CN115054694A

CN115054694A - Use of CREPT in the treatment of prostate cancer

Info

Publication number: CN115054694A
Application number: CN202210770054.0A
Authority: CN
Inventors: 常智杰; 任芳丽; 王银银; 马丹辉; 田野
Original assignee: Tsinghua University
Current assignee: Tsinghua University
Priority date: 2022-06-01
Filing date: 2022-06-30
Publication date: 2022-09-16
Anticipated expiration: 2042-06-30
Also published as: WO2023231780A1; CN115054694B

Abstract

The present disclosure provides the use of CREPT in the treatment of prostate cancer. Specifically, the disclosure provides the use of CREPT gene or its expression product as a target in the preparation of a medicament for treating prostate cancer; use of an agent targeting a CREPT gene or an expression product thereof in the manufacture of a medicament for the treatment of prostate cancer; and the application of the CREPT gene or the expression product thereof as a target spot in the preparation of a drug screening device, wherein the screening refers to screening of drugs for treating prostate cancer. The present disclosure finds that CREPT can be applied to prostate cancer treatment, and can inhibit prostate cancer cell proliferation, inhibit prostate cancer clonogenic, inhibit prostate tumorigenesis and inhibit prostate cancer tumor growth by inhibiting CREPT expression, which is of great significance for prostate cancer treatment.

Description

Use of CREPT in the treatment of prostate cancer

Technical Field

The disclosure relates to the technical field of tumor treatment, in particular to an application of CREPT in treating prostatic cancer.

Background

Prostate cancer is a common disease of old men, and according to the data of the national institute of tumor and the national center for health and statistics, the incidence rate of prostate cancer is higher than that of lung cancer in 2012, and the malignant tumor of men is the first. Although the incidence of prostate cancer in China is low, the incidence of prostate cancer is in a rising trend in recent years due to the change of dietary structure and the improvement of diagnosis technology with the increasing life span of people in China.

For early stage prostate cancer, the tumor is less aggressive and the best treatment is surgical resection when the cancerous lesion is localized in the prostate. However, early-stage prostate cancer has no obvious symptoms and has no great influence on normal life, and early-stage prostate cancer is not easy to be found by means of B-ultrasound, CT and the like.

Non-surgical treatment of prostate cancer includes androgen-deprivation therapy (ADT), Radiation Therapy (RT), ablative therapy, chemotherapy, and emerging immunotherapy. Androgen Deprivation Therapy (ADT) has been the primary treatment for advanced prostate cancer. Generally refers to lowering serum testosterone levels below castration values, either by surgical or pharmacological castration, or by the use of Androgen Receptor (AR) antagonists, alone or in combination. However, Castration Resistant Prostate Cancer (CRPC) patients are not susceptible to androgen deprivation therapy and eventually develop resistance to these drugs, leading to disease progression.

Cited reference 1(D Lu et al, CREPT associated proteins by regulating the transcription of cell-cycle related genes. cancer cell.21:92-104,2012) discloses that tumor-cycle-associated proteins (CREPT) are highly expressed in prostate cancer tissues compared to paracancerous tissues, and it has also been found that CREPT interacts with AR to promote the development and metastasis of prostate cancer by regulating the transcriptional activity of the AR signaling pathway.

However, the occurrence and development of prostate cancer involve complex signaling pathways or mechanisms, and the function of a molecule on a certain signaling pathway is not understood, so that the molecule can not be predicted to be applied to the diagnosis and treatment of diseases. In addition, no research reports that the aim of treating the prostate cancer can be achieved by regulating CREPT at present.

Disclosure of Invention

Problems to be solved by the invention

Based on the above problems in the prior art, it is an object of the present disclosure to provide the use of CREPT in the treatment of prostate cancer.

Means for solving the problems

In some aspects of the present disclosure, there is provided use of any one of the following (i) to (iii):

(i) the CREPT gene or an expression product thereof is used as a target for preparing a medicament for treating prostatic cancer;

(ii) use of an agent targeting a CREPT gene or an expression product thereof in the manufacture of a medicament for the treatment of prostate cancer;

(iii) the CREPT gene or the expression product thereof is used as a target spot for preparing a drug screening device, and the screening refers to screening drugs for treating prostate cancer.

In some embodiments, the expression product of the CREPT gene is selected from the group consisting of: cDNA, mRNA, CREPT precursor protein, mature CREPT protein, and fragments thereof.

In some embodiments, the prostate cancer comprises one or more of adenocarcinoma, ductal adenocarcinoma, urothelial carcinoma, squamous cell carcinoma, and adenosquamous carcinoma.

In some embodiments, the prostate cancer is castration resistant prostate cancer.

In some embodiments, the treatment comprises one or more of inhibiting prostate cancer cell proliferation, inhibiting prostate cancer clonality, inhibiting prostate tumorigenesis, and inhibiting prostate cancer tumor growth.

In some embodiments, the prostate cancer is prostate cancer in a subject.

In some preferred embodiments, the subject comprises a mammal.

In some more preferred embodiments, the subject is a human.

In some embodiments, the agent that targets the CREPT gene or expression product thereof is selected from the group consisting of: nucleic acids, polypeptides, ribonucleoprotein complexes or small molecule drugs.

In some preferred embodiments, the polypeptide is selected from an antibody or antigen-binding fragment thereof.

In some preferred embodiments, the nucleic acid is selected from the group consisting of DNA, RNA, DNA/RNA.

In some preferred embodiments, the ribonucleoprotein complex is selected from the group consisting of CRISPR/cas systems.

In some more preferred embodiments, the agent that targets the CREPT gene or expression product thereof is selected from the group consisting of: antisense oligonucleotides, siRNA, dsRNA, ribozymes, esiRNA, shRNA, CRISPR/cas systems, small molecule drugs.

In some specific embodiments, the agent targeting CREPT gene or its expression product comprises shRNA, the sequence of which is shown in SEQ ID No. 1 or SEQ ID No. 2.

In some specific embodiments, the agent targeting the CREPT gene or the expression product thereof comprises a CRISPR/cas system in which the sgRNA sequence is shown in SEQ ID No: 3.

In some specific embodiments, the agent targeting the CREPT gene or its expression product comprises a small molecule drug represented by the following formula (I),

in some specific embodiments, the screening device comprises a detection agent for determining the level or activity of a CREPT gene or an expression product thereof, preferably selected from the group consisting of: primers, probes, antibodies or antigen-binding fragments thereof specific for the CREPT gene or its expression products.

In other aspects of the disclosure, there is provided an agent that targets a CREPT gene or expression product thereof, which is capable of modulating the level or activity of a CREPT gene or expression product thereof, wherein: the expression product of the CREPT gene is selected from the group consisting of: cDNA, mRNA, CREPT precursor protein, mature CREPT protein, and fragments thereof; the agent targeting the CREPT gene or its expression product is selected from the group consisting of: nucleic acids, polypeptides, ribonucleoprotein complexes or small molecule drugs; preferably, the polypeptide is selected from an antibody or antigen-binding fragment thereof; preferably, the nucleic acid is selected from the group consisting of DNA, RNA, DNA/RNA; preferably, the ribonucleoprotein complex is selected from the group consisting of CRISPR/cas system; more preferably, the agent targeting the CREPT gene or its expression product is selected from the group consisting of: antisense oligonucleotides, siRNA, dsRNA, ribozymes, esiRNA, shRNA, CRISPR/cas systems, small molecule drugs.

In some embodiments, the agent targeting the CREPT gene or expression product thereof comprises a shRNA, the sequence of which is shown in SEQ ID No. 1 or SEQ ID No. 2.

In some embodiments, the agent targeting the CREPT gene or expression product thereof comprises a CRISPR/cas system in which the sgRNA sequence is shown in SEQ ID No: 3.

In some embodiments, the agent that targets the CREPT gene or its expression product comprises a small molecule drug of the following formula (I),

in other aspects of the disclosure, an expression vector that modulates the level or activity of a CREPT gene or its expression product is provided that encodes an agent as described above that targets a CREPT gene or its expression product.

In other aspects of the present disclosure, there is provided a pharmaceutical composition for treating prostate cancer, comprising: agents that target the CREPT gene or its expression product as described above; and, optionally, a pharmaceutically acceptable carrier.

In other aspects of the disclosure, a method of treating prostate cancer is provided comprising the step of administering a therapeutically effective amount of an agent that targets the CREPT gene or expression product thereof as described above.

In other aspects of the disclosure, a method of screening and/or identifying a drug for treating prostate cancer is provided, comprising:

contacting the material to be screened with prostate cancer cells;

detecting the expression level of CREPT gene or its expression product in prostate cancer cell after contacting with the matter to be screened;

and (3) compared with the prostate cancer cells which are not contacted with the substance to be screened, the expression level of the CREPT gene or the expression product thereof in the prostate cancer cells which are contacted with the substance to be screened is obviously reduced, and the substance to be screened is judged to be an effective medicament for treating the prostate cancer.

ADVANTAGEOUS EFFECTS OF INVENTION

The present disclosure finds that CREPT can be applied to prostate cancer treatment, and can inhibit prostate cancer cell proliferation, inhibit prostate cancer clonogenic, inhibit prostate tumorigenesis and inhibit prostate cancer tumor growth by inhibiting CREPT expression, which is of great significance for prostate cancer treatment.

Drawings

Figure 1 is a schematic representation of the promotion of prostate cancer cell proliferation by over-expression of CREPT.

Fig. 2 is a schematic diagram of promotion of prostate cancer cell clonality by over-expression of CREPT, wherein a in fig. 2 is an under-mirror graph and B in fig. 2 is a statistical result graph.

Figure 3 is a schematic of knocking down CREPT to inhibit prostate cancer cell proliferation.

Fig. 4 is a schematic diagram of knocking down CREPT to inhibit prostate cancer cell clonogenic, where a in fig. 4 is a scan and B in fig. 4 is a statistical result graph.

Fig. 5 is a schematic diagram of knocking out CREPT to inhibit clonogenic prostate cancer cells, where a in fig. 5 is a scan and B in fig. 5 is a statistical result.

Figure 6 is a graphical representation of knockdown CREPT inhibition of prostate tumorigenesis, where a in figure 6 is an under-the-lens plot and B, C in figure 6 is a statistical plot of tumor weight and volume, respectively.

Figure 7 is a schematic of knockout CREPT inhibiting prostate tumor growth.

Figure 8 is a schematic of knockdown of CREPT to inhibit the proliferation of castration resistant prostate cancer cells.

FIG. 9 is a schematic representation of small molecule inhibitors inhibiting prostate cancer cell proliferation.

FIGS. 10A-10C show the IC of small molecule inhibitors in inhibiting prostate cancer cell proliferation ₅₀ A schematic diagram wherein: FIG. 10A shows a compound of formula (I); FIG. 10B shows a compound of formula (II); FIG. 10C shows a compound represented by the formula (III).

FIG. 11 is a schematic diagram of the formation of prostate cancer cell clones inhibited by small molecule inhibitors.

Detailed Description

Hereinafter, the present disclosure will be described in detail. The technical features described below are explained based on representative embodiments and specific examples of the present disclosure, but the present disclosure is not limited to these embodiments and specific examples. It should be noted that:

in the present specification, the numerical range represented by "numerical value a to numerical value B" means a range including the end point numerical value A, B.

In the present specification, the term "substantially" or "substantially" means that the standard deviation from the theoretical model or theoretical data is within 5%, preferably 3%, and more preferably 1%.

In the present specification, the term "may" includes both the case where a certain process is performed and the case where no process is performed.

In this specification, "optional" or "optionally" means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where the event occurs and instances where it does not.

In the present specification, reference to "some particular/preferred embodiments," "other particular/preferred embodiments," "embodiments," and the like, means that a particular element (e.g., feature, structure, property, and/or characteristic) described in connection with the embodiment is included in at least one embodiment described herein, and may or may not be present in other embodiments. In addition, it is to be understood that the described elements may be combined in any suitable manner in the various embodiments.

The terms "including" and "having," as well as any variations thereof, of the present disclosure are intended to cover non-exclusive inclusions. For example, a process, method, apparatus, article, or device that comprises a list of steps is not limited to only those steps or modules listed, but may alternatively include other steps not listed or inherent to such process, method, article, or device.

Reference to "a plurality" in this disclosure means two or more. "and/or" describes the association relationship of the associated objects, meaning that there may be three relationships, e.g., a and/or B, which may mean: a exists alone, A and B exist simultaneously, and B exists alone. The character "/" generally indicates that the former and latter associated objects are in an "or" relationship.

In this specification, the term "tumour" or "cancer" refers to any medical condition characterised by neoplastic or malignant cell growth, proliferation or metastasis, including solid cancers and non-solid cancers such as leukaemia.

In the present specification, the term "prostate cancer" or "prostate tumor" refers to a cancer or tumor derived from prostate tissue.

In the present specification, the term "subject" refers to a human (i.e., a male or female of any age group, e.g., a pediatric subject (e.g., an infant, a child, or an adolescent) or an adult subject (e.g., a young, a middle aged, or an elderly)) or a non-human animal. In certain embodiments, the non-human animal is a mammal (e.g., a primate (e.g., a cynomolgus monkey or rhesus monkey), a commercially relevant mammal (e.g., a cow, pig, horse, sheep, goat, cat, or dog), or a bird.

The term "administering" refers to implanting, absorbing, ingesting, injecting, inhaling or otherwise introducing a drug or agent into or onto a subject.

In this specification, the term "treatment" refers to reversing, alleviating, delaying the onset of, or inhibiting the progression of a disease. In some embodiments, treatment may be administered after one or more signs or symptoms of the disease have developed or have been observed. In other embodiments, treatment may be administered without signs or symptoms of disease. For example, treatment may be administered to a susceptible subject prior to the onset of symptoms (e.g., based on a history of symptoms). After remission, treatment may also be continued, e.g., to delay and/or prevent recurrence of the disease or disorder.

In the present specification, the term "prevention" refers to prophylactic treatment of a subject who is not and has not had a disease in the past but is at risk of developing a disease or who has had a disease in the past, is not and has had a disease in the present but is at risk of recurrence of the disease. In certain embodiments, the subject is at a higher risk of developing the disease or a higher risk of disease recurrence compared to the average healthy member of the population of subjects.

In this specification, "effective amount" means an amount sufficient to elicit a desired biological response. The effective amount may vary depending on factors such as the desired biological endpoint, pharmacokinetics, condition being treated, mode of administration, and age and health of the subject. In certain embodiments, the effective amount is a therapeutically effective amount. In certain embodiments, the effective amount is a prophylactically effective amount. In certain embodiments, an effective amount is a single dose amount. In certain embodiments, an effective amount is a combined amount of multiple doses.

In the present specification, a "therapeutically effective amount" is an amount sufficient to provide a therapeutic benefit in the treatment of a disorder or to delay or minimize one or more symptoms associated with the disorder. A therapeutically effective amount refers to the amount of a therapeutic agent, alone or in combination with other therapies, that provides a therapeutic benefit in the treatment of a disorder. The term "therapeutically effective amount" may include improving overall therapy; reducing or avoiding symptoms, signs or causes of the disorder; and/or an amount that enhances the therapeutic efficacy of another therapeutic agent.

In the present specification, a "prophylactically effective amount" is an amount sufficient to prevent a disorder or one or more symptoms associated with a disorder or prevent the recurrence thereof. A prophylactically effective amount refers to an amount of a therapeutic agent, alone or in combination with other agents, that provides a prophylactic benefit in preventing a disorder. The term "prophylactically effective amount" can include an amount that improves overall prophylaxis or enhances the prophylactic efficacy of another prophylactic agent.

The term "gene" refers to a nucleic acid fragment that provides a template that can be used to produce a gene product. In certain embodiments, a gene fragment comprises regulatory sequences before and after the coding sequence.

The terms "nucleic acid" or "nucleic acid sequence", "nucleic acid molecule", "nucleic acid fragment" or "polynucleotide" are used interchangeably. A polynucleotide molecule is a biopolymer composed of nucleotide monomers covalently bonded in a chain. DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are examples of polynucleotides having different biological functions. DNA consists of two polynucleotide strands, each of which is in the form of a helix. In nature, RNA usually occurs in a single-stranded form folded upon itself. Exemplary types of RNA include double-stranded RNA (dsrna), small interfering RNA (sirna), short hairpin RNA (shrna), micro RNA (mirna), messenger RNA (mrna), antisense RNA, transfer RNA (trna), small nuclear RNA (snrna), and ribosomal RNA (rrna).

As used in this disclosure, the terms "polypeptide," "peptide," and "protein" are used interchangeably herein and are polymers of amino acids of any length. The polymer may be linear or branched, it may comprise modified amino acids, and it may be interrupted by non-amino acids. The term also includes amino acid polymers that have been modified (e.g., disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component).

An "expression vector" refers to a vector comprising a recombinant polynucleotide comprising an expression control sequence operably linked to a nucleotide sequence to be expressed. The expression vector includes sufficient cis-acting components for expression; other components for expression may be provided by the host cell or in an in vitro expression system. Expression vectors include all of those known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes), and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) into which recombinant polynucleotides are introduced.

The term "pharmaceutically acceptable" (or "pharmacologically acceptable") refers to molecular entities and compositions that do not produce an adverse reaction, allergic reaction, or other untoward reaction when administered to an animal or human, as appropriate. The term "pharmaceutically acceptable carrier" as used herein includes any and all solvents, dispersion media, coatings, antibacterial agents, isotonic and absorption delaying agents, buffers, excipients, binders, lubricants, gels, surfactants, and the like, which can be used as a medium for a pharmaceutically acceptable substance.

The purpose of the present disclosure is to provide a novel prostate cancer therapeutic target. In particular to a novel prostate cancer treatment method. More particularly, provides the application of CREPT gene or its expression product as target in preparing medicine for treating prostatic cancer. Firstly, a prostate cancer cell line for over-expressing and knocking down CREPT is constructed, and cell proliferation is respectively carried outExperiments and clone formation experiments. It is found that the over-expression of CREPT promotes the proliferation and clonogenic capacity of prostate cancer cells, and conversely, the inhibition of the CREPT expression can inhibit the proliferation and clonogenic capacity of prostate cancer cells. Mouse subcutaneous tumor-bearing experiments show that after CREPT is knocked down, the tumor is inhibited. Following this, prostate cancer mice (TRAMP) will be spontaneously induced ^+/- Pbsn-Cr ^e+/- ) And CREPT conditional knockout mice (CREPT) ^f/f ) Crossing to obtain homozygous mice (TRAMP) capable of spontaneously inducing prostate cancer and knocking out CREPT ^+/- Pbsn-Cre ^+/- CREPT ^f/f ). It was found that the number of tumors produced by CREPT knockout spontaneously induced prostate cancer mice was significantly less than that of CREPT non-knockout spontaneously induced prostate cancer mice. These evidence suggest CREPT as a target for prostate cancer therapy.

The technical solution of the present disclosure is explained in detail below.

According to some embodiments of the disclosure, there is provided the use of a CREPT gene or expression product thereof as a therapeutic target. Specifically, the application of the CREPT gene or an expression product thereof in preparing a medicament for treating prostatic cancer is provided. Specifically, the application of the CREPT gene or the expression product thereof as a target in preparing a medicament for treating prostatic cancer is provided.

In some embodiments, the expression product of a CREPT gene refers to various forms of molecules of the CREPT gene at various stages, such as, but not limited to, molecules produced during amplification, replication, transcription, splicing, processing, translation, modification of the CREPT gene, e.g., cDNA, mRNA, pre-protein, mature protein, and fragments thereof.

In some embodiments, the CREPT gene sequence is described in the NCBI database (https:// www.ncbi.nlm.nih.gov /), identifying the sequence number: gene ID: 58490.

In some embodiments, the sequence of the expression product of the CREPT gene (e.g., the mature CREPT protein) is described in database NCBI (https:// www.ncbi.nlm.nih.gov /), identifying numbers: NP _ 067038.1.

In some embodiments, the treatment comprises one or more of inhibiting prostate cancer cell proliferation, inhibiting prostate cancer clonogenesis, inhibiting prostate tumorigenesis, and inhibiting prostate cancer tumor growth.

According to some embodiments of the present disclosure, there is provided the use of an agent targeting the CREPT gene or an expression product thereof in the manufacture of a medicament for the treatment of prostate cancer.

In some embodiments, agents that target the CREPT gene or its expression product are capable of recognizing and binding to the CREPT gene or its expression product. In some embodiments, the agent that targets the CREPT gene or its expression product is capable of modulating the level or activity of the CREPT gene or its expression product. In some specific embodiments, an agent that targets the CREPT gene, or an expression product thereof, is capable of reducing the level or activity of the CREPT gene, or an expression product thereof. In some specific embodiments, the agent that targets the CREPT gene, or an expression product thereof, is capable of silencing the CREPT gene, or an expression product thereof.

In some embodiments, the agent that targets the CREPT gene or expression product thereof is selected from the group consisting of: nucleic acids, polypeptides, ribonucleoprotein complexes (RNPs) or small molecule drugs. In some embodiments, the nucleic acid is selected from DNA, RNA, DNA/RNA; the polypeptide is selected from: an antibody or antigen-binding fragment thereof; the RNP is selected from: CRISPR/cas system. In some specific embodiments, the agent that targets the CREPT gene or its expression product is selected from the group consisting of: antisense oligonucleotides, siRNA, dsRNA, ribozymes, small interfering RNA (esiRNA) produced by endoribonuclease III, short hairpin RNA (shRNA), CRISPR/cas systems, or small molecule drugs.

In some specific embodiments, the agent that targets the CREPT gene or its expression product comprises a shRNA, the sequence of which is shown in SEQ ID No. 1 or SEQ ID No. 2.

In some specific embodiments, the agent that targets the CREPT gene or expression product thereof comprises a CRISPR/cas system in which the sgRNA sequence is shown in SEQ ID No: 3.

In some specific embodiments, the agent that targets a CREPT gene or its expression product comprises a small molecule drug that can reduce or silence the level or activity of a CREPT gene or its expression product.

The term "small molecule" refers to a low molecular weight compound, which may be synthetically produced or obtained from natural sources, and has a molecular weight of less than 2000 daltons (Da), less than 1500Da, less than 1000Da, less than 900Da, less than 800Da, less than 700Da, less than 600Da, or less than 500 Da.

In some embodiments, the small molecule drug can be an organic compound, an inorganic compound, or a combination of organic and/or inorganic compounds. In some specific embodiments, the small molecule drug is a chemically prepared active substance or compound. Generally, these compounds are synthesized in a classical manner by chemical reactions between different organic and/or inorganic compounds.

In some embodiments, the small molecule drug may exert its activity in the form in which it is administered, or the small molecule drug may be a prodrug. Thus, "small molecule drug" encompasses both the active form and the prodrug.

The term "prodrug" refers to a compound or substance that is converted to a therapeutically active agent under physiological conditions. In some embodiments, a prodrug is a compound or substance that is metabolized to a pharmaceutically active form in the subject following administration (e.g., by enzymatic activity in the subject).

The term "small molecule drug" also encompasses pharmaceutically acceptable salts thereof. The term "pharmaceutically acceptable salt" refers to any salt form of a small molecule drug that is safe and effective for administration to a target subject and that has a desired biological, pharmaceutical, and/or therapeutic activity. Pharmaceutically acceptable salts include salts of acidic or basic groups. Pharmaceutically acceptable acid addition salts can include, but are not limited to, the hydrochloride, hydrobromide, hydroiodide, nitrate, sulfate, bisulfate, phosphate, acid phosphate, isonicotinate, acetate, lactate, salicylate, citrate, tartrate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisate, fumarate, gluconate, glucuronate, sucralonate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, and pamoate salts (i.e., 1,1' -methylene-bis- (2-hydroxy-3-naphthoate)). Suitable base salts may include, but are not limited to, aluminum, calcium, lithium, magnesium, potassium, sodium, zinc, and diethanolamine salts.

In some more specific embodiments, the agent targeting a CREPT gene or an expression product thereof comprises a small molecule drug of the following formula (I),

in some specific embodiments, the use of a CREPT gene or its expression product as a therapeutic target refers to targeting a CREPT gene or its expression product (e.g., by RNA interference) to modulate (e.g., reduce) the level or activity of a CREPT gene or its expression product in prostate cancer cells.

In other embodiments, the use of the CREPT gene or its expression product as a target in the screening of drugs for the treatment of prostate cancer is provided. In some specific embodiments, there is provided the use of a CREPT gene or an expression product thereof in the preparation of a drug screening device, wherein the screening refers to screening for drugs useful in the treatment of prostate cancer. In some specific embodiments, targeting the CREPT gene or its expression product for drug screening refers to: the CREPT gene is taken as a target, and the candidate is screened to find out the candidate which can regulate (such as inhibit and reduce) the level or the activity of the CREPT gene or the expression product thereof, namely the candidate is the medicine for treating the prostatic cancer.

In some specific embodiments, the screening device is in the form of a kit. In some specific embodiments, the screening device comprises a detection agent, such as, but not limited to, a primer, probe, antibody or antigen-binding fragment thereof specific for CREPT gene or its expression product, for determining the level or activity of CREPT gene or its expression product.

In some embodiments, prostate cancer includes prostate cancer of any pathological type, including adenocarcinoma (acinar adenocarcinoma), ductal adenocarcinoma, urothelial carcinoma, squamous cell carcinoma, and adenosquamous carcinoma.

In some preferred embodiments, the prostate cancer is Castration Resistant Prostate Cancer (CRPC). CRPC refers to prostate cancer in which disease continues to progress after initial sustained Androgen Deprivation Therapy (ADT).

In some embodiments, the prostate cancer comprises prostate cancer of different stages or grades, e.g., stages or grades based on the Gleason grading system. The Gleason grading system uses a 5-grade, 10-grade system associated with prognosis, which divides HE stained tumor tissue in one field into primary and secondary morphologies by the total area, each of which is graded by 5 and is 1-5-grade. The score (value) of the Gleason scale is the sum of the score of the primary morphology and the score of the secondary morphology. The Gleason total score of 2-4 belongs to well differentiated cancers; 5-7 scores belonged to moderately differentiated cancers; between 8 and 10 points are of less differentiated cancer. Meanwhile, score 2 is the most noninvasive and score 10 is the most invasive. Clinically, a Gleason total score of 8-10 is considered to be highly likely metastatic prostate cancer. Thus, in some embodiments, prostate cancer includes metastatic prostate cancer and non-metastatic prostate cancer.

According to some embodiments, an agent is provided that targets the CREPT gene or its expression product, which is capable of recognizing and binding the CREPT gene or its expression product. According to some embodiments, there is provided an agent that targets the CREPT gene or its expression product, which is capable of modulating the level or activity of the CREPT gene or its expression product. In particular embodiments, the agent that targets the CREPT gene or its expression product is selected from the group consisting of: a nucleic acid, a polypeptide or an RNP. In some embodiments, the nucleic acid is selected from DNA, RNA, DNA/RNA; the polypeptide is selected from: an antibody or antigen-binding fragment thereof; RNP is selected from: CRISPR/cas system. In specific embodiments, the agent that targets a CREPT gene or expression product thereof is selected from the group consisting of: antisense oligonucleotides, siRNA, dsRNA, ribozymes, small interfering RNA (esiRNA) produced by endoribonuclease III, short hairpin RNA (shRNA), CRISPR/cas systems, or small molecule drugs. In specific embodiments, the sgRNA in the double-stranded RNA, ribozyme, esiRNA, shRNA, or CRISPR/cas system contains the information sequence of the CREPT gene. In a specific embodiment, the double stranded RNA is a small interfering RNA (sirna) or a short hairpin RNA (shrna).

The siRNA comprises a sense strand and an antisense strand; wherein the sense strand and the antisense strand are complementary and together form an RNA dimer; and, the antisense strand is capable of hybridizing to or being complementary to a target sequence in a CREPT gene or an expression product thereof. In another specific embodiment, the siRNA specifically binds to a target sequence in the CREPT gene or expression product thereof.

In another specific embodiment, the shRNA is expressed from a vector, for example, by cloning a DNA fragment into a viral expression vector that transcribes the shRNA. The shRNA comprises a sense strand segment and an antisense strand segment, and a stem-loop structure connecting the sense strand segment and the antisense strand segment, wherein the sequences of the sense strand segment and the antisense strand segment are complementary, and the sequence of the antisense strand is complementary or hybridized with the transcription product sequence of a target sequence in a CREPT gene. The shRNA can become siRNA after enzyme digestion, and further specifically regulates the level or activity of a CREPT gene or an expression product thereof.

It will be appreciated by those skilled in the art that when targeting the CREPT gene, effective sirnas or shrnas can be designed and prepared according to interfering RNA design principles well known in the art.

It will be understood by those skilled in the art that when targeting CREPT gene or its expression product as a target, small molecule drugs targeting CREPT gene or its expression product can be predicted according to tools known in the art, such as bioinformatics prediction tools, etc., and the predicted small molecule drugs can be screened to obtain effective small molecule drugs. Illustratively, in the above manner, a small molecule drug represented by the following formula (I) is obtained, which can be a component of an agent targeting a CREPT gene or an expression product thereof, but is not limited thereto.

According to some embodiments, there is provided a method of treating prostate cancer comprising the step of administering a therapeutically effective amount of an agent that targets the CREPT gene or expression product thereof. In some embodiments, an agent that targets a CREPT gene or expression product thereof is provided to a subject in a therapeutically effective amount. By therapeutically effective amount is meant that the agent is sufficient to modulate (e.g., decrease) transcription or translation of the CREPT gene, or to modulate expression or activity of a CREPT gene expression product. In some embodiments, reduced means that the level or activity of the CREPT gene or expression product thereof is reduced by at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or a range between any two of the foregoing relative to a control in which no agent is administered. The specific therapeutically effective amount will also take into account factors such as the route of administration, the health of the patient, etc., which are within the skill of the skilled practitioner.

According to some embodiments, there is provided an expression vector that modulates the level or activity of a CREPT gene or its expression product, encoding an agent, such as an siRNA or shRNA, described above that targets a CREPT gene or its expression product. The expression vector also optionally comprises a detectable marker, such as, but not limited to, green fluorescent protein. The expression vector is selected from: dsRNA vectors, lentiviral vectors; such as a lentiviral expression vector.

According to some embodiments, there is provided a pharmaceutical composition for the treatment of prostate cancer comprising an agent that targets the CREPT gene or expression product thereof as described above; and optionally a pharmaceutically acceptable carrier.

According to some embodiments, there is provided a method of screening and/or identifying a drug for treating prostate cancer, comprising:

contacting the material to be screened with prostate cancer cells;

In some embodiments, the prostate cancer cells may be ex vivo prostate cancer cells obtained from a prostate cancer patient. In other embodiments, the prostate cancer cell can be a prostate cancer cell line.

Examples

The present disclosure is further illustrated by the following examples, which are not to be construed as limiting the disclosure. The following provides specific materials and sources thereof used in embodiments of the present disclosure. However, it should be understood that these are exemplary only and are not intended to limit the present disclosure, and that materials that are the same as or similar to the type, model, quality, nature, or function of the reagents and instruments described below may be used in the practice of the present disclosure. The experimental procedures used in the following examples are all conventional procedures unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1 overexpression of CREPT promotes prostate cancer cell proliferation

To explore the effect of CREPT on prostate cancer cell proliferation, LNCaP cells stably overexpressing CREPT were constructed in the prostate cancer cell line LNCaP (obtained from ATCC, accession number CRL-1740) using the lentiviral system. The construction process of the CREPT stably over-expressed LNCaP cell is as follows: the lentivirus is first coated. 24 hours prior to transfection, an appropriate amount of 293T cells (obtained from ATCC under the accession number CRL-3216) was inoculated such that the cell density at transfection was 60-80%; 1h before transfection, replacing with fresh complete culture medium; the lentiviral vector packaging plasmid and the target plasmid (pMD 2G: pSPAX 2: pCDH-3HA-CREPT expression plasmid or empty vector plasmid (as control) ═ 1: 1.5: 2.5) were added in a total amount of 5. mu.g to 100. mu.L of 0.9% NaCl and mixed by pipetting; the transfection reagent VigoFect (Weiglas biotechnology (Beijing) Co., Ltd., catalog number T001) and 0.9% NaCl are mixed in proportion and left at room temperature for 5 minutes; mixing the plasmid and 0.9% NaCl in certain proportion, dropping diluted VigoFect, mixing and standing at room temperature for 15 min; mixing the mixed solution gently, adding dropwise into cell culture solution, shaking up and culturingA group; the Petri dish was placed at 37 ℃ in 5% CO ₂ The incubator is replaced by a fresh culture medium after 4 to 6 hours, and is cultured for 24 hours; virus-containing supernatants were collected 24 hours and 48 hours after transfection, respectively; the virus supernatant was filtered through a 0.45 μm filter or centrifuged at 3000rpm for 5 minutes, collected and stored in a 4 ℃ freezer or-80 ℃ freezer for further use. Laying LNCaP cells in advance until the cell density is 30-50% when the virus is infected; removing the culture medium, and adding a proper amount of virus supernatant; after 24h of infection, the medium was replaced with fresh complete medium; after 48h of infection, corresponding antibiotic (puromycin) is added for screening until all control cells without added virus die, and LNCaP cells with CREPT stable overexpression can be generated for subsequent experiments.

The obtained LNCaP cells with CREPT stable overexpression (marked as OECREPT in figure 1) and the prostate cancer cells of a control group (namely the prostate cancer cells LNCaP infected by the empty vector plasmid packaging virus; marked as Ctrl in figure 1) are counted and then paved in a 96-well plate, 1000 cells are laid in each well, the cell proliferation condition is detected by a CCK-8 kit every day, diluted CCK-8 detection liquid is added into each well, then the OD450 value is measured by a microplate reader, the detection is carried out once every 24h for 5 days continuously, and a cell proliferation curve is drawn, wherein the abscissa is time, and the ordinate is the OD450 value. Higher OD450 values represent higher cell activity. The results are shown in fig. 1, and the curve shows that p value is less than 0.0001 through two-factor multivariate analysis of variance, and has significant difference, which indicates that over-expression of CREPT obviously promotes the proliferation of prostate cancer cells.

Example 2 overexpression of CREPT promotes clonogenic prostate cancer cells

To investigate the effect of CREPT on the clonogenic capacity of prostate cancer cells, clonogenic experiments were performed using the control group of prostate cancer cells and the CREPT stably overexpressing LNCaP cells in example 1. 500 control groups of prostate cancer cells and CREPT stably overexpressing LNCaP cells were plated separately in 6-well plates, triplicate in each group. After 7 days of culture, the cells were fixed and stained with 1% crystal violet in methanol, and the area of colony formation was counted after scanning using ImageJ software. As shown in fig. 2, in LNCaP cells, the cell area of the LNCaP cells with CREPT stably over-expressed (marked as OE CREPT in fig. 2) is larger than that of the control group prostate cancer cells (marked as Ctrl in fig. 2), and the p value is less than 0.0001 by t test, which has significant difference, and the result shows that CREPT significantly promotes the cell clonogenic capacity of the prostate cancer cells.

Example 3 knockdown of CREPT inhibits prostate cancer cell proliferation

To further study the effect of CREPT on prostate cancer cell proliferation, stable specific CREPT knockdown LNCaP cells were constructed using the following shRNA sequences.

shRNA1(SEQ ID No:1)：

CCGGCGGCAGCAGTATATTCTGAAACTCGAGTTTCAGAATATACTGCTGCCGTTTTTTG

shRNA2(SEQ ID No:2)：

CCGGGCACGAAGATTAGGTGCATTTCTCGAGAAATGCACCTAATCTTCGTGCTTTTTTG

The cell line construction process is as follows: the lentivirus is first coated. Inoculating a proper amount of 293T cells 24 hours before transfection, so that the cell density is 60-80% during transfection; 1h before transfection, replacing with fresh complete culture medium; adding a total amount of 5 mu g of lentivirus packaging plasmid and target plasmid (pMD 2G: pSPAX 2: TRC2-pLKO-puro-shCREPT plasmid (containing the shRNA1 or shRNA2, sh knock-down plasmid is purchased from Qinghua university gene library platform, pMD2G and pSPAX2 plasmids are stored in Changzijie laboratory) or shNC unloaded plasmid TRC2-pLKO-puro Vector (used as a control group) ═ 1: 1.5: 2.5) into 100 mu L of 0.9% NaCl, and blowing, beating and uniformly mixing; uniformly mixing a transfection reagent VigoFect and 0.9% NaCl according to a proportion, and standing for 5 minutes at room temperature; mixing the plasmid and 0.9% NaCl in certain proportion, dropping diluted VigoFect, mixing and standing at room temperature for 15 min; gently mixing the mixed solution uniformly, adding the mixed solution into the cell culture solution drop by drop, and shaking up the culture medium; the culture dish was placed at 37 ℃ in 5% CO ₂ The incubator is replaced by a fresh culture medium after 4 to 6 hours, and is cultured for 24 hours; virus-containing supernatants were collected 24 hours and 48 hours after transfection, respectively; the virus supernatant was filtered through a 0.45 μm filter or centrifuged at 3000rpm for 5 minutes, collected and stored in a 4 ℃ freezer or-80 ℃ freezer for further use. Laying LNCaP cells in advance until the cell density is 30-50% when the virus is infected; discarding the medium and addingAppropriate amount of virus supernatant; after 24h of infection, the medium was replaced with fresh complete medium; after 48h of infection, the corresponding antibiotic (puromycin) was added and screened until all the control cells without added virus died, and two stable specific CREPT knockdown LNCaP cells (knocked down by shRNA1 and shRNA2, respectively) were generated and used in subsequent experiments.

Cell proliferation experiments were performed using the two stable specific CREPT-knocked-down LNCaP cells obtained above (labeled as shrempt-1 and shrempt-2 in fig. 3) and the control group LNCaP cells (i.e., virus-infected LNCaP cells packaged with shNC empty plasmid, labeled as shNC in fig. 3), as shown in fig. 3, the results showed that the knocking-down CREPT of the two stable specific CREPT-knocked-down LNCaP cells significantly inhibited prostate cancer cell proliferation. Compared with the control group LNCaP cells, the p values of the two stable specific CREPT knockdown LNCaP cells are less than 0.0001, and the two stable specific CREPT knockdown LNCaP cells are significantly different.

Example 4 knockdown of CREPT inhibits clonal formation of prostate cancer cells

Stable specific CREPT-knockdown LNCaP cells constructed as described in example 3 were subjected to simultaneous colony formation experiments and two stable specific CREPT-knockdown LNCaP cells (labeled shrept-1 and shrept-2 in fig. 4) and a control group LNCaP cell (labeled shrept-2 in fig. 4) were plated in 6-well plates, 500 cells per well, with each group replicated three times. After 7 days of culture, the cells were fixed and stained with 1% crystal violet in methanol, and the area of colony formation was counted after scanning using ImageJ software. As shown in fig. 4, the results show that, in the two stable specific CREPT knocked-down LNCaP cells, the knocking-down CREPT clone formation area is reduced, and the two stable specific CREPT knocked-down LNCaP cells have p values of less than 0.0001 compared with the control group LNCaP cells respectively, and have significant differences. Therefore, the knocking-down CREPT obviously inhibits the clonogenic capacity of the prostate cancer cells.

Example 5 knock-out of CREPT inhibits clonogenic prostate cancer cells

In this example, CREPT-knocked-out LNCaP Cells (CREPT) were constructed based on CRISPR/Cas9 system ^-/- ) The construction method is according to Lidan Ding, et al. CREPT/RPRD1B associations with Aurora B to-regulated Cyclin B1 expression for accessing the G2/M transition in structural cancer, Cell Death Dis.2018Dec 5; 1172(PMID:30518842), which is incorporated herein by reference in its entirety. Briefly, the pSpCas9(BB)2A-Puro (PX459) vector containing the sgRNA sequence was transfected in LNCaP cells, while the control group was set up, and the empty vector plasmid was transfected. Screening positive cells by antibiotics; expansion culture, resulting CREPT knockout cell lines (CREPT) ^-/- ) And the method can be used for subsequent experiments.

The sgRNA sequence is 5'-GCGGTGCCACACGGAGACGAT-3' (SEQ ID No: 3);

when constructed in the pSpCas9(BB)2A-Puro (PX459) vector, the upstream sequence form of sgRNA is (SEQ ID No: 4):

F：5’-caccGCGGTGCCACACGGAGACGAT-3’；

the downstream sequence form of sgRNA is (SEQ ID No: 5):

R：5’-aaacATCGTCTCCGTGTGGCACCGC-3’。

colony formation experiments were then performed using CREPT knockout cells, counted and plated in 6-well plates with 500 cells per well, with 3 replicates per group. After 7 days of culture, the cells were fixed and stained with 1% crystal violet in methanol, and the area of colony formation was counted after scanning using ImageJ software. As shown in fig. 5, the results indicated that CREPT knockout cells (shown as CREPT in fig. 5) relative to the control (shown as Ctrl in fig. 5) were present ^-/- ) In the method, the formed area of the knockout CREPT clone is reduced, the p value is less than 0.01, and the obvious difference exists. Therefore, the knockout of CREPT obviously inhibits the clonogenic capacity of prostate cancer cells.

Example 6 knockdown of CREPT inhibits prostate tumorigenesis

In this example, in vivo animal experiments were performed. The stable specific CREPT knockdown LNCaP cells obtained in example 3 (shCREPT-1) and the control group LNCaP cells in example 3 were transplanted subcutaneously into 4-week-old female BALB/c nude mice (obtained from Wintonley Hua Co.) and each cell was inoculated with 5X 10 cells ⁷ One, 5 mice per group. The experiment was terminated two months later and the tumors were dissected. As a result, as shown in FIG. 6, it was found that the tumors were in BALB/c nu in the control group (indicated as shNC in FIG. 6)de nude mice developed and continued to grow subcutaneously, while stable specific CREPT knockdown LNCaP cells (represented as shCREPT in figure 6) were unable to develop tumors subcutaneously in BALB/c nude mice. The control mice had an average tumor weight of 81.52mg and an average volume of 90.44mm ³ 。

Example 7 knockout of CREPT inhibits prostate tumor growth

In this example, mice spontaneously induced for prostate cancer (TRAMP) ^+/- Pbsn-Cre ^+/- ) And CREPT conditional knockout mice (CREPT) ^f/f ) Crossing to obtain homozygous mice (TRAMP) capable of spontaneously inducing prostate cancer and knocking out CREPT ^+/- Pbsn-Cre ^+/- CREPT ^f/f ) (Huang, H.L., Lin, C.Y., Jan, F.D., Lin, Y.S., Hsu, C.T., where-Peng, J., Liu, L.F., Nieh, S., Lin, C.C., and Hwang, J. (2012). A novel synthetic biological carrier protein for defining glucose-based variables 30,7573-7581.Thobe, M.N., Gray, J.K., Gurusamy, D., Palucch, A.M., Wagh, P.K., Pathrose, P.s., Lentsch, A.B., Walz, S.E. product, N.2011. promoter, 4998. model). 40 weeks old wild type mice (TRAMP) were dissected ^-/- ；CREPT ^+/+ (ii) a WT), spontaneous prostate cancer-induced mice (TRAMP) ^+/- ；CREPT ^f/f ) And spontaneously induced prostate cancer and CREPT knockout mice (TRAMP) ^+/- ；CREPT ^f/f ；Pbsn-Cre ^+/- ) The urinary and reproductive systems of (1). As shown in fig. 7, the results show that the number of tumors generated by CREPT knockout spontaneously-induced prostate cancer mice is significantly less than that generated by CREPT non-knockout spontaneously-induced prostate cancer mice. This suggests that knockout of CREPT in prostate tissue in mice can effectively inhibit the development and progression of prostate cancer.

Example 8 knockdown of CREPT inhibits castration-resistant prostate cancer cell proliferation

To further investigate the effect of CREPT on the proliferation of castration-resistant prostate cancer cells, two specific CREPT knockdown 22RV1 cells (obtained from ATCC, accession number CRL-2505) were constructed using shRNA1 and shRNA2 in example 3, and the control group was transformed into the empty vector plasmid. 22RV1 cells are castration resistant prostate cancer cells. The cell line construction procedure was the same as in example 3.

Cell proliferation experiments were performed using two specific CREPT knockdown 22RV1 cells (shown in fig. 8 as shrrpt-1 and shrrpt-2, respectively) and control 22RV1 cells (shown in fig. 8 as shNC), as shown in fig. 8, the cell proliferation of the two specific CREPT knockdown 22RV1 cells was slowed. The result shows that knocking down CREPT obviously inhibits the proliferation of prostate cancer cells. Compared with the control group, the p value of 22RV1 cells with two specific CREPT knockdowns is less than 0.0001, and the difference is significant. Indicating that the CREPT inhibition has obvious effect on the treatment of castration resistant prostate cancer.

Example 9 inhibition of prostate cancer cell proliferation and clonogenic by Small molecule inhibitors against CREPT

1. Prediction of small molecule compounds

According to the website http:// www.swisstargetprediction.ch/and https:// sea. bkslab. org/jointly predicting the small molecule inhibitor aiming at CREPT, 15 small molecule compounds are synthesized to be used as candidate small molecule inhibitors.

2. Screening of Small molecule Compounds

1) Taking cells in logarithmic growth phase (LNCaP cell line), digesting with 0.25% trypsin and gently blowing to make them into single cells, counting viable cells, adjusting cell density to 1 × 10 with DMEM culture solution containing 10% fetal calf serum ⁴ cell/L.

2) After 10mL of the culture medium and 10mL of the cell dilution were mixed at a ratio of 1:1, 0.2mL of the mixture was added to each well of a 96-well plate, and 3 replicate wells were obtained. Placing at 37 ℃ and 5% CO ₂ Incubate in an incubator for 12 hours.

3) Small molecule inhibitor drugs screened against CREPT, totaling 15 candidate compounds, drugs were dissolved using DMSO, each drug was used at the initial screen concentration: 5 μ M. 3 replicates for each compound; each drug concentration was 5. mu.M for 3 days, and then cell proliferation was measured using CCK.

Before measurement, each well was replaced with 10. mu.L of CCK-8 solution and 90. mu.L of complete medium mixed well (wells to which corresponding amounts of CCK-8 solution and cell culture medium were added as blank control). Incubate at 37 ℃ for 3 hours. The absorbance at a wavelength of 450nm was measured. And calculating and counting the results. Referring to fig. 9, the predicted and screened drugs have certain inhibitory effect on prostate cancer cells, wherein the compound shown in the following formula (I) (number 5 in fig. 9) has the best effect; the compounds represented by the following formula (II) (No. 14 in FIG. 9) and the compounds represented by the following formula (III) (No. 15 in FIG. 9) also have a significant inhibitory effect.

3. Small molecule compound IC ₅₀ Measurement of (2)

IC of small molecule compounds ₅₀ The assay was essentially as described above for the "screening of small molecule compounds" except that: selecting compounds with better cell proliferation effect (compounds shown in formula (I), formula (II) and formula (III)), and sequentially according to different concentrations: cell proliferation was measured after 3 days of incubation at 0.25. mu.M, 0.5. mu.M, 1. mu.M, 5. mu.M, 10. mu.M. And calculating and counting results. The results are shown in FIGS. 10A to 10C, and the compound IC represented by the formula (I) ₅₀ 0.6874 mu M, it can be seen that the compound of formula (I) has a better effect of inhibiting the proliferation of prostate cancer cells. The IC50 values of the compound shown in the formula (II) and the compound shown in the formula (III) are 14.87 mu M and 11.73 mu M respectively, the concentration is too high, the pharmacy is poor, and the toxicity is likely to be relatively high. The inhibition of the compounds of formula (I) will then be further tested by colony formation experiments.

4. Small molecule compound has clone forming effect on prostate cancer cells

1) Taking cells in logarithmic growth phase (LNCaP cell line), digesting with 0.25% trypsin and gently blowing to make them into single cells, counting viable cells, adjusting cell density to 1 × 10 with DMEM culture solution containing 20% fetal calf serum ⁶ cell/L. Then, the plates were laid according to the experimental requirements.

2) After 4mL of the culture medium and 4mL of the cell diluent were mixed at a ratio of 1:1, 1mL of the mixture was added to each well of a six-well plate, and 3 replicate wells were used in total. 3 times of the compound shown in the formula (I); the drug concentration is 2 μ M, the drug is added on the day of inoculation, and 2 μ M is replaced every two daysThe culture solution of the drug is placed at 37 ℃ and 5% CO ₂ Incubate in incubator for 8 days.

3) When the clone size is proper, discarding cell clone supernatant, adding 0.1% crystal violet solution for dyeing for 1h, and washing off redundant dye solution with running water.

4) The plate was placed on a scanner and the cell clone number was observed.

The results are shown in fig. 11, and the CREPT small molecule inhibitor (the compound shown in formula (I)) can inhibit the formation of cell clones.

The above description of example embodiments has been presented only to illustrate the technical solutions of the present disclosure, and is not intended to be exhaustive or to limit the disclosure to the precise forms described. Obviously, many modifications and variations are possible in light of the above teaching to those skilled in the art. The exemplary embodiments were chosen and described in order to explain certain principles of the disclosure and its practical application to thereby enable others skilled in the art to understand, implement and utilize the various exemplary embodiments of the disclosure and various alternatives and modifications thereof. It is intended that the scope of the disclosure be defined by the following claims and their equivalents.

Sequence listing

<110> Qinghua university

<120> use of CREPT in the treatment of prostate cancer

<130> 2253134IP-2

<150> CN202210621946.4

<151> 2022-06-01

<160> 5

<170> PatentIn version 3.5

<210> 1

<211> 59

<212> DNA

<213> Artificial sequence

<220>

<223> shRNA1

<400> 1

ccggcggcag cagtatattc tgaaactcga gtttcagaat atactgctgc cgttttttg 59

<210> 2

<211> 59

<212> DNA

<213> Artificial sequence

<220>

<223> shRNA2

<400> 2

ccgggcacga agattaggtg catttctcga gaaatgcacc taatcttcgt gcttttttg 59

<210> 3

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> sgRNA

<400> 3

gcggtgccac acggagacga t 21

<210> 4

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> sgRNA upstream sequence in vector

<400> 4

caccgcggtg ccacacggag acgat 25

<210> 5

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> sgRNA downstream sequence in vector

<400> 5

aaacatcgtc tccgtgtggc accgc 25

Claims

1. Use of any one of the following (i) to (iii):

(i) the use of CREPT gene or its expression product as target in the preparation of medicament for treating prostate cancer;

2. The use of claim 1, wherein the CREPT gene expression product is selected from the group consisting of: cDNA, mRNA, CREPT precursor protein, mature CREPT protein, and fragments thereof.

3. The use of claim 1 or 2, wherein the prostate cancer comprises one or more of adenocarcinoma, ductal adenocarcinoma, urothelial carcinoma, squamous cell carcinoma, and adenosquamous carcinoma; and/or the presence of a gas in the gas,

the prostate cancer is castration resistant prostate cancer.

4. The use of any one of claims 1-3, wherein the treatment comprises one or more of inhibiting prostate cancer cell proliferation, inhibiting prostate cancer clonality, inhibiting prostate tumorigenesis, and inhibiting prostate cancer tumor growth.

5. The use of any one of claims 1 to 4, wherein the prostate cancer is prostate cancer in a subject;

preferably, the subject comprises a mammal;

more preferably, the subject is a human.

6. The use of any one of claims 1 to 5, wherein the agent targeting the CREPT gene or expression product thereof is selected from the group consisting of: nucleic acids, polypeptides, ribonucleoprotein complexes or small molecule drugs;

preferably, the polypeptide is selected from an antibody or antigen-binding fragment thereof;

preferably, the nucleic acid is selected from the group consisting of DNA, RNA, DNA/RNA;

preferably, the ribonucleoprotein complex is selected from the group consisting of CRISPR/cas system;

more preferably, the agent targeting the CREPT gene or its expression product is selected from the group consisting of: antisense oligonucleotides, siRNA, dsRNA, ribozymes, esiRNA, shRNA, CRISPR/cas systems, small molecule drugs.

7. The use of any one of claims 1-6, wherein the CREPT gene or its expression product targeting agent comprises shRNA, the sequence of which is shown in SEQ ID No. 1 or SEQ ID No. 2; and/or the presence of a gas in the atmosphere,

the agent targeting CREPT gene or its expression product comprises CRISPR/cas system, wherein sgRNA sequence in the CRISPR/cas system is shown in SEQ ID No. 3; and/or the presence of a gas in the gas,

the agent targeting CREPT gene or its expression product contains small molecule drug as shown in the following formula (I),

8. use according to any one of claims 1 to 7, wherein the screening device comprises a detection agent for determining the level or activity of a CREPT gene or its expression product, preferably selected from the group consisting of: primers, probes, antibodies or antigen-binding fragments thereof specific for the CREPT gene or its expression products.

9. An agent that targets a CREPT gene or its expression product, which is capable of modulating the level or activity of a CREPT gene or its expression product, wherein:

the CREPT gene expression product is selected from: cDNA, mRNA, CREPT precursor protein, mature CREPT protein, and fragments thereof;

the agent targeting the CREPT gene or its expression product is selected from the group consisting of: nucleic acids, polypeptides, ribonucleoprotein complexes or small molecule drugs; preferably, the polypeptide is selected from an antibody or antigen-binding fragment thereof; preferably, the nucleic acid is selected from the group consisting of DNA, RNA, DNA/RNA; preferably, the ribonucleoprotein complex is selected from the group consisting of CRISPR/cas system;

10. The agent for targeting CREPT gene or its expression product of claim 9, wherein the agent for targeting CREPT gene or its expression product comprises shRNA, the sequence of which is shown in SEQ ID No:1 or SEQ ID No: 2; and/or the presence of a gas in the gas,

the agent targeting CREPT gene or its expression product comprises CRISPR/cas system, wherein sgRNA sequence in the CRISPR/cas system is shown in SEQ ID No. 3; and/or the presence of a gas in the atmosphere,

11. an expression vector for regulating the level or activity of a CREPT gene or an expression product thereof, which encodes an agent targeting a CREPT gene or an expression product thereof as claimed in any one of claims 9-10.

12. A pharmaceutical composition for treating prostate cancer, comprising: an agent targeting a CREPT gene or expression product thereof according to any one of claims 9 to 10; and the number of the first and second groups,

optionally, a pharmaceutically acceptable carrier.

13. A method of treating prostate cancer comprising the step of administering a therapeutically effective amount of an agent that targets the CREPT gene or expression product thereof;

optionally, the agent targeting CREPT gene or its expression product is the agent targeting CREPT gene or its expression product described in any one of claims 9-10.

14. A method of screening and/or identifying a drug for treating prostate cancer, comprising:

contacting the material to be screened with prostate cancer cells;