interference) to modulate (e.g., reduce) the level or activity of the CREPT gene or expression product thereof in prostate cancer cells.
In other embodiments, there is provided the use of a CREPT gene or its expression product as a target in the screening of a medicament for the treatment of prostate cancer. In some specific embodiments, there is provided the use of a CREPT gene or an expression product thereof in the manufacture of a medicament screening device, wherein the screening refers to screening for a medicament for the treatment of prostate cancer. In some specific embodiments, the use of the CREPT gene or its expression product as a target for drug screening refers to: screening candidates by using CREPT gene as target point to find candidates capable of regulating (e.g. inhibiting, reducing) the level or activity of CREPT gene or its expression product, i.e. medicaments for treating prostate cancer.
In some specific embodiments, the screening device is in the form of a kit. In some specific embodiments, the screening device comprises a detection reagent for determining the level or activity of the CREPT gene or its expression product, such as, but not limited to, a primer, probe, antibody or antigen binding fragment thereof specific for the CREPT gene or its expression product.
In some embodiments, prostate cancer includes any pathological type of prostate cancer, including adenocarcinoma (acinar adenocarcinoma), ductal adenocarcinoma, urothelial carcinoma, squamous cell carcinoma, and adenosquamous carcinoma.
In some preferred embodiments, the prostate cancer is castration-resistant prostate cancer (CRPC). CRPC refers to prostate cancer that is still progressing after initial sustained Androgen Deprivation Therapy (ADT).
In some embodiments, the prostate cancer comprises prostate cancer of different stages or stages, e.g., stages or stages based on the Gleason classification system. The Gleason grading system adopts 5-grade and 10-grade grading related to prognosis, and the HE-stained tumor tissue in one visual field is divided into a main form and a secondary form according to the amount of the total area, and each form is divided into 5 grades, which are respectively 1-5 grades. The Gleason-graded score (value) is the sum of the score for the primary morphology and the score for the secondary morphology. Gleason total score of 2-4 is attributed to well-differentiated cancers; 5-7 belonging to medium differentiation carcinoma; 8-10 are classified as less differentiated cancers. Meanwhile, score 2 is the most noninvasive and score 10 is the most invasive. Clinically, a Gleason total score of 8-10 is considered to be highly likely metastatic prostate cancer. Thus, in some embodiments, prostate cancer includes metastatic prostate cancer and non-metastatic prostate cancer.
According to some embodiments, an agent targeting a CREPT gene or its expression product is provided that is capable of recognizing and binding to the CREPT gene or its expression product. According to some embodiments, an agent targeting a CREPT gene or its expression product is provided that is capable of modulating the level or activity of the CREPT gene or its expression product. In specific embodiments, the agent that targets the CREPT gene or its expression product is selected from the group consisting of: nucleic acids, polypeptides or RNPs. In some embodiments, the nucleic acid is selected from DNA, RNA, DNA/RNA; the polypeptide is selected from: an antibody or antigen-binding fragment thereof; RNP is selected from: CRISPR/cas system. In specific embodiments, the agent that targets the CREPT gene or its expression product is selected from the group consisting of: antisense oligonucleotides, siRNA, dsRNA, ribozymes, small interfering RNAs (esirnas) prepared by endoribonuclease III, short hairpin RNAs (shRNA), CRISPR/cas systems, or small molecule drugs. In specific embodiments, the double stranded RNA, ribozyme, esiRNA, shRNA, or sgRNA in a CRISPR/cas system comprises the information sequence of a CREPT gene. In a specific embodiment, the double stranded RNA is a small interfering RNA (siRNA) or a short hairpin RNA (shRNA).
The siRNA comprises a sense strand and an antisense strand; wherein the sense strand and the antisense strand are complementary, together forming an RNA dimer; and, the antisense strand is capable of hybridizing to or is capable of being complementary to a target sequence in a CREPT gene or an expression product thereof. In another specific embodiment, the siRNA is capable of specifically binding to a target sequence in a CREPT gene or an expression product thereof.
In another specific embodiment, the shRNA is expressed from a vector, e.g., a DNA fragment that transcribes the shRNA is cloned into a viral expression vector and expressed. The shRNA comprises a sense strand segment and an antisense strand segment, and a stem-loop structure linking the sense strand segment and the antisense strand segment, the sequences of the sense strand segment and the antisense strand segment being complementary, and the sequence of the antisense strand being complementary or hybridizing to a transcript sequence of a target sequence in a CREPT gene. The shRNA can become siRNA after enzyme digestion, and then the level or activity of CREPT genes or expression products thereof can be specifically regulated.
It will be appreciated by those skilled in the art that when targeting the CREPT gene, effective siRNA or shRNA can be designed and prepared according to the design principles of interfering RNA known in the art.
It will be appreciated by those skilled in the art that when targeting a CREPT gene or its expression product, a small molecule drug targeting the CREPT gene or its expression product can be predicted according to means known in the art, such as bioinformatics prediction means, etc., and the predicted small molecule drug can be screened to obtain an effective small molecule drug. Illustratively, by the above-described manner, a small molecule drug represented by the following formula (I) is obtained, which can be a component of an agent targeting the CREPT gene or an expression product thereof, but is not limited thereto.
According to some embodiments, there is provided a method of treating prostate cancer comprising the step of administering a therapeutically effective amount of an agent that targets the CREPT gene or an expression product thereof. In some embodiments, an agent targeting the CREPT gene or an expression product thereof is provided to the subject in a therapeutically effective amount. By a therapeutically effective amount is meant that the agent is sufficient to modulate (e.g., reduce) transcription or translation of the CREPT gene, or to modulate expression or activity of the CREPT gene expression product. In some embodiments, reduced means that the level or activity of the CREPT gene or its expression product is reduced by at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or a range between any two of the foregoing relative to a control to which no agent is administered. The particular therapeutically effective amount will also take into account factors such as the route of administration, the health of the patient, etc., which are within the skill of the skilled practitioner.
According to some embodiments, there is provided an expression vector that modulates the level or activity of a CREPT gene or its expression product, which encodes an agent, such as siRNA or shRNA, that targets the CREPT gene or its expression product as described above. The expression vector also optionally includes a detectable label such as, but not limited to, green fluorescent protein. The expression vector is selected from the group consisting of: dsRNA vector, lentiviral vector; for example lentiviral expression vectors.
According to some embodiments, there is provided a pharmaceutical composition for treating prostate cancer comprising an agent that targets the CREPT gene or an expression product thereof as described above; optionally a pharmaceutically acceptable carrier.
According to some embodiments, there is provided a method of screening and/or identifying a drug for treating prostate cancer comprising:
contacting the screened material with prostate cancer cells;
detecting the expression level of CREPT genes or expression products thereof in the prostate cancer cells after the contact with the objects to be screened;
compared with the prostate cancer cells which are not contacted with the object to be screened, the expression level of the CREPT gene or the expression product thereof in the prostate cancer cells contacted with the object to be screened is obviously reduced, and the object to be screened is judged to be an effective medicament for treating the prostate cancer.
In some embodiments, the prostate cancer cells may be isolated prostate cancer cells obtained from a prostate cancer patient. In other embodiments, the prostate cancer cell may be a prostate cancer cell line.
Examples
The present disclosure is further illustrated by the following examples, but is not intended to be limiting. Specific materials and sources thereof used in embodiments of the present disclosure are provided below. However, it should be understood that these are merely exemplary and are not intended to limit the present disclosure, and that materials that are the same as or similar to the type, model, quality, property, or function of the following reagents and instruments may be used to practice the present disclosure. The experimental methods used in the following examples are conventional methods unless otherwise specified. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.
Example 1 overexpression of CREPT to promote proliferation of prostate cancer cells
To investigate the effect of CREPT on prostate cancer cell proliferation, LNCaP cells with stable overexpression of CREPT were constructed in the prostate cancer cell line LNCaP (obtained from ATCC under the designation CRL-1740) using a lentiviral system. The LNCaP cell construction process for stable overexpression of CREPT is as follows: the lentivirus is first coated. 24 hours prior to transfection, appropriate amounts of 293T cells (obtained from ATCC under the code CRL-3216) were seeded to give a cell density of 60-80% at transfection; 1h before transfection, changing to fresh complete culture medium; taking 5 mug total amount of lentiviral packaging plasmid and target plasmid (pMD 2G: pSPAX2: pCDH-3HA-CREPT expression plasmid or empty plasmid (as control) =1:1.5:2.5), adding into 100 mug 0.9% NaCl, and blowing and mixing; the transfection reagent VigoFect (Wiggares Biotechnology (Beijing) Co., ltd., catalog number T001) was mixed with 0.9% NaCl in proportion and left at room temperature for 5 minutes; mixing the plasmid with 0.9% NaCl in proportion, adding diluted VigoFect dropwise, gently mixing, and standing at room temperature for 15 min; gently mixing the mixed solution, dropwise adding the mixed solution into the cell culture solution, and shaking the culture medium; the dishes were placed at 37℃with 5% CO 2 The incubator is replaced by fresh culture medium after 4-6 hours, and the incubator is cultivated for 24 hours; virus-containing supernatants were collected 24 and 48 hours after transfection, respectively; the virus supernatant was filtered with a 0.45 μm filter or centrifuged at 3000rpm for 5 minutes, and collected and kept in a refrigerator at 4℃or-80℃for further use. Spreading LNCaP cells in advance until the cell density is 30% -50% when the virus is infected; discarding the culture medium, and adding a proper amount of virus supernatant; 24h after infection, the culture medium was replaced with fresh complete mediumThe method comprises the steps of carrying out a first treatment on the surface of the After 48h infection, the corresponding antibiotics (puromycin) are added and screened until all control cells without viruses die, and LNCaP cells with stable overexpression of CREPT are generated and can be used for subsequent experiments.
LNCaP cells (labeled OE CREPT in FIG. 1) with stable overexpression of CREPT obtained above and prostate cancer cells of a control group (i.e. prostate cancer cells LNCaP infected with empty plasmid packaging virus in FIG. 1; labeled Ctrl) are counted and spread in 96-well plates, 1000 cells per well, cell proliferation is detected by CCK-8 kit every day, diluted CCK-8 detection solution is added to each well, then OD450 value is measured by an enzyme-labeled instrument, detection is performed once every 24 hours, cell proliferation curve is drawn, abscissa is time, and ordinate is OD450 value. Higher OD450 values represent higher cell activity. The results are shown in FIG. 1, and the curves show that p values are less than 0.0001 through two-factor multivariate analysis of variance, and the p values are significantly different, which indicates that the over-expression of CREPT significantly promotes the proliferation of prostate cancer cells.
Example 2 overexpression of CREPT to promote prostate cancer cell clonogenesis
To investigate the effect of CREPT on the clonogenic capacity of prostate cancer cells, clonogenic experiments were performed using the control group of prostate cancer cells and CREPT-stably overexpressed LNCaP cells in example 1. 500 control groups of prostate cancer cells and CREPT stabilized over-expressed LNCaP cells were plated in 6-well plates, three replicates each. After 7 days of incubation, the colonies were fixed and stained with 1% crystal violet in methanol and after scanning the colonies were counted using ImageJ software to form an area. As shown in fig. 2, in LNCaP cells, the cell area of LNCaP cells stably overexpressed by CREPT (labeled OE CREPT in fig. 2) was larger than that of control prostate cancer cells (labeled Ctrl in fig. 2), and the p value was < 0.0001 with a significant difference by t-test, indicating that CREPT significantly promoted the cell clonogenic capacity of prostate cancer cells.
Example 3 knock down CREPT inhibits prostate cancer cell proliferation
To further investigate the effect of CREPT on prostate cancer cell proliferation, stable specific CREPT knockdown LNCaP cells were constructed using the following shRNA sequences.
shRNA1(SEQ ID No:1)：
CCGGCGGCAGCAGTATATTCTGAAACTCGAGTTTCAGAATATACTGCTGCCGTTTTTTG
shRNA2(SEQ ID No:2)：
CCGGGCACGAAGATTAGGTGCATTTCTCGAGAAATGCACCTAATCTTCGTGCTTTTTTG
The cell line construction process is as follows: the lentivirus is first coated. 24 hours before transfection, inoculating a proper amount of 293T cells so that the cell density is 60-80% during transfection; 1h before transfection, changing to fresh complete culture medium; taking 5 mug total amount of lentivirus packaging plasmid and target plasmid (pMD 2G: pSPAX2: TRC2-pLKO-puro-shCREPT plasmid (shRNA 1 or shRNA2 is contained, sh knockdown plasmid is purchased from a Qinghua university gene library platform, pMD2G, pSPAX plasmid is stored in Chang Zhijie laboratory) or shNC empty plasmid TRC2-pLKO-puro Vector (as control group) =1:1.5:2.5) and adding into 100 mug of 0.9% NaCl, and blowing and mixing uniformly; uniformly mixing a transfection reagent VigoFect with 0.9% NaCl in proportion, and standing at room temperature for 5 minutes; mixing the plasmid with 0.9% NaCl in proportion, adding diluted VigoFect dropwise, gently mixing, and standing at room temperature for 15 min; gently mixing the mixed solution, dropwise adding the mixed solution into the cell culture solution, and shaking the culture medium; the dishes were placed at 37℃with 5% CO 2 The incubator is replaced by fresh culture medium after 4-6 hours, and the incubator is cultivated for 24 hours; virus-containing supernatants were collected 24 and 48 hours after transfection, respectively; the virus supernatant was filtered with a 0.45 μm filter or centrifuged at 3000rpm for 5 minutes, and collected and kept in a refrigerator at 4℃or-80℃for further use. Spreading LNCaP cells in advance until the cell density is 30% -50% when the virus is infected; discarding the culture medium, and adding a proper amount of virus supernatant; after 24h of infection, the culture medium is replaced by fresh complete culture medium; after 48h infection, the corresponding antibiotics (puromycin) are added to screen until all control cells without viruses die, and two stable and specific CREPT knockdown LNCaP cells (knockdown by shRNA1 and shRNA2 respectively) are generated and can be used for subsequent experiments.
Cell proliferation experiments were performed using the two stable specific CREPT knockdown LNCaP cells obtained above (labeled shCREPT-1 and shCREPT-2 in FIG. 3, respectively) and the control LNCaP cells (i.e., the shNC empty plasmid-packed virus-infected LNCaP cells, labeled shNC in FIG. 3), as shown in FIG. 3, and the results showed that the knockdown CREPT significantly inhibited proliferation of prostate cancer cells in the two stable specific CREPT knockdown LNCaP cells. The two stable specific CREPT knockdown LNCaP cells were each less than 0.0001 p-value, with a significant difference compared to the control LNCaP cells.
Example 4 knock down CREPT inhibits prostate cancer cell clone formation
Stable specific CREPT knockdown LNCaP cells constructed according to the description of example 3 were subjected to a colony formation experiment simultaneously, and two stable specific CREPT knockdown LNCaP cells (labeled as shCREPT-1 and shCREPT-2 in FIG. 4) and a control LNCaP cell (labeled as shNC in FIG. 4) were plated in 6-well plates, 500 cells per well, and three replicates per group, respectively. After 7 days of incubation, the colonies were fixed and stained with 1% crystal violet in methanol and after scanning the colonies were counted using ImageJ software to form an area. As shown in fig. 4, the results showed that the drop CREPT clone formation area was reduced in two kinds of stable specific CREPT drop LNCaP cells, each of which had p value < 0.0001 compared to the control LNCaP cells, with a significant difference. It was demonstrated that knock-down CREPT significantly inhibited the clonogenic capacity of prostate cancer cells.
Example 5 knockout of CREPT to inhibit prostate cancer cell clone formation
In this embodiment, CREPT knockout LNCaP Cells (CREPT) are constructed based on CRISPR/Cas9 system -/- ) The construction method is according to Lidan Ding, et al CREPT/RPRD1B associates with Aurora B to regulate Cyclin B1 expression for accelerating the G/M transition in gastric cancer, cell Death Dis.2018Dec 5;9 (12): 1172 (PMID: 30518842), which is incorporated herein by reference in its entirety. Briefly, pSpCas9 (BB) 2A-Puro (PX 459) vector containing sgRNA sequence was transfected in LNCaP cells, while a control group was set up to transfect empty plasmid. Screening positive cells by antibiotics; expansion culture, resulting CREPT knockout cell line (CREPT) -/- ) Can be used for subsequent experiments.
The sgRNA sequence is 5'-GCGGTGCCACACGGAGACGAT-3' (SEQ ID No: 3);
when constructed in pSpCas9 (BB) 2A-Puro (PX 459) vector, the upstream sequence of sgRNA was as follows (SEQ ID No: 4):
F：5’-caccGCGGTGCCACACGGAGACGAT-3’；
the downstream sequence form of sgRNA is (SEQ ID No: 5):
R：5’-aaacATCGTCTCCGTGTGGCACCGC-3’。
clone experiments were then performed using CREPT knockout cells, which were plated in 6-well plates after cell counting, 500 cells per well, and 3 replicates per group. After 7 days of incubation, the colonies were fixed and stained with 1% crystal violet in methanol and after scanning the colonies were counted using ImageJ software to form an area. As shown in FIG. 5, the results indicate that CREPT knockout cells (indicated as CREPT in FIG. 5) were compared to the control group (indicated as Ctrl in FIG. 5) -/- ) In the method, the formation area of the CREPT clone is reduced, the p value is less than 0.01, and the significant difference exists. It was demonstrated that knockout of CREPT significantly inhibited the clonogenic capacity of prostate cancer cells.
EXAMPLE 6 knock down CREPT inhibits prostate tumorigenesis
In this example, an in vivo animal experiment was performed. The LNCaP cells (shCREPT-1) with stable and specific CREPT knockdown obtained in example 3 and the LNCaP cells of the control group in example 3 were transplanted subcutaneously into 4-week-old female BALB/c nude mice (obtained from Vetong LiHua Co.), each of which was inoculated with 5X 10 7 Each group had 5 mice. After two months the experiment was ended and the tumor was dissected. As a result, as shown in fig. 6, it was found that in the control group (indicated as shNC in fig. 6), tumors developed subcutaneously and continued to grow in BALB/c nude mice, whereas LNCaP cells (indicated as shCREPT in fig. 6) with stable, specific CREPT knockdown failed to develop tumors subcutaneously in BALB/c nude mice. Tumor weights of control mice averaged 81.52mg and volumes averaged 90.44mm 3 。
EXAMPLE 7 knockout of CREPT to inhibit prostate tumor growth
In this example, spontaneous induction of prostate cancer mice (TRAMP +/- Pbsn-Cre +/- ) With CREPT conditional knockout mice (CREP)T f/f ) Crossing to obtain homozygous mice (TRAMP) capable of spontaneously inducing prostate cancer and knocking out CREPT +/- Pbsn-Cre +/- CREPT f/f ) (Chiang, h.l., lin, c.y., jan, f.d., lin, y.s., hsu, c.t., whang-Peng, j., liu, l.f., nieh, s., lin, c.c., and Hwang, j. (2012) A novel synthetic bipartite carrier protein for developing glycotope-based vaccines.vaccine 30,7573-7581.Thobe, m.n., gray, j.k., gusamay, d., paluch, a.m., wagh, p.k., pathrose, p., lentsch, a.b., and Waltz, s.e. (2011) The Ron receptor promotes prostate tumor growth in the TRAMP mouse model oncogene 30, 4990-4998). Wild type mice 40 weeks old were dissected (TRAMP -/- ；CREPT +/+ The method comprises the steps of carrying out a first treatment on the surface of the WT), spontaneous induction of prostate cancer mice (trail +/- ；CREPT f/f ) And spontaneous induction of prostate cancer and CREPT knockout mice (TRAMP +/- ；CREPT f/f ；Pbsn-Cre +/- ) Is a urinary and reproductive system. As shown in fig. 7, the results showed that the number of tumors produced in the spontaneous induction prostate cancer mice with CREPT knockouts was significantly smaller than that in the spontaneous induction prostate cancer mice without CREPT knockouts. This suggests that knockout of CREPT in the prostate tissue of mice can effectively inhibit the occurrence and progression of prostate cancer.
Example 8 knock down CREPT inhibits castration resistant prostate cancer cell proliferation
To further investigate the effect of CREPT on the proliferation of castration-resistant prostate cancer cells, two specific CREPT knockdown 22RV1 cells (obtained from ATCC, accession No. CRL-2505) were constructed using shRNA1 and shRNA2 of example 3, and the control group was transformed into an empty vector plasmid. 22RV1 cells are castration-resistant prostate cancer cells. The cell line construction procedure was the same as in example 3.
Cell proliferation experiments were performed using two specific CREPT knockdown 22RV1 cells (shCREPT-1 and shCREPT-2 shown in FIG. 8) and a control 22RV1 cell (shNC shown in FIG. 8), and as shown in FIG. 8, cell proliferation of the two specific CREPT knockdown 22RV1 cells was slowed down. The results show that the CREPT is knocked down to obviously inhibit the proliferation of the prostate cancer cells. The p-values of both specific CREPT knockdown 22RV1 cells were less than 0.0001 with significant differences compared to the control group. It is demonstrated that inhibition of CREPT has a significant effect on castration-resistant prostate cancer treatment.
Example 9 inhibition of prostate cancer cell proliferation and clonogenic by small molecule inhibitors against CREPT
1. Prediction of small molecule compounds
According to the http:// www.swisstargetprediction.ch/https:// sea. Bkslab. Org/co-prediction of small molecule inhibitors against CREPT, 15 small molecule compounds were synthesized as candidate small molecule inhibitors.
2. Screening of small molecule compounds
1) Taking cells in logarithmic growth phase (LNCaP cell line), digesting with 0.25% trypsin, gently blowing to obtain single cells, counting living cells, and adjusting cell density to 1×10 with DMEM culture medium containing 10% fetal bovine serum 4 cells/L.
2) After 10mL of the culture solution and 10mL of the cell dilution were mixed in a ratio of 1:1, 0.2mL of the mixture was added to each well of the 96-well plate, and 3 duplicate wells were added in total. Placing at 37deg.C and 5% CO 2 Incubate in incubator for 12 hours.
3) Small molecule inhibitor drugs against CREPT were screened for a total of 15 candidate compounds, drug was dissolved with DMSO, and each drug was screened using concentration: 5. Mu.M. 3 replicates of each compound were made; the concentration of each drug was 5. Mu.M for 3 days and then the cell proliferation was measured using CCK.
Before measurement, each well was replaced by 10. Mu.L of CCK-8 solution and 90. Mu.L of complete medium (wells with corresponding amounts of CCK-8 solution and cell culture broth added as blank). Incubate at 37℃for 3 hours. The absorbance at a wavelength of 450nm was measured. And calculating and counting results. Referring to fig. 9, the predicted and screened drugs have certain inhibition effect on prostate cancer cells, wherein the compound shown in the following formula (I) (number 5 in fig. 9) has the best effect; the compounds of the following formula (II) (number 14 in FIG. 9) and the compounds of the following formula (III) (number 15 in FIG. 9) also have a significant inhibitory effect.
3. Small molecule compound IC 50 Is (are) determined by
IC of small molecule compound 50 The assay is essentially as described above for the "screening of small molecule compounds" method, except that: selecting compounds with good cell proliferation effect (compounds shown in formula (I), formula (II) and formula (III)) according to different concentrations: cell proliferation was measured after 3 days of incubation at 0.25. Mu.M, 0.5. Mu.M, 1. Mu.M, 5. Mu.M, 10. Mu.M. And calculating and counting results. The results are shown in FIGS. 10A to 10C, which show compound IC represented by formula (I) 50 0.6874 mu M, it is shown that the compound of formula (I) has a good proliferation inhibition effect on prostate cancer cells. The IC50 values of the compound of formula (II) and the compound of formula (III) are 14.87. Mu.M and 11.73. Mu.M, respectively, and the concentrations are too high, so that the pharmaceutical properties are poor and the toxicity may be large. The inhibition of the compounds of formula (I) will then be further examined by a colony formation assay.
4. Cloning effect of small molecule compound on prostate cancer cells
1) Taking cells in logarithmic growth phase (LNCaP cell line), digesting with 0.25% trypsin, gently blowing to obtain single cells, counting living cells, and adjusting cell density to 1×10 with DMEM culture medium containing 20% fetal bovine serum 6 cells/L. And then plated according to experimental requirements.
2) After adding 4mL of the culture solution and 4mL of the cell dilution in a ratio of 1:1, 1mL of the mixture was added to each well of the six-well plate, and 3 duplicate wells were added in total. 3 repeats of the compound shown in the formula (I); the medicine concentration is 2 μm, the medicine is added on the day of inoculation, the culture solution containing 2 μm concentration medicine is changed every two days, and the culture solution is placed at 37 ℃ and 5% CO 2 Culturing in an incubator for 8 days.
3) When the clone size is proper, discarding the cell clone supernatant, adding 0.1% crystal violet solution for dyeing for 1h, and washing the excess dye solution with running water.
4) The plate was placed on a scanner and the number of cell clones was observed.
As shown in FIG. 11, the CREPT small molecule inhibitor (compound of formula (I)) was able to inhibit the formation of cell clones.
The description of the exemplary embodiments presented above is merely to illustrate the technical aspects of the present disclosure and is not intended to be exhaustive or to limit the present disclosure to the precise forms described. Obviously, many modifications and variations are possible in light of the above teaching to those of ordinary skill in the art. The exemplary embodiments were chosen and described in order to explain the specific principles of the present disclosure and its practical application to thereby enable others skilled in the art to understand, make and utilize the various exemplary embodiments and various alternatives and modifications thereof. It is intended that the scope of the disclosure be defined by the following claims and their equivalents.
Sequence listing
<110> university of Qinghua
<120> use of CREPT in the treatment of prostate cancer
<130> 2253134IP-2
<150> CN202210621946.4
<151> 2022-06-01
<160> 5
<170> PatentIn version 3.5
<210> 1
<211> 59
<212> DNA
<213> artificial sequence
<220>
<223> shRNA1
<400> 1
ccggcggcag cagtatattc tgaaactcga gtttcagaat atactgctgc cgttttttg 59
<210> 2
<211> 59
<212> DNA
<213> artificial sequence
<220>
<223> shRNA2
<400> 2
ccgggcacga agattaggtg catttctcga gaaatgcacc taatcttcgt gcttttttg 59
<210> 3
<211> 21
<212> DNA
<213> artificial sequence
<220>
<223> sgRNA
<400> 3
gcggtgccac acggagacga t 21
<210> 4
<211> 25
<212> DNA
<213> artificial sequence
<220>
<223> sgRNA upstream sequence in vector
<400> 4
caccgcggtg ccacacggag acgat 25
<210> 5
<211> 25
<212> DNA
<213> artificial sequence
<220>
<223> sgRNA downstream sequence in vector
<400> 5
aaacatcgtc tccgtgtggc accgc 25

Claims (10)

1. Use of an agent that targets the CREPT gene or its expression product in the manufacture of a medicament for the treatment of prostate cancer;
the reagent for targeting the CREPT gene or the expression product thereof is shRNA, and the sequence of the reagent is shown as SEQ ID No. 1 or SEQ ID No. 2; and/or the number of the groups of groups,
the reagent for targeting CREPT gene or the expression product thereof is a small molecule drug shown in the following formula (I),
2. use according to claim 1, wherein the expression product of the CREPT gene is selected from: cDNA, mRNA, CREPT precursor protein, mature CREPT protein, and fragments thereof.
3. The use of claim 1 or 2, wherein the prostate cancer comprises one or more of adenocarcinoma, ductal adenocarcinoma, urothelial carcinoma, squamous cell carcinoma, and adenosquamous carcinoma; and/or the number of the groups of groups,
the prostate cancer is castration-resistant prostate cancer.
4. The use of claim 1 or 2, wherein the treatment comprises one or more of inhibiting proliferation of prostate cancer cells, inhibiting prostate cancer clonogenic, inhibiting prostate tumorigenesis, and inhibiting prostate cancer tumor growth.
5. The use of claim 1 or 2, wherein the prostate cancer is a prostate cancer in a subject.
6. The use of claim 5, wherein the subject is a mammal.
7. The use of claim 5, wherein the subject is a human.
8. An agent that targets a CREPT gene or an expression product thereof, which is capable of modulating the level or activity of the CREPT gene or an expression product thereof, wherein:
the expression product of the CREPT gene is selected from the group consisting of: cDNA, mRNA, CREPT precursor proteins, mature CREPT proteins, and fragments thereof;
the reagent for targeting CREPT genes or expression products thereof is shRNA, and the sequence of the reagent is shown as SEQ ID No. 1 or SEQ ID No. 2.
9. An expression vector that modulates the level or activity of a CREPT gene or its expression product, which encodes the agent of claim 8 that targets a CREPT gene or its expression product.
10. A pharmaceutical composition for treating prostate cancer, comprising: the agent for targeting a CREPT gene or an expression product thereof of claim 8; and, a pharmaceutically acceptable carrier.
CN202210770054.0A 2022-06-01 2022-06-30 Use of CREPT in the treatment of prostate cancer Active CN115054694B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/CN2023/094835 WO2023231780A1 (en) 2022-06-01 2023-05-17 Use of crept in treatment of prostate cancer

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN202210621946 2022-06-01
CN2022106219464 2022-06-01

Publications (2)

Publication Number Publication Date
CN115054694A CN115054694A (en) 2022-09-16
CN115054694B true CN115054694B (en) 2024-03-12

Family

ID=83204386

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210770054.0A Active CN115054694B (en) 2022-06-01 2022-06-30 Use of CREPT in the treatment of prostate cancer

Country Status (2)

Country Link
CN (1) CN115054694B (en)
WO (1) WO2023231780A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115054694B (en) * 2022-06-01 2024-03-12 清华大学 Use of CREPT in the treatment of prostate cancer

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002008255A2 (en) * 2000-07-21 2002-01-31 Incyte Genomics, Inc. Cell cycle proteins and mitosis-associated molecules
CN102559601A (en) * 2012-01-13 2012-07-11 清华大学 CREPT (Cell-cycle Related and Expression-elevated Protein in Tumor) antibody for identifying tumor cells or tumor tissues
CN108949718A (en) * 2018-07-25 2018-12-07 清华大学 CREPT(S145A) mutant and its application in inhibition tumour growth

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101632833B (en) * 2008-07-25 2013-11-06 上海市计划生育科学研究所 Prostatic cancer related gene and application thereof
CN115054694B (en) * 2022-06-01 2024-03-12 清华大学 Use of CREPT in the treatment of prostate cancer

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002008255A2 (en) * 2000-07-21 2002-01-31 Incyte Genomics, Inc. Cell cycle proteins and mitosis-associated molecules
CN102559601A (en) * 2012-01-13 2012-07-11 清华大学 CREPT (Cell-cycle Related and Expression-elevated Protein in Tumor) antibody for identifying tumor cells or tumor tissues
CN108949718A (en) * 2018-07-25 2018-12-07 清华大学 CREPT(S145A) mutant and its application in inhibition tumour growth

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
339197-29-4.《STN REGISTRY》.2001,第1页. *
MicroRNA-501e3p restricts prostate cancer growth through regulating cell cycle-related and expression-elevated protein in tumor/cyclin D1 signaling;Zhanhong Zhang等;《Biochemical and Biophysical Research Communications》(第509期);第 746-752 页 *
Zhanhong Zhang等.MicroRNA-501e3p restricts prostate cancer growth through regulating cell cycle-related and expression-elevated protein in tumor/cyclin D1 signaling.《Biochemical and Biophysical Research Communications》.2019,(第509期),第746-752页. *

Also Published As

Publication number Publication date
WO2023231780A1 (en) 2023-12-07
CN115054694A (en) 2022-09-16

Similar Documents

Publication Publication Date Title
CN107075515A (en) C/EBP α compositions and application method
CN105435228B (en) New anti-tumor application of arsenic trioxide and anti-tumor preparation
Han et al. Low-expression of TMEM100 is associated with poor prognosis in non-small-cell lung cancer
US20220112498A1 (en) Methods for diagnosing and treating metastatic cancer
CN115054694B (en) Use of CREPT in the treatment of prostate cancer
CN109328072B (en) Cell death inducer, cell proliferation inhibitor, and pharmaceutical composition for treating diseases caused by abnormal cell proliferation
KR20200044695A (en) A composition for treating stomach cancer comprising an inhibitor of SYT11
Han et al. RBM23 Drives Hepatocellular Carcinoma by Activating NF-κB Signaling Pathway
CN105189786A (en) FALZ for use as a target for therapies to treat cancer
CN106636368B (en) Application of miR-130a in diagnosis, treatment and prognosis of ovarian cancer
CN115058519A (en) Application of protein-acting method in diagnosis and treatment of KRAS gene mutation-related diseases
JP5683261B2 (en) Double-stranded nucleic acid molecule suitable for cancer prevention or treatment, cancer cell growth inhibitor, and pharmaceutical
US8486905B2 (en) Use of FLJ25416 gene
Li et al. PRUNE2 inhibits progression of colorectal cancer in vitro and in vivo
KR101445921B1 (en) A Use of micro RNA 185 for Treating Cancers
US10835551B2 (en) Double-stranded nucleic acid molecule, DNA, vector, cancer cell growth inhibitor, cancer cell migration inhibitor, and drug
Xie et al. miR-21 Regulates the Growth of Gastric Cancer Cells Through Targeting Phosphatase and Tensin Homolog (PTEN)
Rudran et al. P1. 03-19 Antibody Blockade of Integrin Alpha-V-Beta-6 (avb6) as a Novel Treatment for NSCLC
Hong et al. UBDP1 pseudogene and UBD network competitively bind miR‑6072 to promote glioma progression
CN114917344A (en) WDR67 inhibitor and application thereof in inhibition of growth and transfer of hepatoma cells
CN117344019A (en) Use of CHIP in detecting and improving resistance of prostate cancer to docetaxel
CN117089619A (en) Biomarker for diagnosing colon cancer and application thereof
CN115990163A (en) Application of BCI-121 or pharmaceutically acceptable salt thereof in preparation of medicines for preventing or treating gastric cancer
CN115212308A (en) Use of targeting agents for the GASDERMIN E pathway in the treatment of pancreatic cancer
CN113564260A (en) Use of CPNE3 in detection and treatment of glioblastoma

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant