CN102218147A - Use of epstein-barr virus miR-BART7 antisense oligonucleotide in preparing drugs for treating nasopharyngeal carcinoma - Google Patents
Use of epstein-barr virus miR-BART7 antisense oligonucleotide in preparing drugs for treating nasopharyngeal carcinoma Download PDFInfo
- Publication number
- CN102218147A CN102218147A CN 201110122246 CN201110122246A CN102218147A CN 102218147 A CN102218147 A CN 102218147A CN 201110122246 CN201110122246 CN 201110122246 CN 201110122246 A CN201110122246 A CN 201110122246A CN 102218147 A CN102218147 A CN 102218147A
- Authority
- CN
- China
- Prior art keywords
- antisense oligonucleotide
- bart7
- epstein
- mir
- polymine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention relates to a medicinal use of an epstein-barr virus (EBV) miR-BART7 antisense oligonucleotide, in particular to the use of the EBV miR-BART7 antisense oligonucleotide in preparing drugs for treating nasopharyngeal carcinoma (NPC). A sequence of the antisense oligonucleotide is CCCUGGACACUGGACUAUGAUG (SEQ ID NO:1). With the present invention, the antisense oligonucleotide can be effectively bound with mature miRNA of the EBV to block an expression of the mature miRNA and a corresponding regulatory effect such that an invasion and a metastasis of NPC cells are inhibited, and the miRNA has no immunogenicity so as to facilitate further use for prevention and cure of recurrence and metastasis of the NPC. According to the medicine prepared through the antisense oligonucleotide provided by the present invention, the antisense oligonucleotide can be protected from a degradation through nuclease, action time can be prolonged, a higher transfection efficiency of the antisense oligonucleotide than the transfection efficiency of commercial liposomes is provided so as to facilitate further practical clinic development and application.
Description
Technical field
The invention belongs to and contain the unitary chemical compound of two or more mononucleotides field, particularly relate to chemical compound with the independent phosphate-based or polyphosphoric acid ester group that connects with the saccharide radical of nucleoside base.
Background technology
Nasopharyngeal carcinoma (NPC) is the common head-neck malignant tumor of China's southern area, be relapse rate and the highest disease of the rate of transform in the tumor of head and neck, the cervical lymph node rate of transform is up to 80%, cure and still have 20～30% patients the recurrence and the transfer of nasopharyngeal carcinoma to occur in back 5 years, be to cause one of dead principal element clinically, the traditional treatment means are as operation, radiotherapy or chemotherapy etc. are to preventing and treating the recurrence of nasopharyngeal carcinoma, transfer effect is undesirable, comparatively speaking, the applying biological Therapeutic Method is more suitable for the treatment of second stage, and wherein gene therapy is to preventing and treating the recurrence of nasopharyngeal carcinoma, transfer has prior clinical meaning.
(Epstein Barr virus EBV) is a kind of gamma herpes viruses to Epstein-Barr virus, and nearly all not differentiation is all relevant with the Epstein-Barr virus latent infection with low differentiation nasopharyngeal carcinoma.Recently the miRNA that discovers Epstein-Barr virus coding can participate in the gene of Epstein-Barr virus coding and human host's expression of gene EBV-miR-BART2 can be complementary fully with the 3`UTR of the gene BALF5 of coding viral dna polymerase.When a large amount of virus replication of cracking infection period, the miR-BART2 expression reduces, and the decomposition of BALF5 gene is weakened, and helps the virus replication circulation.Along with the miR-BART2 selection pressure changes, BALF5 expresses reduction, and the virion that the EBV infection cell discharges constantly reduces, and infects entering latency (Nucleic Acids Res 37:1035-48,2009); EBV-miR-BHRFI-3 is relevant with the expression of the inductive T cell chemotactic factor of cell IFN CXCL-11/I-TAC, infer that CXCL-11/I-TAC is the miR-BHRFl-3 action target spot, Epstein-Barr virus can this disturb host's immune surveillance and immune clearance effect (Cancer Res 68:1436-42,2008) as regulative mode; EBV-miR-BART5 can raise the expression of P53 by albumen PUMAHl before the apoptosis that suppresses the host.If from the cell that EBV infects, remove miR-BART5, will promote the effect of PUMA mediated Apoptosis, prompting EBV can suppress the generation of apoptosis, thereby protect epithelial cell (the J Exp Med 205:2551-60 of its infection, 2008, J Biol Chem 285:33358-70,2010); MiR-BART6-5p can suppress the expression of EBNA2 viral oncogene, and I type that is expressed in of this oncogene and II type latency (immune low reaction) are indispensable in the process that III type latency (the high reaction of immunity) transforms, show miR-BART6 performance important regulatory role (J Biol Chem 285:33358-70,2010) and in hiding in the infection of EBV.This shows that Epstein-Barr virus miRNA can act on the one hand the target gene of virus itself, promote the infection of virus and hide, also can act on host's target gene on the other hand, promote virus to escape the immunoreation of host cell, and suppress the apoptosis of host cell.
Yet, the effect of relevant Epstein-Barr virus miR-BART7 and Study on Mechanism are but seldom, the miRNA (miR-BART1-5p, miR-BART16 and miR-BART17-5p) of 3 kinds of Epstein-Barr virus codings of Lo etc. (PNAS 104:16164-9,2007) report can reduce the LMP1 expression of gene of Epstein-Barr virus.When LMP1 was subjected to viral miRNA regulation and control, its downstream signal approach can be suppressed, and NF-KB expresses reduction, and apoptosis is suppressed, and the cell that makes ebv infection is easily to tumor development (Cell Mol Immunol 4:185-96,2007).Other has report EBV-miR-BART1 to combine with BBLF4 and LMP2A mRNA 3 ' end, thus reach the purpose of regulating viral autogene and expressing (PNAS, 1993,90:378-382).Importantly, up to now, about any report is not seen in the effect of Epstein-Barr virus miR-BART7 and the especially short nasopharyngeal carcinoma Invasion and Metastasis of other Epstein-Barr virus miRNA promotion nasopharyngeal carcinoma generation development yet.
Nano-particle has advantages such as small-size effect, skin effect, by strengthening infiltration and stick effect (EPR) target tumor zone effectively, the Recent study nano medicament carrying system is applied to oncotherapy becomes focus (Biomacromolecules.11,3531-3538,2010).Nano-particle can wrap up, concentrate, protects nucleotide, makes it avoid nuclease degradation; By surface-functionalized, can connect the special target molecule; The body-internal-circulation time obviously is longer than the common size granule, and the following nano-particle of 100nm can be escaped engulfing of reticuloendothelial system, thereby prolongs administration time, improves administering effect; Suitable nano gene medicine can either be brought into play the advantage of the external efficient transfection of cationic polymer, also can effectively avoid the removing of reticuloendothelial system in the experimentation in the body, improve therapeutic effect, therefore nanotechnology is applied to gene therapy has the good clinical application prospect.Particle diameter is that the gold grain (AuNP) of 1nm～150nm is an inert substance, nontoxic, preparation method is simple, cost is lower, have special optical property and excellent biological compatibility and surface and be easy to advantages such as functionalization, can combine, be widely used in biomedical sector (Adv.Drug Deliv.Rev.60 such as immune labeled, biochip, bio-sensing and delivery system with drug molecule, biomacromolecule etc., 1307-1315,2008).Be carrier with the gold nano grain in recent years, the base group modification of suitable functionalization is carried out on the surface, and further load AMO, siRNA etc. carry out gene therapy and obtained many gratifying achievements again.Research team of Northwestern Univ USA, use 13nm left and right sides gold grain and stablize multiply sulfhydrylation oligonucleotide, making it advance cell ability strengthens greatly, the nucleic acid (mRNAs) that can be tied to the target courier makes its down-regulated expression, and has nuclease-resistant character, transfection efficiency is higher than not oligonucleotide and the commodity transfection lipid carrier Lipofectamine2000 (Science.312,27-30,2006) through modifying; The gold nano grain that Klibavov group will have low-molecular-weight PEI (2KDa) advances monkey-kidney cells COS-7 as carrier transfection plasmid DNA, not only increased the effective molecular weight of PEI but also reduced its cytotoxicity, the more single PEI of transfection efficiency has increased by 12 times (Proc.Natl.Acad.Sci.USA.100 (16): 9138-9143,2003).
Summary of the invention
The object of the present invention is to provide a kind of medicinal usage of Epstein-Barr virus miR-BART7 antisense oligonucleotide, the medicine that embodies this purposes can combine with Epstein-Barr virus miR-BART7 effectively, the expression of blocking-up miR-BART7 and to the regulation and control facilitation of nasopharyngeal carcinoma Invasion and Metastasis, thus reach the purpose of anti-nasopharyngeal carcinoma Invasion and Metastasis and treatment nasopharyngeal carcinoma.
The medicinal usage of above-mentioned Epstein-Barr virus miR-BART7 antisense oligonucleotide specifically is, the application of Epstein-Barr virus miR-BART7 antisense oligonucleotide in the medicine of the anti-nasopharyngeal carcinoma Invasion and Metastasis of preparation, and the sequence of wherein said antisense oligonucleotide is
CCCUGGACACUGGACUAUGAUG(SEQ?ID?NO：1)。
Antisense oligonucleotide of the present invention adopts this area conventional method synthetic, as, adopt the nucleic acid synthesizer synthetic earlier, again through simple strand chemical modification (as, 2 '-methoxy is modified, and becomes the enhancement mode oligonucleotide) and the HPLC purification make.The method that the inventor recommends is made up of following steps:
1. the design of antisense oligonucleotide probe
(1.1) according to the Epstein-Barr virus miR-BART7 sequence among the public sanger mirbase data base in the world, carry out the antisense design, obtain Antisensedigonucleotsequence sequence; Wherein the basic principle of probe design is, 1) hairpin structure of probe interior is no more than 2; 2) through BLAST relatively with the similarity of other sequence less than 20%; 3) relatively be no more than 3 bases continuously through BLAST with the repetition of other gene order;
(1.2) adopt 21-23 nt 2`-methoxy to modify, obtain sequence shown in the SEQ ID NO:1;
2. antisense oligonucleotide probe synthesizes and purification
(2.1) sequence shown in the SEQ ID NO:1 is imported 3900 synthesizers and synthesized automatically, obtain containing the synthetic post of the antisense oligonucleotide of sequence shown in the SEQ ID NO:1;
(2.2) synthetic post is carried out eluting and collects eluent, then, freezing, dry, deammoniation water is dissolved in 9: 1 the first phthalein amine and TBE mixed solution;
(2.3) be splined on HPLC and carry out purification;
(2.4) obtain the antisense oligonucleotide that sequence is SEQ ID NO:1 after alcohol precipitation, washing, vacuum are drained ,-20 ℃ of preservations are standby.
The present invention utilizes transfer and invasion and attack test (Transwell experiment and the experiment of Boyden cell) analysis to find to be invasion and attack and the transfer that the Epstein-Barr virus miR-BART7 that highly expresses can obviously promote nasopharyngeal carcinoma cell in nasopharyngeal carcinoma cell.After the miR-BART7 transfection of Epstein-Barr virus coding advanced human nasopharyngeal epithelioma 1 CNE1, compare with the CNE1 cell strain that does not have transfection Epstein-Barr virus miR-BART7, the quantity of cell-penetrating filter membrane and matrix membrane significantly increases, and shows the migration and the invasion and attack of this miRNA regulation and control promotion nasopharyngeal carcinoma cell.
The inventor with Epstein-Barr virus miR-BART7 antisense oligonucleotide effect nasopharyngeal carcinoma cell after, Epstein-Barr virus miR-BART7 expression generation significant difference changes (Welch/F=104.400, P=0.000), 24h and 48h disturb and suppress efficient and all can reach more than 80% (show that its Antisense Suppression effect can keep at least two days), show that the quantity of passing filter membrane and matrix membrane obviously reduces through the obviously reduction of transfer invasive ability appearance of the nasopharyngeal carcinoma cell of Epstein-Barr virus miR-BART7 antisense oligonucleotide effect.
The medicine of treatment nasopharyngeal carcinoma of the present invention by Epstein-Barr virus miR-BART7 antisense oligonucleotide and pharmaceutically the acceptable excipient form.
In order to improve drug effect, preferably earlier Epstein-Barr virus miR-BART7 antisense oligonucleotide is adsorbed on the nanosphere, and then the adding appropriate excipients is made needed dosage form.
The particle diameter of nanosphere of the present invention is 30nm～50nm, and this nanosphere is that polymine, Epstein-Barr virus miR-BART7 antisense oligonucleotide and the poly glycol monomethyl ether of 2Kda and the copolymer of branched chain type polymine are formed by the nanometer gold that contains sulfydryl, molecular weight; Described nanosphere can be prepared by following method:
(a) will contain the nanometer gold of sulfydryl and quality is that the molecular weight that contains 10 times of the nanometer gold of sulfydryl is that the polymine of 2Kda adds in the 1mM NaCl solution, room temperature reaction 30 minutes down, and centrifugal purification separates and obtains polymine parcel nanometer gold;
(b) be that the sequence that contains 60 times of the nanometer gold of sulfydryl is that the antisense oligonucleotide of SEQ ID NO:1 adds in the 1mM NaCl solution with the polymine parcel nanometer gold of step (a) preparation and quality, room temperature reacted 30 minutes down, and the centrifugal purification separation obtains load antisense oligonucleotide nano gold;
(c) be to contain the poly glycol monomethyl ether of 7 times of nanometer gold of sulfydryl and the copolymer of branched chain type polymine adds in the 1mM NaCl solution with load antisense oligonucleotide nano gold, the quality of step (b) preparation, room temperature reacted 30 minutes down, and the centrifugal purification separation obtains nanosphere; Wherein, the molecular weight of poly glycol monomethyl ether is 2Kda, and the molecular weight of branched chain type polymine is 25Kda, and the ratio of poly glycol monomethyl ether and the amount of substance of branched chain type polymine is 1: 1.5.
In the preparation method of above-mentioned nanosphere, but the report of the preparation method reference literature of described copolymer (as: Macromolecules, 35,6867-6874,2002).
In the preparation method of above-mentioned nanosphere, the described particle diameter that contains the nanometer gold of sulfydryl is 15～20nm.Wherein, the described nanometer gold that contains sulfydryl can be according to this area method preparation commonly used, the report (as: ACS Nano, 4 (9): 5505-5511,2010) that concrete steps can reference literature.
The miRNA of antisense oligonucleotide of the present invention Epstein-Barr virus coding capable of blocking duplicates, survives and expresses, its base sequence combines with the sequence of reverse complemental, have the specificity higher than antibody, make the nasopharyngeal carcinoma Invasion and Metastasis be subjected to effective inhibition, and the miRNA non-immunogenicity helps preventing and treating better the recurrence and the transfer of nasopharyngeal carcinoma.Further; the present invention is prepared into the nano gene medicine with described antisense oligonucleotide, avoids nuclease degradation with the protection antisense oligonucleotide, prolongs action time; with liposome higher transfection efficiency is arranged than commodity, help further clinical practice development and application.
Description of drawings
Fig. 1 is the rectangular histogram of Epstein-Barr virus miR-BART7 antisense oligonucleotide Transwell shift experiment of the present invention, Control is not for adding the human nasopharyngeal epithelioma 1 Transwell shift experiment result of antisense oligonucleotide among the figure, and BART7-AMO is the human nasopharyngeal epithelioma 1 Transwell shift experiment result after the effect of antisense.
Fig. 2 is the rectangular histogram of Epstein-Barr virus miR-BART7 antisense oligonucleotide Boyden cell invasion and attack experiment of the present invention, Control is not for adding the human nasopharyngeal epithelioma 1 Boyden cell invasion and attack experimental result of antisense oligonucleotide among the figure, and BART7-AMO is the human nasopharyngeal epithelioma 1 Boyden cell invasion and attack experimental result after the effect of antisense.
The specific embodiment
Embodiment 1
1, contains the preparation of the human nasopharyngeal epithelioma 1 CNE1 of EBV-miR-BART7;
Cell:
CNE1 cell strain: available from Hunan Xiangya Medical College, Zhongnan Univ central laboratory.
Cross the CNE1 cell preparation of expressing miR-BART7: chemosynthesis Epstein-Barr virus miR-BART7 precursor molecule sequence (282bp), be connected among the slow virus carrier pMAGic 4.0 that contains the GFP expression, through pNL-EGFP/CMV/WPREDU3 vector plasmid, pCD/NL-BH*DDD packaging plasmid and pLTR-G plasmid, packing in the 293T cell, generation can be expressed slow virus carrier pMAGic-EB virus-miR-BART7 of EBV-miR-BART7.With this slow virus carrier transfection human nasopharyngeal epithelioma 1 CNE1, through the streaming sub-sieve, quantitative PCR confirms, obtains the CNE1 (containing GFP expresses) that Epstein-Barr virus miR-BART7 stablizes high expressed.Concrete steps can reference literature (Nanfang Medical Univ's journal 2011; 31 (3): 419).
Oligonucleotide: the sequence of Epstein-Barr virus miR-BART7 antisense oligonucleotide is SEQ ID NO:1, entrusts Shanghai JiMa pharmacy Technology Co., Ltd synthetic.
In addition, for the miR-BART7 of Epstein-Barr virus coding and the biological activity test of antisense oligonucleotide thereof, be that carrier carries out transfection all with commercialization liposome Lipofectamine2000.
Epstein-Barr virus miR-BART7 antisense oligonucleotide suppresses the active assay method of Epstein-Barr virus miR-BART7:
(1) cell transfecting: get monolayer and cross the human nasopharyngeal epithelioma 1 of expressing miR-BART7, be inoculated in 6 orifice plates not contain antibiotic 10% calf serum complete medium (PBR1640 or DMEM) cultivation, 37 ℃, 5% CO
2Overnight incubation, next day, lipofectamine 2000 is diluted with anteserum-less substrate in every hole, incubated at room 5min, simultaneously with anteserum-less substrate dilution Epstein-Barr virus miR-BART7 antisense oligonucleotide, the lipofectamine 2000 of mixed diluting and the Epstein-Barr virus miR-BART7 antisense oligonucleotide of dilution, place 20min under the room temperature, 6 orifice plate cells wash 2 times after removing the training base, after adding the 2mL anteserum-less substrate, mixed liquor is added in every hole mixing gently, 37 ℃, after 5% CO2 incubator is hatched 6h, replacing contains the full culture medium of 10% calf serum, uses the transfection level of fluorescence quantitative PCR detection different time.
(2) fluorescence quantitative PCR detection transfection level: the vessel of the RNA that is useful on preparation all through going RNase to handle, required liquid is all prepared with the DEPC water of deactivation.The extracting of cell total rna is carried out according to TRIzol reagent description.The human nasopharyngeal epithelioma 1 of trophophase of taking the logarithm is cultured to cell density to be measured, PBS with pre-cooling washes 2 times, add 1mL TRIzol, lysate is transferred to 1.5mL EP pipe after leaving standstill 5min on ice, add chloroform 0.2mL, violent jolting 15sec, room temperature is placed the centrifugal 15min of 12000rpm 4oC after 5 minutes, sucking-off upper strata water, lower floor is transferred to another 1.5ml EP pipe, adds isopropyl alcohol by equal proportion, and room temperature leaves standstill 5min behind the mixing, centrifugal 30min, 75% washing with alcohol precipitation, centrifugal 10 minutes, lower floor is natural drying 5-10min in super-clean bench, treat that the ethanol volatilization is back with an amount of DEPC water dissolution ,-80 ℃ of preservations are standby.A260 and A280 are measured in RNA specimen dilution back, calculate RNA concentration and purity, and electrophoresis detection RNA has or not degraded in 1% agarose gel.Detect intact RNA and be used to carry out reverse transcription reaction, carry out the synthetic of cDNA according to the TIANScript cDNA first chain synthetic agent box.Use the transfection level of fluorescence quantitative PCR detection different time.
2, the experiment of Epstein-Barr virus miR-BART7 antisense oligonucleotide anti-nasopharyngeal cancer cell invasion and attack;
Prepare artificial basement membrane with matrigel chamber on Transwell, respectively organizing cell before and after the transfection, to be diluted to density with anteserum-less substrate be 1 * 10
6The cell suspension of/ml, 100 μ L cell suspension add Transwell and go up the chamber, and following chamber adds 600 μ L conditioned mediums, 37 ℃ 5%, CO
2After incubator is hatched 36h, take out the Transwell cell, inhale and abandon liquid, clean Matrigel with cotton swab, formaldehyde fixed 30min after the PBS rinsing, brazilwood extract dyeing.Mirror is counting (4 visuals field of average counter) down, and more than experiment is independent repeats 3 times.The result as shown in Figure 1.Fig. 1 shows, compare with the human nasopharyngeal epithelioma 1 that has Epstein-Barr virus miR-BART7, cell after the effect of antisense of Epstein-Barr virus miR-BART7, cell-penetrating filter membrane quantity reduces, have significant difference (P＜0.0000), illustrate that the antisense oligonucleotide of Epstein-Barr virus miR-BART7 has suppressed the migration of nasopharyngeal carcinoma cell.
3, Epstein-Barr virus miR-BART7 antisense oligonucleotide suppresses the experiment that nasopharyngeal carcinoma cell shifts.
Identical with Transwell invasion and attack experiment, just Transwell goes up the chamber and need not cover experiment independent repetition 3 times with artificial basement membrane.The result as shown in Figure 2.Fig. 2 shows, compare with the human nasopharyngeal epithelioma 1 that has Epstein-Barr virus miR-BART7, cell after the effect of antisense of Epstein-Barr virus miR-BART7, cell-penetrating matrix membrane quantity reduces, have significant difference (P＜0.0000), illustrate that the antisense oligonucleotide of Epstein-Barr virus miR-BART7 has suppressed the invasion and attack of nasopharyngeal carcinoma cell.
Can know that from Fig. 1 and Fig. 2 Epstein-Barr virus miR-BART7 antisense oligonucleotide has suppressed the migration and the invasion and attack of nasopharyngeal carcinoma cell, have treatment nasopharyngeal carcinoma effect.
Embodiment 2
1. the preparation of nanosphere
1.1 preparation polymine parcel nanometer gold
The nanometer gold adding concentration that will contain sulfydryl is the NaCl solution of 1mM, and adjusting nanometer gold concentration is 0.1mg/mL; In reactant liquor, add polymine (PEI, Mw=2k) to polymine concentration be 1.0mg/mL, normal-temperature reaction 30 minutes with centrifugal 10 minutes of 157500xg, repeats 2 times, prepares polymine and wraps up gold nano; Polymine is wrapped up nanometer gold be resuspended in the NaCl solution that concentration is 10mM, obtain 0.1mg/mL polymine parcel nanometer gold NaCl solution, stand-by;
The nanometer gold that wherein contains sulfydryl can prepare according to following method:
Get 100mL aqueous solution of chloraurate (0.01%), be heated to and boil, stir and accurately add 1% trisodium citrate aqueous solution 2mL down, flavous aqueous solution of chloraurate became orange red in 5 minutes, continued to boil 15 minutes, after the cooling, remove macroparticle, return to original volume with distilled water with the filter membrane of 220nm; Getting freshly prepd aurosol solution, to adjust pH value with the NaOH solution of 1N be 11, and adding 11-sulfydryl hendecanoic acid is 0.1mg/mL to final concentration, and stirring at normal temperature is spent the night, and with centrifugal 10 minutes of centrifugal rotational speed 157500xg, repeats 2 times, obtains containing the sulfydryl nanometer gold.Detecting the nanometer gold particle diameter that contains sulfydryl through TEM is 15～20nm.
1.2. the nanometer gold of preparation load antisense oligonucleotide
Get 0.1mg/mL polymine parcel nanometer gold NaCl solution 5.5mL, adding sequence is the Epstein-Barr virus miR-BART7 antisense oligonucleotide 3.0mg of SEQ ID NO:1, and room temperature stirred 30 minutes down, uses centrifugal 10 minutes of 157500xg, repeat 2 times, obtain load antisense oligonucleotide gold nano.Load antisense oligonucleotide nano gold is resuspended in the NaCl solution that concentration is 10mM, obtains 0.1mg/mL load antisense oligonucleotide nano gold NaCl solution, stand-by;
1.3. preparation nanosphere
Get 0.1mg/mL load antisense oligonucleotide nano gold NaCl solution 10mL, adding molecular weight is the poly glycol monomethyl ether 5mg of 2Kda and the branched chain type polymine 93.6mg that molecular weight is 25Kda, and normal-temperature reaction 30 minutes is used centrifugal 10 minutes of 157500xg, repeat 2 times, obtain nanosphere.Nanosphere is added the NaCl solution that concentration is 10mM, and sealing is preserved.
2. nanosphere Performance Detection
Use the demonstration absworption peak of ultraviolet light spectrophotometric determination nanosphere at 519nm and 260nm place.Wherein, 519nm place absworption peak is the characteristic absorption peak of nanometer gold; 260nm place absworption peak is the nucleic acid characteristic absorption peak.
Utilize transmission electron microscope (TEM) to observe the carrying medicament nanosphere, particle diameter is 30～50nm.
3. Epstein-Barr virus miR-BART7 effect in the inhibition nasopharyngeal carcinoma cell
Expression and effective acting time that this antisense oligonucleotide nano ball of the antisense oligonucleotide of sequence SEQ ID NO:1 and load suppresses Epstein-Barr virus miR-BART7 among the nasopharyngeal carcinoma cell CNE1
3.1 nanosphere suppresses Epstein-Barr virus miR-BART7 experiment in the nasopharyngeal carcinoma cell:
Get monolayer and cross the nasopharyngeal carcinoma CNE1 cell strain of expressing miR-BART7, be inoculated in 6 orifice plates not contain antibiotic 10% calf serum PBR1640 culture medium culturing, 37 ℃, 5% CO2 overnight incubation, next day, 6 orifice plate cells wash 2 times after removing the training base, and every hole adds 2mL and is loaded with antisense oligonucleotide nano ball (containing antisense oligonucleotide 5nmol) with the anteserum-less substrate dilution, mixing gently, 37 ℃, after 5% CO2 incubator is hatched 6h, change and contain the full culture medium of 10% calf serum.Simultaneously, with Lipofectamine2000 transfection Epstein-Barr virus miR-BART7 antisense oligonucleotide sample in contrast, the cell of untransfected Epstein-Barr virus miR-BART7 antisense oligonucleotide compares experiment as blank sample.In whole experiment, collect transfection respectively before, the cell after the transfection when 24h and 48h.
3.2. the application fluorescence quantitative PCR detection is to inhibition effect and the effective acting time of Epstein-Barr virus miR-BART7
3.2.1 the cell of collecting is carried out total RNA extracting respectively
The human nasopharyngeal epithelioma 1 of trophophase of taking the logarithm is cultured to cell density to be measured, PBS with pre-cooling washes 2 times, add 1mLTRIzol, lysate is transferred to 1.5mL EP pipe after leaving standstill 5min on ice, add chloroform 0.2mL, violent jolting 15sec, room temperature is placed 4 ℃ of following centrifugal 15min of 12000rpm after 5 minutes, sucking-off upper strata water, lower floor is transferred to another 1.5ml EP pipe, adds the equal proportion isopropyl alcohol, and room temperature leaves standstill 5min behind the mixing, centrifugal 30min, 75% washing with alcohol precipitation, centrifugal 10 minutes, lower floor is natural drying 5～10min in super-clean bench, treat that ethanol volatilization back obtains total extracting RNA with the DEPC water dissolution ,-80 ℃ of preservations are standby.A260 and A280 are measured in total extracting RNA specimen dilution back, calculate RNA concentration and purity, and the total extracting RNA of electrophoresis detection has or not degraded in 1% agarose gel.
3.2.2. the expression of fluorescence quantitative PCR detection Epstein-Barr virus miR-BART7
3.2.2.1. according to TaqMan MiRNA Reverse Transcription Kit description, total extracting RNA specimen is carried out reverse transcription reaction, synthetic cDNA
(a) in the EP of DEPC water treatment pipe, add 10 * RT buffer, 1.5 μ l, dNTP 0.15 μ l, RNaseInhibitor 0.19 μ l, RT enzyme 1 μ l earlier; Add 3 μ l specificity RT primer, the total extracting RNA specimen of 5 μ l, mixing gently again.
(b) place 5min on ice after, place on the T1 Thermocycler PCR instrument, reaction condition be set be: 16 ℃ of 30min, 42 ℃ of 30min, 85 ℃ of 5min, 4 ℃ of terminations obtain reverse transcription cDNA.
3.2.2.2. quantitative fluorescent PCR reaction
According to TaqMan MiRNA Assay description, carry out the quantitative fluorescent PCR reaction: in 8 pipes, add Nuclease freewater 3.835 μ l, 2 * Master mix, 5 μ l, TaqMan MiRNA Assay (20 *) 0.5 μ l, reverse transcription cDNA0.665 μ l; Reaction condition is set is: 95 ℃ of pre-degeneration 10min; Be 95 ℃ of 15s, 60 ℃ of 60s then, 45 circulations are reacted on fluorescent quantitation Mx3000PCR instrument.Experiment all repeats 3 times.The result shows with the Ct value.Adopt the relatively Epstein-Barr virus miR-BART7 expression of collecting cell of relative quantification method.
Measurement result is as shown in table 1.By table 1 as seen, compare with blank, after the Lipofectamine2000 transfection, the antisense oligonucleotide of sequence SEQ ID NO:1 can effectively suppress the miR-BART7 expression at 24 hours, 48 hours, and corresponding Nano medication can reach better inhibition effect.Compare with liposome Lipofectamine2000 transfection effect with commodity, Nano medication has higher inhibition effect, prolongs effective acting time, and action time can be more than 48 hours.
The inhibition effect of table 1 nanosphere
Embodiment 3
Get the nanosphere of 40mg embodiment 1 preparation and the aseptic NaCl aqueous solution of 10mM of 500 μ l, add an amount of antiseptic and stabilizing agent, be formulated as injection.
Embodiment 4
Get in the nanosphere of 40mg embodiment 1 preparation and the aseptic NaCl aqueous solution of 10mM that ethylparaben 0.0135g is dissolved in 500 μ l, filtration under diminished pressure obtains spray.
Claims (3)
1.EB the application of viral miR-BART7 antisense oligonucleotide in the medicine of preparation treatment nasopharyngeal carcinoma, the sequence of wherein said antisense oligonucleotide is CCCUGGACACUGGACUAUGAUG (SEQ ID NO:1).
2. the described application of claim 1 is characterized in that, described medicine is described antisense oligonucleotide to be loaded to make nanosphere on the nanometer gold earlier, adds pharmaceutically the acceptable adjuvant again and makes.
3. the described application of claim 2, it is characterized in that, the particle diameter of described nanosphere is 30nm～50nm, and this nanosphere is that polymine, antisense oligonucleotide and the poly glycol monomethyl ether of 2Kda and the copolymer of branched chain type polymine are formed by the nanometer gold that contains sulfydryl, molecular weight; Described this nanosphere is prepared by following method:
(a) will contain the nanometer gold of sulfydryl and quality is that the molecular weight that contains 10 times of the nanometer gold of sulfydryl is that the polymine of 2Kda adds in the 1mM NaCl solution, room temperature reaction 30 minutes down, and centrifugal purification separates and obtains polymine parcel nanometer gold;
(b) be that the sequence that contains 60 times of the nanometer gold of sulfydryl is that the antisense oligonucleotide of SEQ ID NO:1 adds in the 1mM NaCl solution with the polymine parcel nanometer gold of step (a) preparation and quality, room temperature reacted 30 minutes down, and the centrifugal purification separation obtains load antisense oligonucleotide nano gold;
(c) be to contain the poly glycol monomethyl ether of 7 times of nanometer gold of sulfydryl and the copolymer of branched chain type polymine adds in the 1mM NaCl solution with load antisense oligonucleotide nano gold, the quality of step (b) preparation, room temperature reacted 30 minutes down, and the centrifugal purification separation obtains nanosphere; Wherein, the molecular weight of poly glycol monomethyl ether is 2Kda, and the molecular weight of branched chain type polymine is 25Kda, and the ratio of poly glycol monomethyl ether and the amount of substance of branched chain type polymine is 1: 1.5.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110122246 CN102218147A (en) | 2011-05-12 | 2011-05-12 | Use of epstein-barr virus miR-BART7 antisense oligonucleotide in preparing drugs for treating nasopharyngeal carcinoma |
| CN 201210140280 CN102641509B (en) | 2011-05-12 | 2012-05-08 | Application of Epstein barr (EB) virus miR-BART7 antisense oligonucleotide in preparing medicine capable of treating nasopharynx cancer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110122246 CN102218147A (en) | 2011-05-12 | 2011-05-12 | Use of epstein-barr virus miR-BART7 antisense oligonucleotide in preparing drugs for treating nasopharyngeal carcinoma |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102218147A true CN102218147A (en) | 2011-10-19 |
Family
ID=44775014
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110122246 Pending CN102218147A (en) | 2011-05-12 | 2011-05-12 | Use of epstein-barr virus miR-BART7 antisense oligonucleotide in preparing drugs for treating nasopharyngeal carcinoma |
| CN 201210140280 Expired - Fee Related CN102641509B (en) | 2011-05-12 | 2012-05-08 | Application of Epstein barr (EB) virus miR-BART7 antisense oligonucleotide in preparing medicine capable of treating nasopharynx cancer |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201210140280 Expired - Fee Related CN102641509B (en) | 2011-05-12 | 2012-05-08 | Application of Epstein barr (EB) virus miR-BART7 antisense oligonucleotide in preparing medicine capable of treating nasopharynx cancer |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN102218147A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110229898A (en) * | 2019-06-14 | 2019-09-13 | 福建省肿瘤医院（福建省肿瘤研究所、福建省癌症防治中心） | It is a kind of detect nasopharyngeal carcinoma marker and application |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2112235A1 (en) * | 2008-04-24 | 2009-10-28 | Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. | Compositions and methods for microRNA expression profiling of nasopharyngeal carcinoma |
-
2011
- 2011-05-12 CN CN 201110122246 patent/CN102218147A/en active Pending
-
2012
- 2012-05-08 CN CN 201210140280 patent/CN102641509B/en not_active Expired - Fee Related
Non-Patent Citations (1)
| Title |
|---|
| 《Oncogene 》 20041220 Dai Iwakiri et al Epstein-Barr virus-encoded small RNA induces insulin-like growth factor 1 and supports growth of nasopharyngeal carcinoma-derived cell lines 1767-1773 1-3 第24卷, * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110229898A (en) * | 2019-06-14 | 2019-09-13 | 福建省肿瘤医院（福建省肿瘤研究所、福建省癌症防治中心） | It is a kind of detect nasopharyngeal carcinoma marker and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102641509A (en) | 2012-08-22 |
| CN102641509B (en) | 2013-07-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108175759A (en) | A kind of antineoplastic target drug delivery system and preparation method and application | |
| Ma et al. | Structural optimization and additional targets identification of antisense oligonucleotide G3139 encapsulated in a neutral cytidinyl-lipid combined with a cationic lipid in vitro and in vivo | |
| CN108220293A (en) | A kind of small RNA and medical composition and its use | |
| CN108175861A (en) | A kind of delivery system of antitumor small nucleic acids drug and its application | |
| Yin et al. | Plasmid-based Stat3 siRNA delivered by functional graphene oxide suppresses mouse malignant melanoma cell growth | |
| Akao et al. | Potential use of fucose-appended dendrimer/α-cyclodextrin conjugates as NF-κB decoy carriers for the treatment of lipopolysaccharide-induced fulminant hepatitis in mice | |
| CN102188719B (en) | Application of EB virus miR-BART3 antisense oligonucleotides in preparing medicament for treating nasopharyngeal darcinoma | |
| CN103849652B (en) | A kind of nano-carrier complex for microRNA targeted delivery and preparation method thereof and application | |
| CN102908315B (en) | Chitosan (CS) nanoparticle delivery system of small molecular interfering ribonucleic acid and preparation method thereof | |
| CN110897998B (en) | Genetic engineering polypeptide nano hydrogel simultaneously loaded with hydrophobic drug and hydrophilic drug and preparation method thereof | |
| CN113170792A (en) | Preparation of nano prodigiosin preparation and application of nano prodigiosin preparation in prevention and treatment of vegetable economic crop virus diseases | |
| WO2023051822A1 (en) | Targeting oligonucleotide for treating diseases associated with pcsk9 | |
| CN102218147A (en) | Use of epstein-barr virus miR-BART7 antisense oligonucleotide in preparing drugs for treating nasopharyngeal carcinoma | |
| CN102218148A (en) | Use of epstein-barr virus miR-BART1-5p antisense oligonucleotide in preparing drugs for treating nasopharyngeal carcinoma | |
| CN114480394B (en) | Antisense oligonucleotide of SP1 and application thereof in preparation of medicines for inhibiting SP1 positive cancer nucleic acid | |
| CN113262307B (en) | Nano-composite carrier for transfection, nucleic acid nano-drug, preparation method and application thereof | |
| CN103804473B (en) | One peptide species and comprise the nucleic acid drug nanoparticle of this polypeptide | |
| CN101148680A (en) | Method for leading plasmid carrier containing gene cure segment in cell by nano particles | |
| CN101229183B (en) | Ribonucleic acid retrogradation snippet compound and applications thereof | |
| CN114869858B (en) | Nucleic acid-chemotherapeutic drug composite nano-particles coated by homologous cancer cell membrane | |
| WO2023138451A1 (en) | Sirna pharmaceutical composition for inhibiting her2 and her3 | |
| CN108939090B (en) | Liposome, preparation method and application | |
| WO2022206781A1 (en) | Rna delivery system for treating colitis | |
| CN115385988B (en) | MMP enzyme response type tumor targeting polypeptide carrier and application thereof | |
| CN108283646A (en) | Hsa-miRNA-155-5p is preparing the application in inhibiting human enterovirus 71 drug |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20111019 |