CN114989281A - Gene ZmEIN2-1 for controlling water content of corn kernels and molecular marker thereof - Google Patents

Gene ZmEIN2-1 for controlling water content of corn kernels and molecular marker thereof Download PDF

Info

Publication number
CN114989281A
CN114989281A CN202210595676.4A CN202210595676A CN114989281A CN 114989281 A CN114989281 A CN 114989281A CN 202210595676 A CN202210595676 A CN 202210595676A CN 114989281 A CN114989281 A CN 114989281A
Authority
CN
China
Prior art keywords
seq
leu
water content
corn
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202210595676.4A
Other languages
Chinese (zh)
Other versions
CN114989281B (en
Inventor
严建兵
李文强
金延辉
刘龙雨
吴伸伸
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Huazhong Agricultural University
Original Assignee
Huazhong Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Huazhong Agricultural University filed Critical Huazhong Agricultural University
Priority to CN202210595676.4A priority Critical patent/CN114989281B/en
Publication of CN114989281A publication Critical patent/CN114989281A/en
Application granted granted Critical
Publication of CN114989281B publication Critical patent/CN114989281B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Botany (AREA)
  • Immunology (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Mycology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a gene ZmEIN2-1 for controlling the water content of corn kernels, related molecular markers and application thereof in screening or improving the water content or dehydration rate traits of the corn kernels, belonging to the field of molecular genetics. The invention provides a sequence of a ZmEIN2-1 gene, and discloses 2 InDel sites which are remarkably related to the water content or dehydration rate of corn kernels in the ZmEIN2-1 gene: InDel _7/0 and InDel _ 303/000. The invention discloses a method for screening the moisture content or dehydration rate of corn kernels by using molecular markers developed based on the InDel _7/0 and InDel _303/000 loci. Furthermore, the invention discloses a method for regulating and controlling the water content or dehydration rate of corn kernels by changing the expression of ZmEIN2-1 protein through a genetic engineering means.

Description

Gene ZmEIN2-1 for controlling water content of corn grains and molecular marker thereof
Technical Field
The invention relates to a gene ZmEIN2-1 for controlling the water content of corn kernels, related molecular markers and application thereof in screening or improving the water content or dehydration rate of the corn kernels, belonging to the field of molecular genetics.
Background
The kernel moisture is a key factor influencing the mechanical harvesting quality, safe storage and economic benefit of the corn. The grain water content during harvesting has great influence on corn harvesting, drying, storage, transportation and processing utilization, and the excessively high water content causes economic loss to corn growers and operators, reduces economic benefit, and is easy to cause grain mildew and influence corn quality. In addition, corn kernel recycling has become one of the major factors limiting corn production in our country, and the most critical step in corn kernel recycling is that the water content of corn kernels at the time of recycling cannot reach the standard water content of less than or equal to 25% that can be achieved by the kernel recycling (Wang Z, Wang X, Zhang L, Liu X, Di H, Li T, Jin X. QTL undercut field yield after physical information in mail (Zea Mays L.) [ J ]. Euphytoica, 2012,185(3): clasping 528.). Therefore, the method is very important for breeding corn varieties with low kernel water content during harvesting. In addition, the low grain water content can shorten the growth cycle of the corn, which has great production significance for harvesting before the frost period in high latitude areas in China and for wheat planting in Huang-Huai-Hai areas without being influenced.
Some QTLs for controlling the moisture content and dehydration rate of corn grains are obtained in some current researches and distributed on 10 chromosomes of corn, wherein the QTL located on the No.1 chromosome mainly comprises: q45dGM1-1, qHTGM1-1, qHTGM1-2 and qAUDDC1-1(Zhang J, Zhang F, Tang B, Ding Y, Xia L, Qi J, Mu X, Gu L, Lu D, Chen Y. molecular mapping of qualitative trap location for Grain model and field map analysis in mail (Zea maps L.) [ J ]. physical Plant,2020,169, 1):64-72), mQTL1-1, mQTL1-2, mQTL1-3 and mL 1-4 (DeqY, Doy, Yang M, Wang Q, Shi Q, Zhou Q, Deng F, Qin Z, Qio H. Q, yu H, Liu Y, Deng S, Liu Q, Liu B, Xu M.genetic separation of grain water content and purification rate related to mechanical harvest in mail [ J ]. BMC Plant Biol,2020,20(1): 118). Meanwhile, studies have been conducted to clone ZmGAR2(Li W, Yu Y, Wang L, Luo Y, Peng Y, Xu Y, Liu X, Wu S, Jian L, Xu J, Xiao Y, Yan J. the genetic architecture of the dynamic changes in grain mobility in mail [ J ]. Plant Biotechnol J,2021,19(6): 1195-. Different genes for controlling the character are cloned, more effective gene resources and molecular markers can be provided for molecular breeding, breeding and creating different rapidly dehydrated corn materials.
Therefore, the invention utilizes the corn related population and the linked population to clone and position a new gene ZmEIN2-1 for controlling the water content and the dehydration rate of corn kernels through correlation analysis and by combining with a map, identifies a molecular marker linked with the gene and the marker, can screen the water content or the dehydration rate of the corn kernels, and cultivates a corn variety with low water content and high dehydration speed.
Disclosure of Invention
The invention aims to provide a nucleic acid sequence of a gene ZmEIN2-1 influencing the water content character of corn kernels and an amino acid sequence coded by the same.
The second purpose of the invention is to provide 2 molecular markers closely linked with the moisture content character of corn grains: InDel _7/0 and InDel _ 303/000.
The invention also aims to disclose a method for identifying and screening the water content or dehydration rate character of the corn kernel by using the molecular marker.
The fourth purpose of the invention is to disclose a method for improving the water content or dehydration rate character of corn kernels.
In order to achieve the purpose, the invention adopts the following technical scheme:
the invention provides an application of protein in controlling the water content or dehydration rate character of corn kernels, which is characterized in that: the amino acid sequence of the protein is shown in any one of SEQ ID NO.1, SEQ ID NO.17 or SEQ ID NO. 18.
The invention also provides application of the nucleic acid in controlling the water content or dehydration rate character of corn kernels, and the nucleic acid is characterized in that the nucleic acid encodes the protein.
In some embodiments, the nucleotide sequence or reverse complement of the nucleic acid is as set forth in any one of SEQ ID No.2, SEQ ID No.3, SEQ ID No.4, SEQ ID No.13, SEQ ID No.14, SEQ ID No.15, or SEQ ID No. 16.
The invention also provides a molecular marker, which is characterized in that 7 bases AGTATCT are inserted into the position of 1044-1045 of the sequence shown in SEQ ID NO. 2; or 303 bases at position 2506 and 2808 of the sequence shown in SEQ ID NO.2
CTTGATCACCAATTCGCGAAAGGGCCTCTAGCTGAGTTGGTTAGGTGGTCTGAATAGCACTCCTCAGGTCCTGGGTTCGACTCCCCGTGGGAGCGAATTTCAGGCTGTGGTTAAAAAAATCCCCTCGTCTGTCCCACGCCAAAGCACAGGTCTAAGACTCAGCCCGGTCGTGGTCGTTCTCACATGGGCTTCGATGCCGCTGTGTATGGGTGGGGTAGGGGTTCGGGGGTTTTCTTGACCTGTGTGAGAAGGTATTTTTCTTAATACAATACCCGGGGCTGTCTTACCCCCCGCAGGTCAAGT。
The invention also provides a method for identifying or assisting in identifying the water content or dehydration rate character of corn grains, which is characterized by comprising the following steps of: (1) detecting the molecular marker in the material to be detected; (2) if the detection result is that the marker is included, the material to be detected shows the characteristics of high water content of grains or low dehydration rate; if the detection result is that the marker is not included, the material to be detected shows the character of low water content of the grains or high dehydration rate.
In some embodiments, the method of detecting the molecular marker described above employs PCR amplification.
In some embodiments, the primer pair used for the PCR amplification consists of SEQ ID NO.5/SEQ ID NO.6 or SEQ ID NO.9/SEQ ID NO. 10.
In some embodiments, the PCR amplification product represented by SEQ ID NO.7 or SEQ ID NO.11 comprising the marker described above; the PCR amplification product which does not contain the marker is shown as SEQ ID NO.8 or SEQ ID NO. 12.
The invention also provides a method for screening the corn material with the characteristics of low grain water content or high dehydration rate, which is characterized in that the molecular marker in the material to be detected is detected according to the method, and the material which does not contain the molecular marker is screened.
The invention also provides a method for reducing the water content of corn kernels or increasing the dehydration rate, which is characterized in that the expression and/or activity of the protein is increased in the corn material to be improved, and plants with low water content of corn kernels or high dehydration rate are selected.
In some embodiments, the method of increasing protein expression is by using a high activity promoter to drive expression of a nucleic acid sequence encoding the protein.
In some embodiments, the high activity promoter is a maize ubiquitin promoter.
In some embodiments, the maize ubiquitin promoter sequence is set forth in SEQ ID No. 19.
The invention also provides application of the molecular marker and the method in improving the water content or dehydration rate of corn kernels.
Compared with the prior art, the invention has the beneficial effects that: the ZmEIN2-1 gene and the protein coded by the gene have the function of regulating and controlling the water content or dehydration rate of corn grains, and the function of the gene is not reported in the prior published data. The invention also provides functional molecular markers InDel _7/0 and InDel _303/000 closely linked with ZmEIN2-1 and a detection method of the markers, which can specifically identify genotypes with different grain water contents or dehydration rates from a corn population, and carry out auxiliary identification and improvement on the grain water content or dehydration rate characters of the corn variety, thereby obtaining the corn variety with low water content or high dehydration rate. The water content of corn grains can be reduced and the dehydration rate can be improved by over-expressing the ZmEIN2-1 gene.
Drawings
FIG. 1 is a Manhattan diagram of whole genome association analysis of corn kernel moisture content change index (taking AUDDC _4_1 as an example). The vertical axis represents the p-value of each marker association analysis test, taken as-log 10; the horizontal axis represents the position of the chromosome. Arrows indicate target SNPs.
FIG. 2 is a QTL mapping chart of corn kernel moisture content variation index (taking BLUP _ AUDDC _4_3, 13HN _ AUDDC _5_4 and 14SY _ AUDDC _4_3 as examples). The vertical axis represents the LOD value for each marker association analysis test; the horizontal axis represents the position of the chromosome.
FIG. 3 is a fine mapping of ZmEIN2-1 gene.
FIG. 4 is a schematic diagram of the gene structure, molecular markers and target sites of ZmEIN 2-1. Triangles indicate the positions of the 2 molecular markers and the TE insertion site of the Mu mutant; arrows indicate target sites; ATG: a start codon; TAA: stop codon
FIG. 5 InDel _7/0 molecular marker causes protein structure change
FIG. 6 nucleic acid sequence and encoded protein structure of wild type ZmEIN2-1 gene and edited gene. WT: a wild type; KO: gene editing; target sequences are underlined; "-" indicates a base deletion.
FIG. 7 is a diagram of a ZmEIN2-1 gene overexpression vector.
FIG. 8 shows the results of gene expression levels of two transformation events overexpressing ZmEIN2-1 gene. WT: a wild type; OE: overexpression
Detailed Description
The following definitions and methods are provided to better define the present application and to guide those of ordinary skill in the art in the practice of the present application. Unless otherwise indicated, terms are to be understood in accordance with their ordinary usage by those of ordinary skill in the relevant art. All patent documents, academic papers, industry standards and other publications, etc., cited herein are incorporated by reference in their entirety.
As used herein, "maize" is any maize plant and includes all plant varieties that can be bred with maize, including whole plants, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, intact plant cells in plants or plant parts, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, stems, roots, root tips, anthers, and the like. Unless otherwise indicated, nucleic acids are written from left to right in the 5 'to 3' direction; amino acid sequences are written from left to right in the amino to carboxy direction. Amino acids may be referred to herein by their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical nomenclature Commission. Similarly, nucleotides may be represented by commonly accepted single-letter codes. Numerical ranges include the numbers defining the range. As used herein, "nucleic acid" includes reference to deoxyribonucleotide or ribonucleotide polymers in either single-or double-stranded form, and unless otherwise limited, includes known analogs (e.g., peptide nucleic acids) having the basic properties of natural nucleotides that hybridize to single-stranded nucleic acids in a manner similar to naturally occurring nucleotides. As used herein, the term "encode" or "encoded" when used in the context of a particular nucleic acid means that the nucleic acid contains the necessary information to direct translation of the nucleotide sequence into a particular protein. The information encoding the protein is represented using a codon. As used herein, "full-length sequence" in reference to a particular polynucleotide or protein encoded thereby refers to the entire nucleic acid sequence or the entire amino acid sequence having a native (non-synthetic) endogenous sequence. The full-length polynucleotide encodes the full-length, catalytically active form of the particular protein. The terms "polypeptide," "polypeptide," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The term is used for amino acid polymers in which one or more amino acid residues is an artificial chemical analogue of a corresponding naturally occurring amino acid. The term is also used for naturally occurring amino acid polymers. The terms "residue" or "amino acid" are used interchangeably herein to refer to an amino acid that is incorporated into a protein, polypeptide, or peptide (collectively, "protein"). The amino acid can be a naturally occurring amino acid, and unless otherwise limited, can include known analogs of natural amino acids that can function in a similar manner as naturally occurring amino acids.
The term "trait" refers to a physiological, morphological, biochemical or physical characteristic of a plant or a particular plant material or cell. In some cases, this property is visible to the human eye, such as seed or plant size, or can be measured by biochemical techniques, such as detecting the protein, starch or oil content of the seed or leaf, or by observing metabolic or physiological processes, for example by measuring tolerance to water deprivation or specific salt or sugar or nitrogen concentrations, or by observing the expression levels of one or more genes, or by agronomic observations such as osmotic stress tolerance or yield.
By "transgenic" is meant any cell, cell line, callus, tissue, plant part or plant whose genome has been altered by the presence of a heterologous nucleic acid (such as a recombinant DNA construct). The term "transgene" as used herein includes those initial transgenic events as well as those generated by sexual crosses or asexual propagation from the initial transgenic events and does not encompass genomic (chromosomal or extra-chromosomal) alteration by conventional plant breeding methods or by naturally occurring events such as random cross-fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition or spontaneous mutation.
"plant" includes reference to whole plants, plant organs, plant tissues, seeds, and plant cells, and progeny of same. Plant cells include, but are not limited to, cells from seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen, and microspores. "progeny" comprises any subsequent generation of the plant.
In this application, the words "comprise", "comprising" or variations thereof are to be understood as embracing each and every element, number or step recited in addition to those elements, numbers or steps. By "test plant" or "test plant cell" is meant a plant or plant cell in which genetic modification has been effected, or a progeny cell of such a modified plant or cell, which progeny cell comprises the modification. The "control" or "control plant cell" provides a reference point for measuring the phenotypic change of the test plant or plant cell.
Negative or control plants may include, for example: (a) a wild-type plant or cell, i.e., a plant or cell having the same genotype as the starting material for the genetic modification to produce a test plant or cell; (b) plants or plant cells having the same genotype as the starting material but which have been transformed with an empty construct (i.e., a construct that has no known effect on the trait of interest, such as a construct comprising a target gene); (c) a plant or plant cell that is a non-transformed isolate of a subject plant or plant cell; (d) a plant or plant cell that is genetically identical to the subject plant or plant cell but that has not been exposed to conditions or stimuli that induce expression of the gene of interest; or (e) the subject plant or plant cell itself, under conditions in which the gene of interest is not expressed.
Those skilled in the art will readily recognize that advances in the field of molecular biology, such as site-specific and random mutagenesis, polymerase chain reaction methods, and protein engineering techniques, provide a wide range of suitable tools and procedures for engineering or engineering amino acid sequences and potential gene sequences of proteins of agricultural interest.
In some embodiments, changes may be made to the nucleotide sequences of the present application to make conservative amino acid substitutions. The principles and examples of conservative amino acid substitutions are further described below. In certain embodiments, substitutions that do not alter the amino acid sequence of the nucleotide sequences of the present application can be made in accordance with the codon preferences disclosed for monocots, e.g., codons encoding the same amino acid sequence can be substituted with monocot preferred codons without altering the amino acid sequence encoded by the nucleotide sequence. In some embodiments, a portion of the nucleotide sequence in this application is replaced with a different codon that encodes the same amino acid sequence, such that the nucleotide sequence is not altered while the amino acid sequence encoded thereby is not altered. Conservative variants include those sequences that, due to the degeneracy of the genetic code, encode the amino acid sequence of one of the proteins of the embodiments. In some embodiments, a partial nucleotide sequence herein is replaced according to monocot preferred codons. One skilled in the art will recognize that amino acid additions and/or substitutions are generally based on the relative similarity of the amino acid side-chain substituents, e.g., hydrophobicity, charge, size, etc., of the substituents. Exemplary amino acid substituent groups having various of the foregoing properties are known to those skilled in the art and include arginine and lysine; glutamic acid and aspartic acid; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine. Guidance regarding suitable amino acid substitutions that do not affect the biological activity of the Protein of interest can be found in the model of the Atlas of Protein sequences and structures (Protein Sequence and Structure Atlas) (Natl. biomed. Res. Foundation, Washington, D.C.) (incorporated herein by reference). Conservative substitutions such as exchanging one amino acid for another with similar properties may be made. Identification of sequence identity includes hybridization techniques. For example, all or part of a known nucleotide sequence is used as a probe for selective hybridization to other corresponding nucleotide sequences present in a population of cloned genomic DNA fragments or cDNA fragments (i.e., a genomic library or cDNA library) from a selected organism. The hybridization probes may be genomic DNA fragments, cDNA fragments, RNA fragments, or other oligonucleotides, and may be labeled with a detectable group such as 32P or other detectable marker. Thus, for example, hybridization probes can be prepared by labeling synthetic oligonucleotides based on the sequence of the embodiment. Methods for preparing hybridization probes and constructing cDNA and genomic libraries are generally known in the art. Hybridization of the sequences may be performed under stringent conditions. As used herein, the term "stringent conditions" or "stringent hybridization conditions" refers to conditions under which a probe will hybridize to its target sequence to a detectably greater degree (e.g., at least 2-fold, 5-fold, or 10-fold over background) than to other sequences. Stringent conditions are sequence dependent and differ in different environments. By controlling the stringency of hybridization and/or by controlling the washing conditions, it is possible to identify target sequences which are 100% complementary to the probes (homologous probe method). Alternatively, stringency conditions can be adjusted to allow some sequence mismatches in order to detect lower similarity (heterologous probe methods). Typically, the probe is less than about 1000 or 500 nucleotides in length. Typically, stringent conditions are conditions in which the salt concentration is less than about 1.5M Na ion, typically about 0.01M to 1.0M Na ion concentration (or other salt) at pH 7.0 to 8.3, and the temperature conditions are: when used with short probes (e.g., 10 to 50 nucleotides), at least about 30 ℃; when used with long probes (e.g., greater than 50 nucleotides), at least about 60 ℃. Stringent conditions may also be achieved by the addition of destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization at 37 ℃ using 30% to 35% formamide buffer, 1M NaCl, 1% SDS (sodium dodecyl sulfate), washing at 50 ℃ to 55 ℃ in1 × to 2 × SSC (20 × SSC ═ 3.0M NaCl/0.3M trisodium citrate). Exemplary moderately stringent conditions include hybridization in 40% to 45% formamide, 1.0M NaCl, 1% SDS at 37 ℃ and washing in 0.5X to 1 XSSC at 55 ℃ to 60 ℃. Exemplary high stringency conditions include hybridization in 50% formamide, 1M NaCl, 1% SDS at 37 deg.C, and a final wash in 0.1 XSSC at 60 deg.C to 65 deg.C for at least about 20 minutes. Optionally, the wash buffer may comprise about 0.1% to about 1% SDS. The duration of hybridization is generally less than about 24 hours, and typically from about 4 hours to about 12 hours. Specificity usually depends on the post-hybridization wash, the critical factors being the ionic strength and temperature of the final wash solution. The Tm (thermal melting point) of a DNA-DNA hybrid can be approximated by the formula of Meinkoth and Wahl (1984) anal. biochem.138: 267-284: tm 81.5 ℃ +16.6(logM) +0.41 (% GC) -0.61 (% formamide) -500/L; where M is the molar concentration of monovalent cations,% GC is the percentage of guanosine and cytosine nucleotides in the DNA,% formamide is the percentage formamide of the hybridization solution, and L is the base pair length of the hybrid. The Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. Washing is typically performed at least until equilibrium is reached and a low background level of hybridization is achieved, such as for 2 hours, 1 hour, or 30 minutes. Decrease Tm by about 1 ℃ per 1% mismatch; thus, Tm, hybridization and/or wash conditions can be adjusted to hybridize to sequences of desired identity. For example, if a sequence with > 90% identity is desired, the Tm can be lowered by 10 ℃. Typically, stringent conditions are selected to be about 5 ℃ lower than the Tm for the specific sequence and its complement under defined ionic strength and pH. However, under very stringent conditions, hybridization and/or washing may be performed at 4 ℃ below the Tm; hybridization and/or washing may be performed at 6 ℃ below the Tm under moderately stringent conditions; under low stringency conditions, hybridization and/or washing can be performed at 11 ℃ below the Tm.
In some embodiments, fragments of the nucleotide sequences and the amino acid sequences encoded thereby are also included. As used herein, the term "fragment" refers to a portion of the nucleotide sequence of a polynucleotide or a portion of the amino acid sequence of a polypeptide of an embodiment. Fragments of the nucleotide sequences may encode protein fragments that retain the biological activity of the native or corresponding full-length protein, and thus have protein activity. Mutant proteins include biologically active fragments of the native protein that comprise contiguous amino acid residues that retain the biological activity of the native protein. Some embodiments also include a transformed plant cell or transgenic plant comprising the nucleotide sequence of at least one embodiment. In some embodiments, plants are transformed with an expression vector comprising at least one embodiment of the nucleotide sequence and operably linked thereto a promoter that drives expression in plant cells. Transformed plant cells and transgenic plants refer to plant cells or plants that comprise a heterologous polynucleotide within their genome. Generally, the heterologous polynucleotide is stably integrated within the genome of the transformed plant cell or transgenic plant such that the polynucleotide is transmitted to progeny. The heterologous polynucleotide may be integrated into the genome alone or as part of an expression vector. In some embodiments, the plants to which the present application relates include plant cells, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps, and plant cells, which are whole plants or parts of plants, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, nuts, ears, cobs, husks, stalks, roots, root tips, anthers, and the like. The present application also includes plant cells, protoplasts, tissues, calli, embryos, and flowers, stems, fruits, leaves, and roots derived from the transgenic plants of the present application or progeny thereof, and thus comprising at least in part the nucleotide sequences of the present application.
The term "amplification" in the context of nucleic acid amplification is any process in which additional copies of a selected nucleic acid (or a transcribed form thereof) are produced. Typical amplification methods include various polymerase-based replication methods, including Polymerase Chain Reaction (PCR), ligase-mediated methods such as Ligase Chain Reaction (LCR), and RNA polymerase-based amplification (e.g., by transcription) methods.
An allele is "associated with" a trait when it is linked to the trait, and when the allele present is an indication that the desired trait or trait form will occur in a plant containing the allele.
The term "quantitative trait locus" or "QTL" as used herein refers to a polymorphic locus having at least one allele associated with differential expression of a phenotypic trait in at least one genetic background (e.g., in at least one breeding population or progeny). QTLs can function through a monogenic or polygenic mechanism.
The term "QTL mapping" as used herein refers to the mapping of a QTL to a genetic map using methods similar to single gene mapping, and determining the distance (expressed as recombination rate) between the QTL and a genetic marker. According to the number of labels, there are several methods, including single label, double label and multiple label. According to different statistical analysis methods, the method can be divided into variance and mean analysis, regression and correlation analysis, moment estimation, maximum likelihood method and the like. The number of marked intervals can be divided into zero interval mapping, single interval mapping and multi-interval mapping. In addition, there are comprehensive analysis methods combining different methods, such as QTL Complex Interval Mapping (CIM) Multiple Interval Mapping (MIM), multiple QTL mapping, Multiple Trait Mapping (MTM), and the like.
The term "molecular marker" as used herein refers to a specific DNA fragment that reflects some difference in the genome between individual or population groups of an organism.
The term "major gene" as used herein refers to a gene that determines a trait from a single gene, referred to as a major gene, and the term "minor gene" as used herein refers to a gene that has only a partial effect on each of several non-alleles of a phenotype of the same trait, referred to as additive or polygenes. Each gene has only a small portion of the phenotypic effect in the additive genes and is therefore also referred to as a mini-gene.
The term "inbred line" as used herein refers to a line which has regular and consistent agronomic traits and simple genetic basis, obtained by selecting individual plants with good agronomic traits through several generations of continuous elimination of bad panicles under the condition of artificially controlled self-pollination.
The term "backcrossing" as used herein refers to a process in which a progeny and either of two parents are crossed.
The term "cross" or "crossed" as used herein refers to a gamete fusion (e.g., cell, seed, or plant) that produces progeny through pollination. The term includes sexual crosses (pollination of one plant by another) and selfing (self-pollination, e.g., when the pollen and ovule are from the same plant). The term "crossing" refers to the act of fusion of gametes via pollination to produce progeny.
The term "backcrossing" as used herein refers to a process in which progeny of a cross are repeatedly backcrossed to one of the parents. In a backcrossing scheme, the "donor" parent refers to the parent plant having the desired gene or locus to be introgressed. The "recipient" parent (used one or more times) or "recurrent" parent (used two or more times) refers to the parent plant into which the gene or locus has been introgressed. Initial hybridization yields F 1 Generation; then, the term "BC 1 "indicates the second use of recurrent parent," BC 2 "refers to the rotation of the parent for a third use, etc.
The term "closely linked" as used herein means that recombination between two linked loci occurs at a frequency of equal to or less than about 10% (i.e., the frequency of separation on the genetic map does not exceed 10 cM). In other words, closely linked loci co-segregate in at least 90% of the cases. Marker loci are particularly useful in the present invention when they exhibit a significant probability of co-segregation (linkage) with a desired trait (e.g., pathogen resistance). Closely linked loci such as a marker locus and a second locus can exhibit a recombination frequency within the locus of 10% or less, preferably about 9% or less, more preferably about 8% or less, more preferably about 7% or less, more preferably about 6% or less, more preferably about 5% or less, more preferably about 4% or less, more preferably about 3% or less, more preferably about 2% or less. In highly preferred embodiments, the cognate locus exhibits a recombination frequency of about 1% or less, such as about 0.75% or less, more preferably about 0.5% or less, more preferably about 0.25% or less. Two loci that are located on the same chromosome and that are separated by a distance such that recombination between the two loci occurs at a frequency of less than 10% (e.g., about 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.75%, 0.5%, 0.25%, or less) are also said to be "close to" each other. In some cases, two different markers can have the same genetic map coordinates. In that case, the two tags are close enough to each other that recombination between them occurs at a frequency too low to be detected.
Centimorgans ("cM") is a measure of the frequency of recombination. 1cM equals 1% of the probability that a marker at one locus will separate from a marker at a second locus by a single generation hybridization.
A "favorable allele" is an allele at a particular locus that confers or contributes to an agronomically desirable phenotype, such as increased moisture content of corn kernels, and allows for the identification of plants having an agronomically desirable phenotype. A "favorable" allele of a marker is a marker allele that cosegregates with a favorable phenotype.
A "genetic map" is a description of the genetic linkage between loci on one or more chromosomes in a given species, typically depicted in a graphical or tabular format. For each genetic map, the distance between loci is measured by the frequency of recombination between them, and recombination between loci can be detected using a variety of markers. Genetic maps are the product of the mapped population, the type of marker used, and the polymorphic potential of each marker across different populations. The order and genetic distance between loci may differ from one genetic map to another. However, a generic box using common labels can associate information of one map with another map. One of ordinary skill in the art can use a framework of common markers to identify marker locations and loci of interest on the genetic map of each individual.
A "genetic map location" is a location on a genetic map on the same linkage group relative to surrounding genetic markers where a given marker can be found in a given population.
"Gene mapping" is a method of defining linkage relationships of loci by using standard genetic principles of genetic markers, population segregation of markers, and recombination frequency.
"genetic recombination frequency" is the frequency of crossover events (recombination) between two loci. Recombination frequency can be observed after segregation of the marker and/or post-meiotic trait.
The term "genotype" is the genetic makeup of an individual (or group of individuals) at one or more loci, as contrasted with an observable trait (phenotype). The genotype is defined by the alleles of one or more known loci that the individual has inherited from its parent. The term genotype may be used to refer to the genetic makeup of an individual at a single locus, the genetic makeup at multiple loci, or more generally, the term genotype may be used to refer to the genetic makeup of all genes of an individual in their genome.
"germplasm" refers to an individual (e.g., a plant), a group of individuals (e.g., a line, variety, or family of plants), or cloned or derived genetic material from a line, variety, species, or culture. The germplasm may be part of an organism or cell, or may be isolated from an organism or cell. Germplasm generally provides the genetic material with a specific molecular makeup that provides the physical basis for some or all of the genetic traits of an organism or cell culture. As used herein, germplasm includes cells, seeds, or tissues from which new plants can be grown, or plant parts such as leaves, stems, pollen, or cells, which can be cultured into whole plants.
A "marker" is a nucleotide sequence or its encoded product (e.g., a protein) that serves as a reference point. For markers to be used for detecting recombination, they require detection of differences or polymorphisms within the population being monitored. For molecular markers, this means that differences at the DNA level are due to polynucleotide sequence differences (e.g. SSR, RFLP, FLP, and SNP). Genomic variability can be of any origin, such as insertions, deletions, duplications, repetitive elements, point mutations, recombination events, or the presence and sequence of transposable elements. Molecular markers may be derived from genomic or expressed nucleic acids (e.g., ESTs) and may also refer to nucleic acids used as probes or primer pairs capable of amplifying sequence fragments using PCR-based methods.
Markers corresponding to genetic polymorphisms between members of a population can be detected by methods established in the art. These methods include, for example, DNA sequencing, PCR-based sequence-specific amplification methods, restriction fragment length polymorphism detection (RFLP), isozyme marker detection, polynucleotide polymorphism detection by allele-specific hybridization (ASH), amplified variable sequence detection of plant genomes, autonomous sequence replication detection, simple repeat sequence detection (SSR), single nucleotide polymorphism detection (SNP), or amplified fragment length polymorphism detection (AFLP). Established methods are also known for detecting Expressed Sequence Tags (ESTs) and SSR markers derived from EST sequences, as well as Randomly Amplified Polymorphic DNA (RAPD).
A "marker allele" or "allele of a marker locus" can refer to one of a plurality of polymorphic nucleotide sequences located at a marker locus in a population that is polymorphic with respect to the marker locus.
A "marker probe" is a nucleic acid sequence or molecule that can be used to identify the presence or absence of a marker locus by nucleic acid hybridization, e.g., a nucleic acid molecular probe that is complementary to a sequence of a marker locus. Labeled probes comprising 30 or more contiguous nucleotides of a marker locus (all or part of a "marker locus sequence") can be used for nucleic acid hybridization. Alternatively, in some aspects a molecular probe refers to any type of probe that is capable of distinguishing (i.e., genotype) a particular allele present at a marker locus.
As noted above, the term "molecular marker" may be used to refer to a genetic marker, or its encoded product (e.g., a protein) that serves as a point of reference when identifying linked loci. The tag can be derived from a genomic nucleotide sequence or from an expressed nucleotide sequence (e.g., from spliced RNA, cDNA, etc.), or from an encoded polypeptide. The term also refers to nucleic acid sequences that are complementary to or flanked by marker sequences, such as nucleic acids that are used as probes or primer pairs capable of amplifying the marker sequences. A "molecular marker probe" is a nucleic acid sequence or molecule that can be used to identify the presence or absence of a marker locus, e.g., a nucleic acid probe that is complementary to a marker locus sequence. Alternatively, in some aspects a molecular probe refers to any type of probe that is capable of distinguishing (i.e., genotype) a particular allele present at a marker locus. Nucleic acids are "complementary" when they specifically hybridize in solution, for example, according to the Watson-Crick base-pairing rules. Some of the markers described herein are also referred to as hybridization markers when located in regions of indels, such as the non-collinear regions described herein. This is because the insertion region is a polymorphism with respect to a plant having no insertion. Thus, the marker need only indicate the presence or absence of the indel region. Any suitable label detection technique may be used to identify such hybridization labels, e.g., KASP technique, PCR amplification.
The invention locates a gene ZmEIN2-1 which influences the water content and dehydration rate traits of corn kernels from a corn associated population, the gene is positioned at the position of a reference genome Chromosome1:270891072 and 270897163 of B73V 5 version, and the genome sequence is shown as SEQ ID NO. 2. By determining the transcript of the ZmEIN2-1 gene, the nucleotide sequence of the coding region of the gene and the sequence of the encoded protein were determined.
The invention further analyzes the variation sites in the corn material represented by different kernel water contents, finds 2 variation sites (InDel _7/0 and InDel _303/000) linked with characters, wherein InDel _7/0 is positioned at the position of 1045-1051 of a sequence shown in SEQ ID NO.2 and represents the insertion of 7 bases (AGTATCT); InDel _303/000 is located at position 2513-2815 of the sequence shown in SEQ ID NO.2 and shows 303-base insertion deletion.
Based on InDel _7/0 and InDel _303/000 sites, the invention develops a molecular marker detection method, can identify the genotypes of InDel _7/0 and InDel _303/000, and identifies or assists in identifying the water content or dehydration rate character of corn kernels according to the genotype identification result.
The invention provides an embodiment of a method for driving over-expression of ZmEIN2-1 gene by using a maize ubiquitin promoter, reducing the water content of maize grains or improving the dehydration rate.
The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Modifications or substitutions to methods, steps or conditions of the present invention may be made without departing from the spirit and scope of the present invention. Unless otherwise indicated, the examples follow conventional experimental conditions, such as the Molecular cloning laboratory Manual of Sambrook et al (Sambrook J & Russell D W, Molecular cloning: a laboratory Manual,2001), or the conditions as recommended by the manufacturer's instructions. Unless otherwise specified, the chemical reagents used in the examples are all conventional commercially available reagents, and the technical means used in the examples are conventional means well known to those skilled in the art.
Example 1 cloning of corn grain moisture Gene
The invention utilizes the association group constructed in the laboratory (the construction method of the association group refers to Yang X, Gao S, Xu S, Zhang Z, Prasanna B.M., Li L, Li J, Yan J.Characterisation of a global dental collection and an item potential evaluation for analysis of complex quantitative traitments in the main [ J]Molecular Breeding,2011,28(4): 511-526.). Through the measurement of the moisture content of the corn kernels in 5 environments, the phenotypic values of the moisture content (GM) of the corn kernels in 5 stages are obtained: respectively 34 days, 40 days, 46 days, 52 days and 58 days after pollination, recording34DAP, 40DAP, 45DAP, 52DAP, 58 DAP. And simultaneously calculating BLUP phenotypic values of 5 environments by using an optimality unbiased estimation method (BLUP), and calculating a grain water content change index (AUDDC) by using the phenotypic values, wherein the evaluation method refers to a method to estimate a rate of dry in main [ J ] of]Crop sci.,2010,50(6): 2347-2354), denoted as AUDDC _2_1, AUDDC _3_2, AUDDC _4_3, AUDDC _5_4, AUDDC _3_1, AUDDC _4_2, AUDDC _5_3, AUDDC _4_1, AUDDC _5_2, AUDDC _5_1 (where the numbers indicate the moisture content of the grains for 5 stages, for example: AUDDC — 2 — 1 is the AUDDC value between the second kernel water content (40DAP) and the first kernel water content (34 DAP). Genotype data using the 1.25M SNP marker of the related population and the population structure and genetic relationship deduced from the genotype (genotype data from Liu H, Luo X, Niu L, Xiao Y, Chen L, Liu J, Wang X, Jin M, Li W, Zhang Q, Yan J.Distancet eLs QT and Non-coding Sequences Play Critical Roles in Regulation Gene Expression and Quantitative transfer Variation in Maize [ J J.J. ]]414-426) using a mixed linear model, performing genome-wide association analysis on the 15 personality, with a threshold P of 2.0 × 10 -6 Under the standard of (3), SNP sites chr1.S _264272396 and BLUP _ GM (BLUP _34_ DAP, BLUP _46_ DAP), BLUP _ AUDDC (BLUP _ AUDDC _4_1, BLUP _ AUDDC _3_1, BLUP _ AUDDC _5_1, BLUP _ AUDDC _4_2, BLUP _ AUDDC _2_1, BLUP _ AUDDC _4_3, BLUP _ AUDDC _3_2, BLUP _ AUDDC _5_2) were identified,
the 14JL _ GM (14JL _40_ DAP, 14JL _46_ DAP) and 14JL _ BLUP (14JL _ AUDDC _3_1, 14JL _ AUDDC _2_1, 14JL _ AUDDC _3_2, 14JL _ AUDDC _4_1, 14JL _ AUDDC _4_2, 14JL _ AUDDC _5_1) traits were significantly correlated (Table 1; FIG. 1). Meanwhile, the RIL group constructed by K22 XDan 340 is utilized by the inventor, the phenotype data collection method and the correlation analysis experimental part are utilized, and then a QTL site is positioned by utilizing a high-density genetic linkage map (Pan Q, Li L, Yang X, Tong H, Xu S, Li Z, Li W, Muehlbauer GJ, Yan J, genome-side recombination dynamics associated with in main [ J ] New Phytol,2016,210(3): 1083) and 1094), the main effect QTL positioned in chromosome 1.09 of No.1 DDC, the characters positioned to the QTL mainly comprise HN-GM (13 HN-52, 13 HN-58 DAP), 13 _ AUDDC (13 DDC-5 _ DDC, 13 _ HN-5 _4), 14-14 DDC (14 HN-14 DDC-14, 14 _ 14 DDC _ 14 DDC _3_ 13 DDC _ 13 DDC _3_ 13 DDC _ 13 DDC _ 13 DDC _3_ 13 _4, 13 _ DDC _3_ 13 _ DDC _3_ DDC _4, 14SY _ AUDDC _4_3, 14SY _ AUDDC _5_1, 14SY _ AUDDC _5_2, 14SY _ AUDDC _5_3, 14SY _ AUDDC _5_4), 14WH _ AUDDC (14WH _ AUDDC _5_2, 14SY _ AUDDC _3_1) and BLUP _ AUDDC (BLUP _ AUDDC _4_3) (table 2; FIG. 2), the SNP associated with the QTL and the association analysis is the same site and is named qDR 1-2. The QTL interval is narrowed to 60kb by map-based cloning, two genes are arranged in the interval (figure 3), and the gene with the most significant SNP in association analysis is taken as a candidate gene and is named as ZmEIN 2-1.
TABLE 1 significant SNP (Chr1. S-264272396) and trait Association analysis results
Figure BDA0003667980110000171
TABLE 2 QTL (qDR1-1) basic information
Figure BDA0003667980110000172
Example 2 Gene Structure and functional site analysis
The ZmEIN2-1 gene is numbered Zm00001eb054060 in the B73 reference genome, and is positioned in Chr1:270891072-270897163 for a total of 6092 bp. The sequence is shown as SEQ ID NO. 2. The function of the gene is annotated as ethylene insensitivity, and no research has shown that the function is related to the dehydration rate of corn. The ZmEIN2-1 gene has 3 transcripts in total, and the sequences are shown as SEQ ID NO.3 (transcript T1), SEQ ID NO.13 (transcript T2) and SEQ ID NO.15 (transcript T3). The transcript 1 contains 8 exons, 6 of the exons are coding exons (the structure is shown in figure 4), the sequence of a coding region is shown as SEQ ID NO.4, and the sequence of coded amino acid is shown as SEQ ID NO. 1.
Through sequencing and PCR identification of the whole gene region of different character expression materials in the related population, the gene is found to have 2 variation sites. The first mutation site is located at the position of Chromosome1: 270892115-270892116 (sequence 1044-1045 shown in SEQ ID NO. 2), and a 7bp insertion deletion is formed on the 1 st exon: AGTATCT (position shown in FIG. 4). Insertion of 7 bases into this position leads to premature termination of gene transcription, which is significantly associated with the moisture content trait. Therefore, the variation can be developed into a molecular marker InDel _7/0 for assisting in identifying the moisture content and the dehydration rate of the corn kernel. Wherein, the corn kernel containing 7 basic groups of genotype InDel _7 has higher water content and slower dehydration; corn kernels of genotype InDel _0 without 7 bases have lower moisture and faster dehydration.
The second mutation site was located at the position Chromosome1:270893584 and 270893886(SEQ ID NO.2, SEQ ID NO. 2506 and 2808) and was a 303bp indel between the 4 th and 5 th exons:
CTTGATCACCAATTCGCGAAAGGGCCTCTAGCTGAGTTGGTTAGGTGGTCTGAATAGCACTCCTCAGGTCCTGGGTTCGACTCCCCGTGGGAGCGAATTTCAGGCTGTGGTTAAAAAAATCCCCTCGTCTGTCCCACGCCAAAGCACAGGTCTAAGACTCAGCCCGGTCGTGGTCGTTCTCACATGGGCTTCGATGCCGCTGTGTATGGGTGGGGTAGGGGTTCGGGGGTTTTCTTGACCTGTGTGAGAAGGTATTTTTCTTAATACAATACCCGGGGCTGTCTTACCCCCCGCAGGTCAAGT (position shown in figure 4). This marker was found to be significantly associated with the phenotype BLUP _ AUDDC _4_1 by T-test analysis (Table 3). Therefore, the variation can be developed into a molecular marker InDel _303/000 for assisting in identifying the moisture content and the dehydration rate of the corn kernel. Wherein, the corn kernel containing the genotype InDel _303 with 303 basic groups has higher water content and slower dehydration; the corn kernel of the genotype InDel _000 without 303 basic groups has lower moisture and faster dehydration.
Table 3 molecular marker InDel _303/000 affects corn kernel moisture and its changes (BLUP _ AUDDC _4_1)
Figure BDA0003667980110000191
The higher the AUDDC _4_1 value, the higher the moisture content of the kernel, the lower the dehydration rate.
Example 3 corn kernel water content related molecular marker detection method
The molecular markers can be identified using PCR methods based on the genomic sequence near the positions InDel _7/0 and InDel _ 303/000. The primer pair used for PCR identification at position InDel _7/0 is shown in SEQ ID NO.5 and SEQ ID NO. 6. The primer pair used for PCR identification at position InDel _303/000 is shown in SEQ ID NO.9 and SEQ ID NO. 10.
The molecular marker detection adopts the following method:
(1) extracting corn genome DNA:
1. about 1.5g of corn leaves are ground in liquid nitrogen and transferred into a 2mL centrifuge tube.
2. Add 750. mu.l CTAB extraction buffer pre-heated to 65 ℃ and mix rapidly. Water bath is carried out in a water bath kettle at 65 ℃ for about 30 minutes, and the centrifuge tube is gently shaken for 2-3 times from time to time in the middle.
3. Taking out the centrifuge tube, adding equal volume of chloroform: isoamyl alcohol (24: 1), shake the tube on a shaker for 10 minutes until the solution separates into layers with the lower layer being dark green and the upper layer being pale yellow.
4. Centrifuge at 12000rpm for 10 minutes at room temperature and transfer the supernatant to a 1.5mL centrifuge tube.
5. To the supernatant was added 2/3 volumes of pre-cooled isopropanol and carefully mixed. Placing the mixture into a freezer with the temperature of-20 ℃ for 30 minutes.
6. Then, the mixture was centrifuged at 12000rpm for 10 minutes at 4 ℃.
7. The supernatant was decanted, and 1mL of 75% ethanol was added and soaked for 5 minutes. The washing was repeated once more. Then the liquid was poured off, the centrifuge tube was left for 30min, dried at room temperature, and 200. mu.l of water was added to dissolve the DNA.
8. The DNA mass was checked with 1% agarose and the DNA concentration was determined. The DNA was stored in a freezer at-20 ℃ until use.
(2) The PCR system and procedure were:
and (3) PCR system:
Figure BDA0003667980110000201
PCR procedure:
Figure BDA0003667980110000202
(3) gel imaging
Detection on 1% agarose gel.
The primer pair used for PCR at position InDel _7/0 is shown as SEQ ID NO.5 and SEQ ID NO. 6. Amplifying a 84bp band (shown as SEQ ID NO. 7) by using the material with the genotype of InDel _7, wherein the materials show that the water content of grains is high and the dehydration rate is slow; 77bp bands (shown as SEQ ID NO. 8) are amplified from the material with the genotype of InDel _0, and the material shows that the moisture content of grains is low and the dehydration rate is high.
The primer pair used at position InDel _303/000 is shown in SEQ ID NO.9 and SEQ ID NO. 10. Amplifying a band (the sequence is shown as SEQ ID NO. 11) of 935bp by using the material with the genotype of InDel _303, wherein the materials show that the grains have high water content and slow dehydration rate; the 632bp band (shown as SEQ ID NO. 12) is amplified from the material with the genotype of InDel _000, and the materials show that the moisture content of grains is low and the dehydration rate is high.
The method is used for detecting a plurality of self-bred line materials, and the result shows that the detection of the marker can well distinguish the water content or dehydration rate characters of grains among different materials. The results of the partial material marker tests and the data on the dehydration behavior are shown in Table 4.
TABLE 4 detection results of some materials for markers and dehydration behavior
Figure BDA0003667980110000211
Example 4 inactivation of ZmEIN2-1 protein, alteration of corn kernel moisture content and dehydration Rate
The ZmEIN2-1 gene has the function of controlling the water content and the dehydration rate of corn kernels, and in order to further verify the regulation and control mode of the gene on the water content and the dehydration rate of the kernels, the gene is knocked out by using a CRISPR-Cas9 gene editing technology. The gene encodes a protein containing an Nramp-like domain predicted by the protein structure (FIG. 6). Two targets, GTAATGTTCCCCAAGTTGAG and GCAGGTTCAGAGAAGATTTC (target positions see fig. 4), were designed at the 5 th and 6 th exons, respectively, with respect to the genomic sequence, sgrnas (sgRNA _1 and sgRNA _2) were synthesized, and a gene editing vector was constructed. Transformation of the maize variety KN5585 with the vector resulted in the successful gene-edited transformant which lost 714 bases and at the same time inserted 76 bases and prematurely terminated gene translation, resulting in the loss of the protein domain, and the edited protein structure is shown in FIG. 6. The gene editing material investigates the property data such as AUDDC and water content change and the like under two environments of Hainan Sansui and Jilin princess mountains, and proves that the water content of corn grains is increased and the dehydration rate is slowed down after the gene editing (tables 5 and 6).
TABLE 5 influence of ZmEIN2-1 Gene editing on corn kernel moisture changes
Figure BDA0003667980110000212
Figure BDA0003667980110000221
WT: a wild type; KO: gene editing
TABLE 6 influence of ZmEIN2-1 Gene editing on corn grain moisture content
Figure BDA0003667980110000222
WT: a wild type; KO: gene editing
In addition, a mutant in which transposon was inserted into the 5' UTR region of EIN2-1 gene was obtained by screening a maize mutant library (FIG. 4). The mutant and the wild material have differences in phenotype, the water content of the mutant grains is high, and dehydration is slow (tables 7 and 8).
TABLE 7 ZmEIN2-1 Gene mutant affecting corn kernel moisture changes
Figure BDA0003667980110000223
WT: a wild type; MU: mutants
TABLE 8 ZmEIN2-1 Gene mutant affecting corn grain moisture content
Figure BDA0003667980110000224
WT: a wild type; MU: mutants
Example 5 overexpression of EIN2-1 Gene reduces corn grain Water content and increases dehydration Rate
After the EIN2-1 gene is knocked out, the water content of corn kernels is increased, and dehydration is slowed. Therefore, in order to reduce the water content of the corn kernels and improve the dehydration rate of the corn kernels, the gene can be overexpressed.
Overexpression can select a strong promoter (such as ubiquitin, actin, 35S and the like) to drive the EIN2-1 gene (the genome sequence shown in SEQ ID NO.2, or the cDNA sequence shown in SEQ ID NO.3, SEQ ID NO.13 or SEQ ID NO.15, or the coding region sequence shown in SEQ ID NO.4, SEQ ID NO.14 or SEQ ID NO. 16) to express. In this example, a maize strong promoter ubiquitin (SEQ ID NO.19) was selected to drive a segment of genome sequence (specifically, the sequence at position 210-4530 of SEQ ID NO. 2) containing a coding region to express, and a overexpression vector was constructed (the vector map is shown in FIG. 7). The overexpression vector is transformed into a maize inbred line KN5585, obtained transformed seedlings are detected, two transformation events ZMEIN2-1# OE1 and ZMEIN2-1# OE2 with stable overexpression of the target genes are identified, and the results of gene expression amount are shown in figure 8. After investigating the water content and dehydration rate of the kernels, the water content of the over-expressed corn plant kernels is reduced, and the dehydration rate is increased (tables 9 and 10).
TABLE 9 influence of ZmEIN2-1 gene overexpression on corn kernel moisture change
Figure BDA0003667980110000231
OE 1: overexpression Material 1; WT 1: wild type control 1; OE 2: overexpression Material 2; WT 2: wild type control 2.
TABLE 10 influence of maize grain water content by ZmEIN2-1 gene overexpression
Figure BDA0003667980110000232
OE 1: overexpression of 1; WT 1: wild type control 1; OE 2: overexpression Material 2; WT 2: wild type control 2; na: and (4) not detecting.
Although the invention has been described in detail with respect to the general description and the specific embodiments thereof, it will be apparent to those skilled in the art that modifications and improvements can be made based on the invention. Accordingly, it is intended that all such modifications and alterations be included within the scope of this invention as defined in the appended claims.
Sequence listing
<110> university of agriculture in Huazhong
<120> gene ZmEIN2-1 for controlling water content of corn kernels and molecular marker thereof
<130> 1
<160> 19
<170> SIPOSequenceListing 1.0
<210> 1
<211> 476
<212> PRT
<213> Zea mays
<400> 1
Met Asp Gly Val Arg Cys Met Glu Ser Pro Ala Ala Gly Asp Ala Pro
1 5 10 15
His Ser Ser Phe Arg Thr Leu Gly Pro Thr Leu Leu Val Ser Met Gly
20 25 30
Tyr Leu Asp Phe Gly Lys Trp Leu Val Ala Val Glu Ala Gly Ser Arg
35 40 45
Phe Gly Tyr Asp Leu Val Leu Leu Val Leu Leu Phe Asn Leu Ser Ala
50 55 60
Ile Leu Cys Gln Tyr Leu Ser Ser Cys Ile Gly Ile Val Thr Lys Lys
65 70 75 80
Asn Leu Ala Glu Ile Cys His Gln Glu Tyr Asp Gln Lys Ile Cys Val
85 90 95
Val Leu Gly Leu Gln Ala Gly Leu Ser Leu Leu Thr Ser Glu Phe Thr
100 105 110
Met Ile Ala Gly Ile Val Val Gly Phe Asn Leu Val Phe Glu Ser Asn
115 120 125
Asn Pro Ile Thr Val Val Cys Phe Thr Ser Val Val Val Asn Leu Leu
130 135 140
Pro Tyr Thr Leu Ser Leu Leu Asp Lys Arg Lys Ala Gly Met Phe Asn
145 150 155 160
Ala Tyr Ala Ser Gly Phe Thr Leu Val Cys Phe Val Leu Gly Leu Leu
165 170 175
Val Ser His Pro Lys Thr Pro Val Asn Thr Asn Val Met Phe Pro Lys
180 185 190
Leu Ser Gly Glu Ser Ala Tyr Ser Leu Met Val Leu Leu Gly Thr Asn
195 200 205
Ile Ile Val His Asn Phe Tyr Thr His Ser Ser Val Val Gln Val Gln
210 215 220
Arg Arg Phe Gln Gly His Thr Leu Gly Thr Leu Phe His Asp His Leu
225 230 235 240
Phe Ser Val Leu Phe Ala Phe Ser Gly Ile Phe Leu Val Asn Tyr Ile
245 250 255
Leu Met Ser Ser Ala Val Asp Glu Ser Lys Asn Thr Met Ala Ile Asn
260 265 270
Phe Gln Asp Ala Arg Gln Leu Met Asn Gln Val Phe Thr Ser Pro Val
275 280 285
Ala Pro Ile Val Leu Leu Val Val Leu Leu Phe Ser Gly His Ile Val
290 295 300
Ser Met Thr Cys Ile Ile Gly Ser Asp Val Ile Ser Glu Asp Leu Phe
305 310 315 320
Gly Ile Lys Leu Pro Leu Phe Val His His Leu Leu Pro Lys Val Phe
325 330 335
Ala Met Ile Thr Thr Ile Tyr His Ala Lys Val Val Gly Phe Glu Gly
340 345 350
Leu Tyr Gln Leu Leu Met Val Cys Pro Ile Ile Gln Ala Met Leu Leu
355 360 365
Pro Ser Ser Val Ile Pro Val Phe Arg Ile Ser Ser Ser Arg Ser Leu
370 375 380
Met Gly Arg Tyr Arg Ile Ser Arg Cys Val Glu Ile Leu Cys Phe Leu
385 390 395 400
Ala Phe Leu Leu Thr Leu Phe Thr Asn Ile Ile Phe Val Ala Glu Val
405 410 415
Leu Phe Gly Asp Ser Thr Trp Thr Asn Asp Leu Lys Gly Asn Thr Glu
420 425 430
Asn Pro Ile Leu Leu Pro Tyr Ile Val Val Val Leu Ile Ser Cys Gly
435 440 445
Ser Ile Gly Phe Ala Leu Phe Leu Ala Val Thr Pro Leu Lys Ser Ala
450 455 460
Cys Asn Glu Ala Glu Arg Ala Leu Ser Val His Ser
465 470 475
<210> 2
<211> 6091
<212> DNA
<213> Zea mays
<400> 2
tagcttgtaa gtttgcatct gattgcacaa ccgttgttcc cgtgcgtggg ggactgcggc 60
tcgttcttgg atgaggttct gacttctgag gaggatgggg atggctcacg gcgccgtgac 120
gcgacgatcg gcgtcggcag cggcgcgtcc ctgctgtccc tcctgcatgc ttgccaccca 180
gcttcgcctc gccacgcgtc tcgtggacca ttgcgcgcgt ccctcgtgcc acggcgcacc 240
cgcagccatg agtgccagcg ctcccgtctc ccgactcccg agcaaatcgc tcggcgccta 300
ctactagccc gaaacctagg tggtgggaac tcgggatacg aggtcctctt ctccgccgct 360
tgtcctcggc aagcacaaac gcggtaagcc accaaccgcc tttcgatcgc cgggctccat 420
ccctaagcca tctcgccgcc tcgtgagtcg tgagccgtga gccaaccgac ctgccatcat 480
caattagtga cttcctgaac ctgcttcgtg cgtcctacca ctccaaagtt ccaacaatca 540
agagatttaa acaaagcctt ccataacttg ttgccaataa ggtaactgtc actattgtgc 600
tgctcatcct ttccatctaa gagaaaactt tactgtgtcc tgtgcatact cctctttcat 660
ccgtaactct ccgtaaccat ttgcgggaaa taatgtaaag ttcattctcg gcaaagtatt 720
gtggcgtgtg atggatagag cttaaatcag gagcgtcttc atattgttgt aattggctcg 780
ttgcagtgca ggatttggag gccactgggc tttggaaatt caaagtagac tgcttggatc 840
ataacgagag agcacaaagg gcctgggttt tgtaaacagt tggctttcac tagagtcgat 900
ccattccata ctgagctttt gcatatcatc aattcatcac acaatggatg gtgtgcgatg 960
catggagtcc ccagctgctg gtgatgcccc gcatagttct ttccgaaccc ttgggccaac 1020
actcctggtt tcaatggggt atcttgactt cggaaaatgg ttggtggcag tggaagctgg 1080
gtctcggttt ggctatgatc ttgtcctgct cgtgctgctt tttaatctat cagctattct 1140
gtgtcagtac ctctcgagct gtatcggcat tgtcaccaaa aagaatcttg cggaggtaaa 1200
aatttactca gtcctctctt gccattgtaa actgtagaat tttcaccaga actacggtgt 1260
ggagatctca gttgataaga atggtgattc attaggatag ggtgggccca ccataaattt 1320
ctgtacccgt aatattggtg ttaatttgtt ttgcgtttat gagagatgtc tggggaaaaa 1380
aagctcatgg agtcatggca tcctaactcc taagcgttgt agctatgctg tcgtacttct 1440
gttgaaaaaa tgccatcatc gttcaaatga aaacatcaga tatccacatg tgacaacaat 1500
agaagtatcc cttttatttt acattttctt catctatttt caacagtgtc ttgtgcagat 1560
cttgacttct ttcttgttat atttgtacat gaacaaatag atttgccacc aggagtatga 1620
tcagaaaata tgtgttgttc ttggtcttca agcaggactg tccttgctaa cttctgaatt 1680
taccatggta tgtctacaaa tacttcagaa aatccatttt ctgatgatgg ttgatcttgg 1740
acttttatgt gctcatgata catttgcttg caccattcct aattaacaga gcatgtaagc 1800
agctcggtac atttgaaaca cttagggctg gtttggtgac agtcacctaa ccagcactta 1860
acattttcaa gagaaaaaca cttaacatat gatacttttc agattgcagg catcgtagtt 1920
gggttcaacc ttgtatttga aagcaacaat cccatcacag tcgtatgttt tacaagtgtt 1980
gtagttaatc tgctaccata tacactctcc cttctggtaa atttataagt ctctccaaag 2040
aactgtatat aaaagctgac ttgctctaaa acattttata atttattcta gttcctatat 2100
ttgtgctgat tgtaggacaa gaggaaggct ggaatgttta atgcctacgc atctggcttt 2160
acactagttt gttttgtgct tggtttatta gtgagccatc ccaaaacccc tgtcaatacc 2220
aacgtaatgt tccccaagtt gagtggtgaa agtgcttact cactgatggt actacttggc 2280
acaaatataa tagtacacaa cttttatact cattcatcag ttgttcaggt aaatttctga 2340
caattccatt cccatgttta tgcaattagc tttgtcaagc atgtcttcca ttaaaagttt 2400
gtcttatcaa acctgaatgc atctttcatg gcgaaagtga tgttttgtgt taggattatg 2460
tacaaaaaaa tggtttatgt tagggtactg agtgtattgg ttgttcttga tcaccaattc 2520
gcgaaagggc ctctagctga gttggttagg tggtctgaat agcactcctc aggtcctggg 2580
ttcgactccc cgtgggagcg aatttcaggc tgtggttaaa aaaatcccct cgtctgtccc 2640
acgccaaagc acaggtctaa gactcagccc ggtcgtggtc gttctcacat gggcttcgat 2700
gccgctgtgt atgggtgggg taggggttcg ggggttttct tgacctgtgt gagaaggtat 2760
ttttcttaat acaatacccg gggctgtctt accccccgca ggtcaagttt tgatcaccaa 2820
ttcaccatag gggtgctgaa tgcactgagt tgttcttgat tcattctttg ctagtttggt 2880
ctgctttggc ttcatgtatc agtgttcatt cagatatatt atcacttgtg caggttcaga 2940
gaagatttca gggtcatacc cttggtactc tgtttcatga tcaccttttt tctgtactat 3000
ttgcattttc tggtatcttt cttgtgaatt atattctgat gagttcagca gttgatgagt 3060
ccaaaaacac aatggccatt aacttccaag atgctagaca gctaatgaat caggttcatg 3120
tcattgttct cttcttatcc gtcaagtctt ttgtttaatt ggctatttgt tctccgttca 3180
ccttcctatt aatgtaaaga gcagcattcg aattctcaaa ttataagaca tgaccatagg 3240
tttggtgttg tggcatgcta ctatacttgc atgtttggat tttcaacttt gtgaagttat 3300
tgtattataa gtacattacc tattttttgg gttgaccaaa tggtgcacga gtttcaatat 3360
tttactatgg tcaaaaggac ctaattggag tagcagagtt ttaggaaaaa tatagttcta 3420
gtatatttgg ggttcaagtt atagatatta gaaatcctat agtgtgtgtt tgctttgtgg 3480
aagtgcctca tgctagatca ggtcgtgtat catgagttta ttccatgaat ttttgggtgg 3540
aacaaaccca ttcttcatgt gtatacatta gcttgtgaga attgagttgg tgatgcatca 3600
actcattcta ttctacagac caaacaaaaa gtgatcatga tggatcacca tattactcaa 3660
acccaataca cgttgttcta aacaagggct aaggttggga gaaatgatgt gttctaggga 3720
agccactggg gacactctct taggctcatt ccctgaatag ggacataaag actgagttat 3780
aagtaagctg ctgggatgct ctttttctct tcaactttct tgaaaactta gcctccgcat 3840
gaactggcca gcgcatattc aataaaaata gtatcccttt gagcttggag tgtgcattga 3900
aggaggaagc tccttcctga atttcgtctg gattcttgta ttttgcaggt gttcacaagt 3960
cctgtggcgc caattgtatt attagtggtc cttctctttt caggccacat cgtgtcaatg 4020
acatgtatta ttggtagtga tgtaatttca gaggatctct tcggcataaa gctgcctctt 4080
tttgtgcacc atctgttacc taaggttttt gccatgatta ctactatata ccatgcgaag 4140
gttgtgggtt ttgaagggtt atatcagtta ctcatggtct gcccaattat ccaagctatg 4200
ctccttcctt cgtctgttat acctgttttc cgcatttcct cgtcgagatc attgatggga 4260
agataccgga tatctcgatg tgttgaaata ttgtgcttcc tagcatttct tctaacactg 4320
tttacaaata tcatttttgt ggcggaagtt ctttttggtg atagcacttg gacaaatgac 4380
ctgaaaggga acactgaaaa ccctattcta cttccatata tcgtcgtagt cctgatatca 4440
tgtggatcta ttggttttgc actgttcctt gctgttactc cactaaaatc agcatgtaat 4500
gaagctgaga gagcgttgtc tgtgcactca taacagagag aaacgttgga tgccactcgt 4560
cacagcaaaa ccgacttctc tgagaatagg gcacatgaag catatgaaga acagaggtcc 4620
ttagccatcc ttgttccaca ggattcactg aaaggtgata gaaataattt tcgtagcata 4680
tccgtcatct caaattagct tttgatcaca agggcagttt ctgacgctac tctacatgca 4740
aatcatatgt ctagtaatcc agaagttcat ccttagcatt gactggacag agcctatgtc 4800
aactgaaggt tgtgccctta aaattgactg gacagagagc ctatgtcaac tgaaaaaggt 4860
tgtgcaaata gactcggatg cctgcacgga caacgctctg tttgtggaga agtctgaata 4920
tttcttttat caatcactat ttctcttcca tttaaattca caattaacag gatggttctt 4980
atcatgactg tacctctgtt tgtgggagtg gaagtgttgg cttatctacc tattactcaa 5040
agaaacacca ctgtctcacc tgacacctcc ggtgattgct gcaaacagaa tgctttgttg 5100
gttgttgaat gaagcaaatt aatgtggaca gtggtactgc aaatcaggtg gttcctctat 5160
aggatacacc atgtgtggag tctgcaacaa ggttctagtc tcaacttgca catatggtgg 5220
ctcttgcgag ttgtgacatg atcgtctgac atcaaagcgt gaaagacgtt aataaatctg 5280
ttcaggagaa gcagtcatct agcgtggcaa gcttggaatt gacaatgagt gaggtggaca 5340
ctggtagatc tagtagcagg gtcaaaggat gatttctttt accaagtatg cttgcattcg 5400
tgaggtgatc cttttctctt cttacctgtt tttagtaaaa atagaagtag aaactgtaat 5460
cttcccatga gaaagacgag cttcttgaga tctagatcca ctcaatgagt tgtggcctgt 5520
gggttttgga aaggtttttg ttttagtcga gcatcccatc tttgcagctg aatttcacat 5580
tttagtaaac aacagctaat tggaccatag aaggttgatc atattgcatc tctttttttc 5640
gtgaccatgt ctaagcacat ttttcattag gaggaaggag agtttacaac acacatctta 5700
gtaagcatga tccttgggta gtttacatca tatgatgaat ggttacttct agtatttgcg 5760
tatgccttca gtagtacatt ggatatatcc tctatatttg aactttcgat ggaaagaatt 5820
tgtaggccgc ttatatagac cctatttgga accacttata atcgattcaa ttataatcat 5880
cttactgtga ggatcttttc tattctcgat tatgctagtc caaagttata aacggagatc 5940
aaaagaatca gaaataatct gtgccatagt ctcagtggtg aacaatgcag ttgcccagtt 6000
gtcccgttca aattcctgaa ctattccgct cattgtcgcc accagtttgc tgatttcttc 6060
tttgatttcc ttgatgtagg caaatcaatg a 6091
<210> 3
<211> 3093
<212> DNA
<213> Zea mays
<400> 3
ttagcttgta agtttgcatc tgattgcaca accgttgttc ccgtgcgtgg gggactgcgg 60
ctcgttcttg gatgaggttc tgacttctga ggaggatggg gatggctcac ggcgccgtga 120
cgcgacgatc ggcgtcggca gcggcgcgtc cctgctgtcc ctcctgcatg cttgccaccc 180
agcttcgcct cgccacgcgt ctcgtggacc attgcgcgcg tccctcgtgc cacggcgcac 240
ccgcagccat gagtgccagc gctcccgtct cccgactccc gagcaaatcg ctcggcgcct 300
actactagcc cgaaacctag gtggtgggaa ctcgggatac gaggtcctct tctccgccgc 360
ttgtcctcgg caagcacaaa cgcggtaagc caccaaccgc ctttcgatcg ccgggctcca 420
tccctaagcc atctcgccgc ctcgtgagtc gtgagccgtg agccaaccga cctgccatca 480
tcaattagtg acttcctgaa cctgcttcgt gcgtcctacc actccaaagt tccaacaatc 540
aagagattta aacaaagcct tccataactt gttgccaata agtgcaggat ttggaggcca 600
ctgggctttg gaaattcaaa gtagactgct tggatcataa cgagagagca caaagggcct 660
gggttttgta aacagttggc tttcactaga gtcgatccat tccatactga gcttttgcat 720
atcatcaatt catcacacaa tggatggtgt gcgatgcatg gagtccccag ctgctggtga 780
tgccccgcat agttctttcc gaacccttgg gccaacactc ctggtttcaa tggggtatct 840
tgacttcgga aaatggttgg tggcagtgga agctgggtct cggtttggct atgatcttgt 900
cctgctcgtg ctgcttttta atctatcagc tattctgtgt cagtacctct cgagctgtat 960
cggcattgtc accaaaaaga atcttgcgga gatttgccac caggagtatg atcagaaaat 1020
atgtgttgtt cttggtcttc aagcaggact gtccttgcta acttctgaat ttaccatgat 1080
tgcaggcatc gtagttgggt tcaaccttgt atttgaaagc aacaatccca tcacagtcgt 1140
atgttttaca agtgttgtag ttaatctgct accatataca ctctcccttc tggacaagag 1200
gaaggctgga atgtttaatg cctacgcatc tggctttaca ctagtttgtt ttgtgcttgg 1260
tttattagtg agccatccca aaacccctgt caataccaac gtaatgttcc ccaagttgag 1320
tggtgaaagt gcttactcac tgatggtact acttggcaca aatataatag tacacaactt 1380
ttatactcat tcatcagttg ttcaggttca gagaagattt cagggtcata cccttggtac 1440
tctgtttcat gatcaccttt tttctgtact atttgcattt tctggtatct ttcttgtgaa 1500
ttatattctg atgagttcag cagttgatga gtccaaaaac acaatggcca ttaacttcca 1560
agatgctaga cagctaatga atcaggtgtt cacaagtcct gtggcgccaa ttgtattatt 1620
agtggtcctt ctcttttcag gccacatcgt gtcaatgaca tgtattattg gtagtgatgt 1680
aatttcagag gatctcttcg gcataaagct gcctcttttt gtgcaccatc tgttacctaa 1740
ggtttttgcc atgattacta ctatatacca tgcgaaggtt gtgggttttg aagggttata 1800
tcagttactc atggtctgcc caattatcca agctatgctc cttccttcgt ctgttatacc 1860
tgttttccgc atttcctcgt cgagatcatt gatgggaaga taccggatat ctcgatgtgt 1920
tgaaatattg tgcttcctag catttcttct aacactgttt acaaatatca tttttgtggc 1980
ggaagttctt tttggtgata gcacttggac aaatgacctg aaagggaaca ctgaaaaccc 2040
tattctactt ccatatatcg tcgtagtcct gatatcatgt ggatctattg gttttgcact 2100
gttccttgct gttactccac taaaatcagc atgtaatgaa gctgagagag cgttgtctgt 2160
gcactcataa cagagagaaa cgttggatgc cactcgtcac agcaaaaccg acttctctga 2220
gaatagggca catgaagcat atgaagaaca gaggtcctta gccatccttg ttccacagga 2280
ttcactgaaa gtaatccaga agttcatcct tagcattgac tggacagagc ctatgtcaac 2340
tgaaggttgt gcccttaaaa ttgactggac agagagccta tgtcaactga aaaaggttgt 2400
gcaaatagac tcggatgcct gcacggacaa cgctctgttt gtggagaagt ctgaatattt 2460
cttttatcaa tcactatttc tcttccattt aaattcacaa ttaacaggat ggttcttatc 2520
atgactgtac ctctgtttgt gggagtggaa gtgttggctt atctacctat tactcaaaga 2580
aacaccactg tctcacctga cacctccggt gattgctgca aacagaatgc tttgttggtt 2640
gttgaatgaa gcaaattaat gtggacagtg gtactgcaaa tcaggtggtt cctctatagg 2700
atacaccatg tgtggagtct gcaacaaggt tctagtctca acttgcacat atggtggctc 2760
ttgcgagttg tgacatgatc gtctgacatc aaagcgtgaa agacgttaat aaatctgttc 2820
aggagaagca gtcatctagc gtggcaagct tggaattgac aatgagtgag gtggacactg 2880
gtagatctag tagcagggtc aaaggatgat ttcttttacc aagtatgctt gcattcgtga 2940
ggtgatcctt ttctcttctt acctgttttt agtaaaaata gaagtagaaa ctgtaatctt 3000
cccatgagaa agacgagctt cttgagatct agatccactc aatgagttgt ggcctgtggg 3060
ttttggaaag gtttttgttt tagtcgagca tcc 3093
<210> 4
<211> 1431
<212> DNA
<213> Zea mays
<400> 4
atggatggtg tgcgatgcat ggagtcccca gctgctggtg atgccccgca tagttctttc 60
cgaacccttg ggccaacact cctggtttca atggggtatc ttgacttcgg aaaatggttg 120
gtggcagtgg aagctgggtc tcggtttggc tatgatcttg tcctgctcgt gctgcttttt 180
aatctatcag ctattctgtg tcagtacctc tcgagctgta tcggcattgt caccaaaaag 240
aatcttgcgg agatttgcca ccaggagtat gatcagaaaa tatgtgttgt tcttggtctt 300
caagcaggac tgtccttgct aacttctgaa tttaccatga ttgcaggcat cgtagttggg 360
ttcaaccttg tatttgaaag caacaatccc atcacagtcg tatgttttac aagtgttgta 420
gttaatctgc taccatatac actctccctt ctggacaaga ggaaggctgg aatgtttaat 480
gcctacgcat ctggctttac actagtttgt tttgtgcttg gtttattagt gagccatccc 540
aaaacccctg tcaataccaa cgtaatgttc cccaagttga gtggtgaaag tgcttactca 600
ctgatggtac tacttggcac aaatataata gtacacaact tttatactca ttcatcagtt 660
gttcaggttc agagaagatt tcagggtcat acccttggta ctctgtttca tgatcacctt 720
ttttctgtac tatttgcatt ttctggtatc tttcttgtga attatattct gatgagttca 780
gcagttgatg agtccaaaaa cacaatggcc attaacttcc aagatgctag acagctaatg 840
aatcaggtgt tcacaagtcc tgtggcgcca attgtattat tagtggtcct tctcttttca 900
ggccacatcg tgtcaatgac atgtattatt ggtagtgatg taatttcaga ggatctcttc 960
ggcataaagc tgcctctttt tgtgcaccat ctgttaccta aggtttttgc catgattact 1020
actatatacc atgcgaaggt tgtgggtttt gaagggttat atcagttact catggtctgc 1080
ccaattatcc aagctatgct ccttccttcg tctgttatac ctgttttccg catttcctcg 1140
tcgagatcat tgatgggaag ataccggata tctcgatgtg ttgaaatatt gtgcttccta 1200
gcatttcttc taacactgtt tacaaatatc atttttgtgg cggaagttct ttttggtgat 1260
agcacttgga caaatgacct gaaagggaac actgaaaacc ctattctact tccatatatc 1320
gtcgtagtcc tgatatcatg tggatctatt ggttttgcac tgttccttgc tgttactcca 1380
ctaaaatcag catgtaatga agctgagaga gcgttgtctg tgcactcata a 1431
<210> 5
<211> 20
<212> DNA
<213> unknown (Artificial Synthesis)
<400> 5
cgcatagttc tttccgaacc 20
<210> 6
<211> 19
<212> DNA
<213> Unknown (Artificial Synthesis)
<400> 6
caccaaccat tttccgaag 19
<210> 7
<211> 84
<212> DNA
<213> Zea mays
<400> 7
cgcatagttc tttccgaacc cttgggccaa cactcctggt ttcaatgggg tatctagtat 60
cttgacttcg gaaaatggtt ggtg 84
<210> 8
<211> 77
<212> DNA
<213> Zea mays
<400> 8
cgcatagttc tttccgaacc cttgggccaa cactcctggt ttcaatgggg tatcttgact 60
tcggaaaatg gttggtg 77
<210> 9
<211> 20
<212> DNA
<213> unknown (Artificial Synthesis)
<400> 9
gcctacgcat ctggctttac 20
<210> 10
<211> 20
<212> DNA
<213> Unknown (Artificial Synthesis)
<400> 10
ggccattgtg tttttggact 20
<210> 11
<211> 935
<212> DNA
<213> Zea mays
<400> 11
gcctacgcat ctggctttac actagtttgt tttgtgcttg gtttattagt gagccatccc 60
aaaacccctg tcaataccaa cgtaatgttc cccaagttga gtggtgaaag tgcttactca 120
ctgatggtac tacttggcac aaatataata gtacacaact tttatactca ttcatcagtt 180
gttcaggtaa atttctgaca attccattcc catgtttatg caattagctt tgtcaagcat 240
gtcttccatt aaaagtttgt cttatcaaac ctgaatgcat ctttcatggc gaaagtgatg 300
ttttgtgtta ggattatgta caaaaaaatg gtttatgtta gggtactgag tgtattggtt 360
gttcttgatc accaattcgc gaaagggcct ctagctgagt tggttaggtg gtctgaatag 420
cactcctcag gtcctgggtt cgactccccg tgggagcgaa tttcaggctg tggttaaaaa 480
aatcccctcg tctgtcccac gccaaagcac aggtctaaga ctcagcccgg tcgtggtcgt 540
tctcacatgg gcttcgatgc cgctgtgtat gggtggggta ggggttcggg ggttttcttg 600
acctgtgtga gaaggtattt ttcttaatac aatacccggg gctgtcttac cccccgcagg 660
tcaagttttg atcaccaatt caccataggg gtgctgaatg cactgagttg ttcttgattc 720
attctttgct agtttggtct gctttggctt catgtatcag tgttcattca gatatattat 780
cacttgtgca ggttcagaga agatttcagg gtcataccct tggtactctg tttcatgatc 840
accttttttc tgtactattt gcattttctg gtatctttct tgtgaattat attctgatga 900
gttcagcagt tgatgagtcc aaaaacacaa tggcc 935
<210> 12
<211> 632
<212> DNA
<213> Zea mays
<400> 12
gcctacgcat ctggctttac actagtttgt tttgtgcttg gtttattagt gagccatccc 60
aaaacccctg tcaataccaa cgtaatgttc cccaagttga gtggtgaaag tgcttactca 120
ctgatggtac tacttggcac aaatataata gtacacaact tttatactca ttcatcagtt 180
gttcaggtaa atttctgaca attccattcc catgtttatg caattagctt tgtcaagcat 240
gtcttccatt aaaagtttgt cttatcaaac ctgaatgcat ctttcatggc gaaagtgatg 300
ttttgtgtta ggattatgta caaaaaaatg gtttatgtta gggtactgag tgtattggtt 360
gtttttgatc accaattcac cataggggtg ctgaatgcac tgagttgttc ttgattcatt 420
ctttgctagt ttggtctgct ttggcttcat gtatcagtgt tcattcagat atattatcac 480
ttgtgcaggt tcagagaaga tttcagggtc atacccttgg tactctgttt catgatcacc 540
ttttttctgt actatttgca ttttctggta tctttcttgt gaattatatt ctgatgagtt 600
cagcagttga tgagtccaaa aacacaatgg cc 632
<210> 13
<211> 1313
<212> DNA
<213> Zea mays
<400> 13
aaatcgctcg gcgcctacta ctagcccgaa acctaggtgg tgggaactcg ggatacgagg 60
tcctcttctc cgccgcttgt cctcggcaag cacaaacgcg gtaagccacc aaccgccttt 120
cgatcgccgg gctccatccc taagccatct cgccgcctcg tgagtcgtga gccgtgagcc 180
aaccgacctg ccatcatcaa ttagtgactt cctgaacctg cttcgtgcgt cctaccactc 240
caaagttcca acaatcaaga gatttaaaca aagccttcca taacttgttg ccaataagtg 300
caggatttgg aggccactgg gctttggaaa ttcaaagtag actgcttgga tcataacgag 360
agagcacaaa gggcctgggt tttgtaaaca gttggctttc actagagtcg atccattcca 420
tactgagctt ttgcatatca tcaattcatc acacaatgga tggtgtgcga tgcatggagt 480
ccccagctgc tggtgatgcc ccgcatagtt ctttccgaac ccttgggcca acactcctgg 540
tttcaatggg gtatcttgac ttcggaaaat ggttggtggc agtggaagct gggtctcggt 600
ttggctatga tcttgtcctg ctcgtgctgc tttttaatct atcagctatt ctgtgtcagt 660
acctctcgag ctgtatcggc attgtcacca aaaagaatct tgcggagatt tgccaccagg 720
agtatgatca gaaaatatgt gttgttcttg gtcttcaagc aggactgtcc ttgctaactt 780
ctgaatttac catgattgca ggcatcgtag ttgggttcaa ccttgtattt gaaagcaaca 840
atcccatcac agtcgtatgt tttacaagtg ttgtagttaa tctgctacca tatacactct 900
cccttctgga caagaggaag gctggaatgt ttaatgccta cgcatctggc tttacactag 960
tttgttttgt gcttggttta ttagtgagcc atcccaaaac ccctgtcaat accaacgtaa 1020
tgttccccaa gttgagtggt gaaagtgctt actcactgat ggtactactt ggcacaaata 1080
taatagtaca caacttttat actcattcat cagttgttca ggttcagaga agatttcagg 1140
gtcataccct tggtactctg tttcatgatc accttttttc tgtactattt gcattttctg 1200
gtatctttct tgtgaattat attctgatga gttcagcagt tgatgagtcc aaaaacacaa 1260
tggccattaa cttccaagat gctagacagc taatgaatca ggcaaatcaa tga 1313
<210> 14
<211> 858
<212> DNA
<213> Zea mays
<400> 14
atggatggtg tgcgatgcat ggagtcccca gctgctggtg atgccccgca tagttctttc 60
cgaacccttg ggccaacact cctggtttca atggggtatc ttgacttcgg aaaatggttg 120
gtggcagtgg aagctgggtc tcggtttggc tatgatcttg tcctgctcgt gctgcttttt 180
aatctatcag ctattctgtg tcagtacctc tcgagctgta tcggcattgt caccaaaaag 240
aatcttgcgg agatttgcca ccaggagtat gatcagaaaa tatgtgttgt tcttggtctt 300
caagcaggac tgtccttgct aacttctgaa tttaccatga ttgcaggcat cgtagttggg 360
ttcaaccttg tatttgaaag caacaatccc atcacagtcg tatgttttac aagtgttgta 420
gttaatctgc taccatatac actctccctt ctggacaaga ggaaggctgg aatgtttaat 480
gcctacgcat ctggctttac actagtttgt tttgtgcttg gtttattagt gagccatccc 540
aaaacccctg tcaataccaa cgtaatgttc cccaagttga gtggtgaaag tgcttactca 600
ctgatggtac tacttggcac aaatataata gtacacaact tttatactca ttcatcagtt 660
gttcaggttc agagaagatt tcagggtcat acccttggta ctctgtttca tgatcacctt 720
ttttctgtac tatttgcatt ttctggtatc tttcttgtga attatattct gatgagttca 780
gcagttgatg agtccaaaaa cacaatggcc attaacttcc aagatgctag acagctaatg 840
aatcaggcaa atcaatga 858
<210> 15
<211> 1526
<212> DNA
<213> Zea mays
<400> 15
aaatcgctcg gcgcctacta ctagcccgaa acctaggtgg tgggaactcg ggatacgagg 60
tcctcttctc cgccgcttgt cctcggcaag cacaaacgcg gtaagccacc aaccgccttt 120
cgatcgccgg gctccatccc taagccatct cgccgcctcg tgagtcgtga gccgtgagcc 180
aaccgacctg ccatcatcaa ttagtgactt cctgaacctg cttcgtgcgt cctaccactc 240
caaagttcca acaatcaaga gatttaaaca aagccttcca taacttgttg ccaataagtg 300
caggatttgg aggccactgg gctttggaaa ttcaaagtag actgcttgga tcataacgag 360
agagcacaaa gggcctgggt tttgtaaaca gttggctttc actagagtcg atccattcca 420
tactgagctt ttgcatatca tcaattcatc acacaatgga tggtgtgcga tgcatggagt 480
ccccagctgc tggtgatgcc ccgcatagtt ctttccgaac ccttgggcca acactcctgg 540
tttcaatggg gtatcttgac ttcggaaaat ggttggtggc agtggaagct gggtctcggt 600
ttggctatga tcttgtcctg ctcgtgctgc tttttaatct atcagctatt ctgtgtcagt 660
acctctcgag ctgtatcggc attgtcacca aaaagaatct tgcggagatt tgccaccagg 720
agtatgatca gaaaatatgt gttgttcttg gtcttcaagc aggactgtcc ttgctaactt 780
ctgaatttac catgattgca ggcatcgtag ttgggttcaa ccttgtattt gaaagcaaca 840
atcccatcac agtcgtatgt tttacaagtg ttgtagttaa tctgctacca tatacactct 900
cccttctgga caagaggaag gctggaatgt ttaatgccta cgcatctggc tttacactag 960
tttgttttgt gcttggttta ttagtgagcc atcccaaaac ccctgtcaat accaacgtaa 1020
tgttccccaa gttgagtggt gaaagtgctt actcactgat ggtactactt ggcacaaata 1080
taatagtaca caacttttat actcattcat cagttgttca ggttcagaga agatttcagg 1140
gtcataccct tggtactctg tttcatgatc accttttttc tgtactattt gcattttctg 1200
gtatctttct tgtgaattat attctgatga gttcagcagt tgatgagtcc aaaaacacaa 1260
tggccattaa cttccaagat gctagacagc taatgaatca ggttcatgtc attgttctct 1320
tcttatccgt caagtctttt gtttaattgg ctatttgttc tccgttcacc ttcctattaa 1380
tgtaaagagc agcattcgaa ttctcaaatt ataagacatg accataggtt tggtgttgtg 1440
gcatgctact atacttgcat gtttggattt tcaactttgt gaagttattg tattataagt 1500
acattaccta ttttttgggt tgacca 1526
<210> 16
<211> 891
<212> DNA
<213> Zea mays
<400> 16
atggatggtg tgcgatgcat ggagtcccca gctgctggtg atgccccgca tagttctttc 60
cgaacccttg ggccaacact cctggtttca atggggtatc ttgacttcgg aaaatggttg 120
gtggcagtgg aagctgggtc tcggtttggc tatgatcttg tcctgctcgt gctgcttttt 180
aatctatcag ctattctgtg tcagtacctc tcgagctgta tcggcattgt caccaaaaag 240
aatcttgcgg agatttgcca ccaggagtat gatcagaaaa tatgtgttgt tcttggtctt 300
caagcaggac tgtccttgct aacttctgaa tttaccatga ttgcaggcat cgtagttggg 360
ttcaaccttg tatttgaaag caacaatccc atcacagtcg tatgttttac aagtgttgta 420
gttaatctgc taccatatac actctccctt ctggacaaga ggaaggctgg aatgtttaat 480
gcctacgcat ctggctttac actagtttgt tttgtgcttg gtttattagt gagccatccc 540
aaaacccctg tcaataccaa cgtaatgttc cccaagttga gtggtgaaag tgcttactca 600
ctgatggtac tacttggcac aaatataata gtacacaact tttatactca ttcatcagtt 660
gttcaggttc agagaagatt tcagggtcat acccttggta ctctgtttca tgatcacctt 720
ttttctgtac tatttgcatt ttctggtatc tttcttgtga attatattct gatgagttca 780
gcagttgatg agtccaaaaa cacaatggcc attaacttcc aagatgctag acagctaatg 840
aatcaggttc atgtcattgt tctcttctta tccgtcaagt cttttgttta a 891
<210> 17
<211> 285
<212> PRT
<213> Zea mays
<400> 17
Met Asp Gly Val Arg Cys Met Glu Ser Pro Ala Ala Gly Asp Ala Pro
1 5 10 15
His Ser Ser Phe Arg Thr Leu Gly Pro Thr Leu Leu Val Ser Met Gly
20 25 30
Tyr Leu Asp Phe Gly Lys Trp Leu Val Ala Val Glu Ala Gly Ser Arg
35 40 45
Phe Gly Tyr Asp Leu Val Leu Leu Val Leu Leu Phe Asn Leu Ser Ala
50 55 60
Ile Leu Cys Gln Tyr Leu Ser Ser Cys Ile Gly Ile Val Thr Lys Lys
65 70 75 80
Asn Leu Ala Glu Ile Cys His Gln Glu Tyr Asp Gln Lys Ile Cys Val
85 90 95
Val Leu Gly Leu Gln Ala Gly Leu Ser Leu Leu Thr Ser Glu Phe Thr
100 105 110
Met Ile Ala Gly Ile Val Val Gly Phe Asn Leu Val Phe Glu Ser Asn
115 120 125
Asn Pro Ile Thr Val Val Cys Phe Thr Ser Val Val Val Asn Leu Leu
130 135 140
Pro Tyr Thr Leu Ser Leu Leu Asp Lys Arg Lys Ala Gly Met Phe Asn
145 150 155 160
Ala Tyr Ala Ser Gly Phe Thr Leu Val Cys Phe Val Leu Gly Leu Leu
165 170 175
Val Ser His Pro Lys Thr Pro Val Asn Thr Asn Val Met Phe Pro Lys
180 185 190
Leu Ser Gly Glu Ser Ala Tyr Ser Leu Met Val Leu Leu Gly Thr Asn
195 200 205
Ile Ile Val His Asn Phe Tyr Thr His Ser Ser Val Val Gln Val Gln
210 215 220
Arg Arg Phe Gln Gly His Thr Leu Gly Thr Leu Phe His Asp His Leu
225 230 235 240
Phe Ser Val Leu Phe Ala Phe Ser Gly Ile Phe Leu Val Asn Tyr Ile
245 250 255
Leu Met Ser Ser Ala Val Asp Glu Ser Lys Asn Thr Met Ala Ile Asn
260 265 270
Phe Gln Asp Ala Arg Gln Leu Met Asn Gln Ala Asn Gln
275 280 285
<210> 18
<211> 296
<212> PRT
<213> Zea mays
<400> 18
Met Asp Gly Val Arg Cys Met Glu Ser Pro Ala Ala Gly Asp Ala Pro
1 5 10 15
His Ser Ser Phe Arg Thr Leu Gly Pro Thr Leu Leu Val Ser Met Gly
20 25 30
Tyr Leu Asp Phe Gly Lys Trp Leu Val Ala Val Glu Ala Gly Ser Arg
35 40 45
Phe Gly Tyr Asp Leu Val Leu Leu Val Leu Leu Phe Asn Leu Ser Ala
50 55 60
Ile Leu Cys Gln Tyr Leu Ser Ser Cys Ile Gly Ile Val Thr Lys Lys
65 70 75 80
Asn Leu Ala Glu Ile Cys His Gln Glu Tyr Asp Gln Lys Ile Cys Val
85 90 95
Val Leu Gly Leu Gln Ala Gly Leu Ser Leu Leu Thr Ser Glu Phe Thr
100 105 110
Met Ile Ala Gly Ile Val Val Gly Phe Asn Leu Val Phe Glu Ser Asn
115 120 125
Asn Pro Ile Thr Val Val Cys Phe Thr Ser Val Val Val Asn Leu Leu
130 135 140
Pro Tyr Thr Leu Ser Leu Leu Asp Lys Arg Lys Ala Gly Met Phe Asn
145 150 155 160
Ala Tyr Ala Ser Gly Phe Thr Leu Val Cys Phe Val Leu Gly Leu Leu
165 170 175
Val Ser His Pro Lys Thr Pro Val Asn Thr Asn Val Met Phe Pro Lys
180 185 190
Leu Ser Gly Glu Ser Ala Tyr Ser Leu Met Val Leu Leu Gly Thr Asn
195 200 205
Ile Ile Val His Asn Phe Tyr Thr His Ser Ser Val Val Gln Val Gln
210 215 220
Arg Arg Phe Gln Gly His Thr Leu Gly Thr Leu Phe His Asp His Leu
225 230 235 240
Phe Ser Val Leu Phe Ala Phe Ser Gly Ile Phe Leu Val Asn Tyr Ile
245 250 255
Leu Met Ser Ser Ala Val Asp Glu Ser Lys Asn Thr Met Ala Ile Asn
260 265 270
Phe Gln Asp Ala Arg Gln Leu Met Asn Gln Val His Val Ile Val Leu
275 280 285
Phe Leu Ser Val Lys Ser Phe Val
290 295
<210> 19
<211> 1991
<212> DNA
<213> Zea mays
<400> 19
ctgcagtgca gcgtgacccg gtcgtgcccc tctctagaga taatgagcat tgcatgtcta 60
agttataaaa aattaccaca tatttttttt gtcacacttg tttgaagtgc agtttatcta 120
tctttataca tatatttaaa ctttactcta cgaataatat aatctatagt actacaataa 180
tatcagtgtt ttagagaatc atataaatga acagttagac atggtctaaa ggacaattga 240
gtattttgac aacaggactc tacagtttta tctttttagt gtgcatgtgt tctccttttt 300
ttttgcaaat agcttcacct atataatact tcatccattt tattagtaca tccatttagg 360
gtttagggtt aatggttttt atagactaat ttttttagta catctatttt attctatttt 420
agcctctaaa ttaagaaaac taaaactcta ttttagtttt tttatttaat aatttagata 480
taaaatagaa taaaataaag tgactaaaaa ttaaacaaat accctttaag aaattaaaaa 540
aactaaggaa acatttttct tgtttcgagt agataatgcc agcctgttaa acgccgtcga 600
cgagtctaac ggacaccaac cagcgaacca gcagcgtcgc gtcgggccaa gcgaagcaga 660
cggcacggca tctctgtcgc tgcctctgga cccctctcga gagttccgct ccaccgttgg 720
acttgctccg ctgtcggcat ccagaaattg cgtggcggag cggcagacgt gagccggcac 780
ggcaggcggc ctcctcctcc tctcacggca ccggcagcta cgggggattc ctttcccacc 840
gctccttcgc tttcccttcc tcgcccgccg taataaatag acaccccctc cacaccctct 900
ttccccaacc tcgtgttgtt cggagcgcac acacacacaa ccagatctcc cccaaatcca 960
cccgtcggca cctccgcttc aaggtacgcc gctcgtcctc cccccccccc tctctacctt 1020
ctctagatcg gcgttccggt ccatggttag ggcccggtag ttctacttct gttcatgttt 1080
gtgttagatc cgtgtttgtg ttagatccgt gctgctagcg ttcgtacacg gatgcgacct 1140
gtacgtcaga cacgttctga ttgctaactt gccagtgttt ctctttgggg aatcctggga 1200
tggctctagc cgttccgcag acgggatcga tttcatgatt ttttttgttt cgttgcatag 1260
ggtttggttt gcccttttcc tttatttcaa tatatgccgt gcacttgttt gtcgggtcat 1320
cttttcatgc ttttttttgt cttggttgtg atgatgtggt ctggttgggc ggtcgttcta 1380
gatcggagta gaattctgtt tcaaactacc tggtggattt attaattttg gatctgtatg 1440
tgtgtgccat acatattcat agttacgaat tgaagatgat ggatggaaat atcgatctag 1500
gataggtata catgttgatg cgggttttac tgatgcatat acagagatgc tttttgttcg 1560
cttggttgtg ttgatgtggt gtggttgggc ggtcgttcat tcgttctaga tcggagtaga 1620
atactgtttc aaactacctg gtgtatttat taattttgga actgtatgtg tgtgtcatac 1680
atcttcatag ttacgagttt aagatggatg gaaatatcga tctaggatag gtatacatgt 1740
tgatgtgggt tttactgatg catatacatg atggcatatg cagcatctat tcatatgctc 1800
taaccttgag tacctatcta ttataataaa caagtatgtt ttataattat tttgatcttg 1860
atatacttgg atgatggcat atgcagcagc tatatgtgga tttttttagc cctgccttca 1920
tacgctattt atttgcttgg tactgtttct tttgtcgatg ctcaccctgt tgtttggtgt 1980
tacttctgca g 1991

Claims (7)

1. The application of the protein in controlling the water content or dehydration rate of corn grains is characterized in that: the amino acid sequence of the protein is shown in any one of SEQ ID NO.1, SEQ ID NO.17 or SEQ ID NO. 18.
2. Use of a nucleic acid for controlling a moisture content or dehydration rate trait in corn kernel, wherein the nucleic acid encodes a protein according to claim 1; optionally, the nucleotide sequence or reverse complementary sequence of the nucleic acid is shown as any one of SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15 or SEQ ID NO. 16.
3. A molecular marker, which is characterized in that 7 bases AGTATCT are inserted into the position of 1044-1045 of the sequence shown in SEQ ID NO. 2; or 303 bases CTTGATCACCAATTCGCGAAAGGGCCTCTAGCTGAGTTGGTTAGGTGGTCTGAATAGCACTCCTCAGGTCCTGGGTTCGACTCCCCGTGGGAGCGAATTTCAGGCTGTGGTTAAAAAAATCCCCTCGTCTGTCCCACGCCAAAGCACAGGTCTAAGACTCAGCCCGGTCGTGGTCGTTCTCACATGGGCTTCGATGCCGCTGTGTATGGGTGGGGTAGGGGTTCGGGGGTTTTCTTGACCTGTGTGAGAAGGTATTTTTCTTAATACAATACCCGGGGCTGTCTTACCCCCCGCAGGTCAAGT at position 2506 and 2808 of the sequence shown in SEQ ID NO. 2.
4. A method for identifying or assisting in identifying the water content or dehydration rate character of corn kernels is characterized by comprising the following steps: (1) detecting the molecular marker of claim 3 in a test material; (2) if the detection result is that the marker is included, the material to be detected shows the character of high water content of grains or slow dehydration rate; if the detection result is that the marker is not included, the material to be detected shows the characteristics of low water content of grains or high dehydration rate; optionally, the detection method of the molecular marker adopts PCR amplification;
optionally, the primer pair adopted by the PCR amplification consists of SEQ ID NO.5/SEQ ID NO.6 or SEQ ID NO.9/SEQ ID NO. 10;
optionally, the PCR amplification product containing the marker is shown as SEQ ID NO.7 or SEQ ID NO. 11; the expression PCR amplification product not containing the above marker is shown in SEQ ID NO.8 or SEQ ID NO. 12.
5. A method for screening corn materials with the characteristics of low grain water content or high dehydration rate, which is characterized in that the molecular marker in claim 3 in a material to be tested is detected according to the method in claim 4, and materials which do not contain the molecular marker in claim 3 are screened.
6. A method for reducing the moisture content of corn kernels or increasing the rate of dehydration, characterized in that the expression and/or activity of the protein of claim 1 is increased in the corn material to be modified, plants are selected which have a low moisture content of corn kernels or a high rate of dehydration;
optionally, the method of increasing the expression of a protein is to use a highly active promoter to drive expression of a nucleic acid sequence encoding the protein;
optionally, the high-activity promoter is a maize ubiquitin promoter;
optionally, the sequence of the maize ubiquitin promoter is shown in SEQ ID NO. 19.
7. Use of the molecular marker and method of claims 3-6 for improving moisture content or dehydration rate traits of corn kernel.
CN202210595676.4A 2022-05-30 2022-05-30 Corn kernel water content control gene ZmEIN2-1 and molecular marker thereof Active CN114989281B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210595676.4A CN114989281B (en) 2022-05-30 2022-05-30 Corn kernel water content control gene ZmEIN2-1 and molecular marker thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210595676.4A CN114989281B (en) 2022-05-30 2022-05-30 Corn kernel water content control gene ZmEIN2-1 and molecular marker thereof

Publications (2)

Publication Number Publication Date
CN114989281A true CN114989281A (en) 2022-09-02
CN114989281B CN114989281B (en) 2024-04-05

Family

ID=83028735

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210595676.4A Active CN114989281B (en) 2022-05-30 2022-05-30 Corn kernel water content control gene ZmEIN2-1 and molecular marker thereof

Country Status (1)

Country Link
CN (1) CN114989281B (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111719012A (en) * 2020-06-29 2020-09-29 吉林省农业科学院 dCAPS molecular marker primer pair for identifying dehydration rate genotype of corn kernel and application
CN112521471A (en) * 2020-11-27 2021-03-19 华中农业大学 Gene and molecular marker for controlling water content of corn kernels and application thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111719012A (en) * 2020-06-29 2020-09-29 吉林省农业科学院 dCAPS molecular marker primer pair for identifying dehydration rate genotype of corn kernel and application
CN112521471A (en) * 2020-11-27 2021-03-19 华中农业大学 Gene and molecular marker for controlling water content of corn kernels and application thereof

Also Published As

Publication number Publication date
CN114989281B (en) 2024-04-05

Similar Documents

Publication Publication Date Title
US9663794B2 (en) Heat-resistance rice gene OsZFP, screening marker and separation method thereof
CN112375130B (en) Corn ear length gene and molecular marker and application thereof
CN111153974A (en) Corn disease-resistant gene and molecular marker and application thereof
CN108165554B (en) Corn leaf width control gene ZmNL4 and application thereof
US11479784B2 (en) Modulation of seed vigor
CN110862993B (en) Gene ZKM89 for controlling plant height and ear position height of corn and application thereof
CN111235180A (en) Method for shortening flowering phase of corn
CN110903368B (en) Gene for controlling female character of corn, kit for creating female sterile line of corn, mutant genotype and method
CN111172173A (en) Method for reducing plant height of corn or delaying flowering
CN112521471B (en) Gene and molecular marker for controlling water content of corn kernels and application thereof
JP6639382B2 (en) Brassica plant comprising mutant DA1 allele
CN101747420B (en) Dominant dwarf rice related protein, encoding gene thereof and application
CN110862440B (en) Gene ZKM465 for controlling corn plant height and application thereof
CN116445446B (en) Wild cabbage glycosyltransferase BoUGT C2 gene and application
CN108484741B (en) Protein for controlling grain weight of crop seeds and application thereof
CN114989281B (en) Corn kernel water content control gene ZmEIN2-1 and molecular marker thereof
CN114958867A (en) Corn ear grain weight and yield regulation gene KWE2, and encoding protein, functional marker, expression vector and application thereof
CN110862994B (en) Gene ZKM76 for controlling corn plant height and ear position and application thereof
CN110358774B (en) Gene, protein, gene expression cassette, expression vector, host cell, method and application for controlling rice flowering time
CN111172171A (en) Gene for controlling plant height and flowering phase of corn and application thereof
CN112724210A (en) Plant amyloplast development related protein OsSSG7 and coding gene and application thereof
CN110959043A (en) Method for improving agronomic traits of plants by using BCS1L gene and guide RNA/CAS endonuclease system
CN114540375B (en) Gene and molecular marker for regulating and controlling flowering period and photoperiod adaptability of corn and application of gene and molecular marker
CN110229801B (en) Gene for controlling rice leaf senescence and protein coded by same
CN116426562A (en) Corn kernel type gene and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
CB03 Change of inventor or designer information

Inventor after: Yan Jianbing

Inventor after: Li Wenqiang

Inventor after: Yu Yanhui

Inventor after: Liu Longyu

Inventor after: Wu Shenshen

Inventor before: Yan Jianbing

Inventor before: Li Wenqiang

Inventor before: Jin Yanhui

Inventor before: Liu Longyu

Inventor before: Wu Shenshen

CB03 Change of inventor or designer information
GR01 Patent grant
GR01 Patent grant