CN114989281B - Corn kernel water content control gene ZmEIN2-1 and molecular marker thereof - Google Patents

Corn kernel water content control gene ZmEIN2-1 and molecular marker thereof Download PDF

Info

Publication number
CN114989281B
CN114989281B CN202210595676.4A CN202210595676A CN114989281B CN 114989281 B CN114989281 B CN 114989281B CN 202210595676 A CN202210595676 A CN 202210595676A CN 114989281 B CN114989281 B CN 114989281B
Authority
CN
China
Prior art keywords
seq
leu
moisture content
dehydration rate
val
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202210595676.4A
Other languages
Chinese (zh)
Other versions
CN114989281A (en
Inventor
严建兵
李文强
余延辉
刘龙雨
吴伸伸
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Huazhong Agricultural University
Original Assignee
Huazhong Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Huazhong Agricultural University filed Critical Huazhong Agricultural University
Priority to CN202210595676.4A priority Critical patent/CN114989281B/en
Publication of CN114989281A publication Critical patent/CN114989281A/en
Application granted granted Critical
Publication of CN114989281B publication Critical patent/CN114989281B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Botany (AREA)
  • Immunology (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Mycology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a corn kernel water content control gene ZmEIN2-1, a related molecular marker and application thereof in screening or improving corn kernel water content or dehydration rate characteristics, and belongs to the field of molecular genetics. The invention provides the sequence of the ZmEIN2-1 gene and discloses 2 InDel sites in the ZmEIN2-1 gene, which are obviously related to the moisture content or dehydration rate of corn kernels: inDel_7/0 and InDel_303/000 sites. The invention discloses a method for screening the moisture content or dehydration rate of corn kernels based on the molecular markers developed at InDel_7/0 and InDel_303/000 sites. Further, the invention discloses a method for regulating and controlling the moisture content or dehydration rate of corn kernels by changing the expression of ZmEIN2-1 protein through genetic engineering means.

Description

Corn kernel water content control gene ZmEIN2-1 and molecular marker thereof
Technical Field
The invention relates to a corn kernel water content control gene ZmEIN2-1, a related molecular marker and application thereof in screening or improving corn kernel water content or dehydration rate, belonging to the field of molecular genetics.
Background
Grain moisture is a key factor affecting the mechanical harvest quality, safe storage and economic benefits of corn. The moisture content of the seeds during harvesting has great influence on corn harvesting, drying, storage, transportation and processing utilization, and too high moisture content often causes corn growers and operators to suffer economic loss, reduces economic benefit, and also easily causes the mildewing of the seeds to influence the corn quality. In addition, kernel harvesting has become one of the main factors limiting corn production in China, and the most critical link of corn kernel harvesting is that the moisture content of corn kernels cannot reach the standard moisture content (Wang Z, wang X, zhang L, liu X, di H, li T, jin X.QTL underlying field grain drying rate after physiological maturity in maize (Zea Mays L.) [ J ]. Euphytica,2012,185 (3): 521-528.) which can be harvested by the kernel. Therefore, the method is very important for breeding corn varieties with low water content in the grains during harvesting. In addition, the low water content of the seeds can shorten the growth period of corn, which has great production significance for harvesting the corn before the frost period in the high latitude area of China and not affecting the wheat planting in the Huang-Huai-Hai area.
Some studies have now resulted in QTLs controlling moisture content and dehydration rate of corn kernels, distributed on 10 chromosomes of corn, wherein QTLs located on chromosome 1 mainly include: q45dGM1-1, qHTGM1-2, and qAUDDC1-1 (Zhang J, zhang F, tang B, ding Y, xia L, qi J, mu X, gu L, lu D, chen Y.molecular mapping of quantitative trait loci for grain moisture at harvest and field grain drying rate in maize (Zea mays L.) [ J ]. Physiol Plant,2020,169 (1): 64-72), mQTL1-1, mQTL1-2, mQTL1-3, and mQTL1-4 (Li Y, dong Y, yang M, wang Q, shi Q, zhou Q, deng F, ma Z, qiao D, xu H.QTL Detection for Grain Water Relations and Genetic Correlations with Grain Matter Accumulation at Four Stages after Pollination in Maize [ J ]. Plant Biochem & Physiol,2014,2 (1): 1-9 ]) and qgwc1.1, qgwc1.2, and qGdr1.2 (Liu J, yu H, liu Y, deng S, liu Q, liu B, xu M.genetic dissection of grain water content and dehydration rate related to mechanical harvest in maize [ J ]. BMC Plant Biol,2020,20 (1): 118). Meanwhile, it has been studied that a gene ZmGAR2 (Li W, yu Y, wang L, luo Y, peng Y, xu Y, liu X, wu S, jian L, xu J, xiao Y, yan J.the genetic architecture of the dynamic changes in grain moisture in maize [ J ]. Plant Biotechnol J,2021,19 (6): 1195-1205) controlling corn moisture was cloned by association analysis. The cloning of different genes for controlling the character can provide more effective gene resources and molecular markers for molecular breeding, breeding and creating different fast dehydration corn materials.
Therefore, the invention utilizes the corn association population and linkage population, combines image cloning and positioning to a new gene ZmEIN2-1 for controlling the corn kernel moisture content and dehydration rate character through association analysis, identifies a molecular marker linked with the gene ZmEIN2-1, and can screen the corn kernel moisture content or dehydration rate character by utilizing the gene and the marker, and cultivate corn varieties with low moisture content and rapid dehydration.
Disclosure of Invention
It is an object of the present invention to provide a nucleic acid sequence of gene ZmEIN2-1 affecting moisture content property of corn kernel and its coded amino acid sequence.
The second purpose of the invention is to provide 2 molecular markers closely linked with the moisture content character of corn kernels: inDel_7/0 and InDel_303/000.
The invention further aims at disclosing a method for identifying and screening the moisture content or dehydration rate characteristics of corn kernels by using molecular markers.
The fourth object of the invention is to disclose a method for improving the moisture content or dehydration rate characteristics of corn kernels.
In order to achieve the above purpose, the invention adopts the following technical scheme:
the invention provides an application of protein in controlling the water content or dehydration rate of corn kernels, which is characterized in that: the amino acid sequence of the protein is shown as any one of SEQ ID NO.1, SEQ ID NO.17 or SEQ ID NO. 18.
The invention also provides an application of the nucleic acid in controlling the moisture content or dehydration rate of corn kernels, which is characterized in that the nucleic acid codes the protein.
In some embodiments, the nucleotide sequence or reverse complement of the nucleic acid is as set forth in any one of SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15, or SEQ ID NO. 16.
The invention also provides a molecular marker, which is characterized in that the marker is formed by inserting 7 bases AGTATT at 1044-1045 positions of a sequence shown in SEQ ID NO. 2; or 303 bases at positions 2506 to 2808 of the sequence shown in SEQ ID NO.2
CTTGATCACCAATTCGCGAAAGGGCCTCTAGCTGAGTTGGTTAGGTGGTCT
GAATAGCACTCCTCAGGTCCTGGGTTCGACTCCCCGTGGGAGCGAATTTCA
GGCTGTGGTTAAAAAAATCCCCTCGTCTGTCCCACGCCAAAGCACAGGTCT
AAGACTCAGCCCGGTCGTGGTCGTTCTCACATGGGCTTCGATGCCGCTGTG
TATGGGTGGGGTAGGGGTTCGGGGGTTTTCTTGACCTGTGTGAGAAGGTATTTTTCTTAATACAATACCCGGGGCTGTCTTACCCCCCGCAGGTCAAGT。
The invention also provides a method for identifying or assisting in identifying the moisture content or dehydration rate characteristics of corn kernels, which is characterized by comprising the following steps: (1) detecting the molecular marker in the material to be detected; (2) If the detection result is that the mark is contained, the material to be detected shows the characteristics of high grain water content or slow dehydration rate; if the detection result is that the mark is not contained, the material to be detected shows the characteristics of low water content of the grains or high dehydration rate.
In some embodiments, the detection methods of molecular markers described above employ PCR amplification.
In some embodiments, the primer pair used for the above PCR amplification consists of SEQ ID NO.5/SEQ ID NO.6 or SEQ ID NO.9/SEQ ID NO. 10.
In some embodiments, the expression of the above-described markers comprising PCR amplification products is shown as SEQ ID No.7 or SEQ ID No. 11; the PCR amplification products without the above markers are shown as SEQ ID NO.8 or SEQ ID NO. 12.
The invention also provides a method for screening corn materials with low grain water content or rapid dehydration rate, which is characterized in that the molecular markers in the materials to be tested are detected according to the method, and materials which do not contain the molecular markers are screened.
The invention also provides a method for reducing the moisture content of corn kernels or increasing the dehydration rate, which is characterized in that the expression and/or activity of the protein is increased in the corn material to be improved, and plants with low moisture content or high dehydration rate of the corn kernels are selected.
In some embodiments, the method of increasing protein expression is to use a highly active promoter to drive expression of a nucleic acid sequence encoding a protein.
In some embodiments, the high activity promoter is the maize ubiquitin promoter.
In some embodiments, the maize ubiquitin promoter sequence is shown in SEQ ID No. 19.
The invention also provides application of the molecular marker and the method in improving the moisture content or dehydration rate property of corn kernels.
Compared with the prior art, the invention has the beneficial effects that: the ZmEIN2-1 gene and the protein coded by the gene have the function of regulating the moisture content or dehydration rate property of corn kernels, and the function of the gene is not reported in the prior published materials. The invention also provides functional molecular markers InDel_7/0 and InDel_303/000 closely linked with ZmEIN2-1 and a detection method of the markers, which can specifically identify genotypes with different grain water contents or dehydration rate expressions from corn populations, and assist in identifying and improving grain water content or dehydration rate characters of corn varieties, so that the corn varieties with low water content or rapid dehydration rate are obtained. The water content of corn kernels can be reduced and the dehydration rate can be improved by over-expressing ZmEIN2-1 genes.
Drawings
FIG. 1 Manhattan plot of corn kernel moisture content variation index (exemplified by AUDDC_4_1) genome-wide correlation analysis. The vertical axis represents p-value for each marker association analysis test, -log10; the horizontal axis represents the position of the chromosome. The arrow indicates the target SNP.
Fig. 2 is a QTL localization map of corn kernel moisture content variation indices (blup_auddc_4_3, 13hn_auddc_5_4 and 14sy_auddc_4_3, for example). The vertical axis represents LOD values for each marker association analysis test; the horizontal axis represents the position of the chromosome.
FIG. 3ZmEIN2-1 gene fine localization map.
FIG. 4 shows ZmEIN2-1 gene structure, molecular markers and target sites. Triangles represent the positions of 2 molecular markers and the TE insertion site of Mu mutant; arrows indicate target sites; ATG: a start codon; TAA: stop codon
FIG. 5InDel_7/0 molecular marker causes a structural change in protein
FIG. 6 nucleic acid sequences and encoded protein structures of the wild type ZmEIN2-1 gene and the edited gene. WT: wild type; KO: editing genes; underline identifies the target sequence; "-" indicates a base deletion.
FIG. 7 shows ZmEIN2-1 gene overexpression vector.
FIG. 8 shows the results of the gene expression levels of two transformation events over-expressing ZmEIN2-1 gene. WT: wild type; OE: overexpression of
Detailed Description
The following definitions and methods are provided to better define the present application and to guide those of ordinary skill in the art in the practice of the present application. Unless otherwise indicated, terms are to be construed according to conventional usage by those of ordinary skill in the relevant art. All patent documents, academic papers, industry standards, and other publications cited herein are incorporated by reference in their entirety.
As used herein, "maize" is any maize plant and includes all plant varieties that can be bred with maize, including whole plants, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, whole plant cells in plants or plant parts such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, stems, roots, root tips, anthers, and the like. Unless otherwise indicated, nucleic acids are written in the 5 'to 3' direction from left to right; the amino acid sequence is written in the amino to carboxyl direction from left to right. Amino acids may be represented herein by their commonly known three-letter symbols or by the single-letter symbols recommended by the IUPAC-IUB biochemical nomenclature committee. Likewise, nucleotides may be referred to by commonly accepted single letter codes. The numerical range includes the numbers defining the range. As used herein, "nucleic acid" includes reference to deoxyribonucleotide or ribonucleotide polymers in either single-or double-stranded form, and unless otherwise limited, includes known analogs (e.g., peptide nucleic acids) having the basic properties of natural nucleotides that hybridize to single-stranded nucleic acids in a manner similar to naturally occurring nucleotides. As used herein, the term "encode" or "encoded" when used in the context of a particular nucleic acid, means that the nucleic acid contains the necessary information to direct translation of the nucleotide sequence into a particular protein. The information encoding the protein is represented using codons. As used herein, reference to a "full-length sequence" of a particular polynucleotide or protein encoded thereby refers to an entire nucleic acid sequence or an entire amino acid sequence having a natural (non-synthetic) endogenous sequence. The full length polynucleotide encodes the full length, catalytically active form of the particular protein. The terms "polypeptide", "polypeptide" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The term is used for amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acid. The term is also used for naturally occurring amino acid polymers. The terms "residue" or "amino acid" are used interchangeably herein to refer to an amino acid that is incorporated into a protein, polypeptide, or peptide (collectively, "protein"). Amino acids may be naturally occurring amino acids, and unless otherwise limited, may include known analogs of natural amino acids, which analogs may function in a similar manner to naturally occurring amino acids.
The term "trait" refers to a physiological, morphological, biochemical or physical characteristic of a plant or a particular plant material or cell. In some cases, this property is visible to the human eye, such as seed or plant size, or can be measured by biochemical techniques, such as detecting the protein, starch or oil content of the seed or leaf, or by observing metabolic or physiological processes, for example by measuring tolerance to water deprivation or specific salt or sugar or nitrogen concentrations, or by observing the expression level of one or more genes, or by agronomic observations such as osmotic stress tolerance or yield.
"transgenic" refers to any cell, cell line, callus, tissue, plant part or plant whose genome has been altered by the presence of a heterologous nucleic acid, such as a recombinant DNA construct. The term "transgene" as used herein includes those initial transgenic events as well as those produced from the initial transgenic events by sexual hybridization or asexual reproduction, and does not encompass genomic (chromosomal or extrachromosomal) changes by conventional plant breeding methods or by naturally occurring events such as random fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition, or spontaneous mutation.
"plant" includes references to whole plants, plant organs, plant tissues, seeds and plant cells, and their progeny. Plant cells include, but are not limited to, cells from seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen, and microspores. "progeny" includes any subsequent generation of a plant.
In this application, the terms "comprises," "comprising," or variations thereof, are to be understood to encompass other elements, numbers, or steps in addition to those described. "subject plant" or "subject plant cell" refers to a plant or plant cell in which genetic engineering has been effected, or a progeny cell of a plant or cell so engineered, which progeny cell comprises the engineering. "control" or "control plant cell" provides a reference point for measuring phenotypic changes in a subject plant or plant cell.
Negative or control plants can include, for example: (a) Wild-type plants or cells, i.e., plants or cells having the same genotype as the genetically engineered starting material, which genetic engineering produces the subject plant or cell; (b) A plant or plant cell having the same genotype as the starting material but which has been transformed with an empty construct (i.e., with a construct that has no known effect on the trait of interest, such as a construct comprising a marker gene); (c) A plant or plant cell that is a non-transformed isolate of the subject plant or plant cell; (d) A plant or plant cell genetically identical to the test plant or plant cell but not exposed to conditions or stimuli that induce expression of the gene of interest; or (e) the subject plant or plant cell itself, under conditions in which the gene of interest is not expressed.
Those skilled in the art will readily recognize that advances in molecular biology, such as site-specific and random mutagenesis, polymerase chain reaction methods, and protein engineering techniques, provide a wide range of suitable tools and procedures for engineering or engineering amino acid sequences and potentially genetic sequences of proteins of agricultural interest.
In some embodiments, the nucleotide sequences of the present application may be altered to make conservative amino acid substitutions. The principles and examples of conservative amino acid substitutions are described further below. In certain embodiments, the nucleotide sequences of the present application can be subjected to substitutions in accordance with the disclosed monocot codon preferences that do not alter the amino acid sequence, e.g., codons encoding the same amino acid sequence can be replaced with monocot-preferred codons without altering the amino acid sequence encoded by the nucleotide sequence. In some embodiments, a portion of the nucleotide sequence herein is replaced with a different codon encoding the same amino acid sequence, such that the amino acid sequence encoded thereby is not changed while the nucleotide sequence is changed. Conservative variants include those sequences that encode the amino acid sequence of one of the proteins of an embodiment due to the degeneracy of the genetic code. In some embodiments, a portion of the nucleotide sequences herein are substituted according to monocot preference codons. Those skilled in the art will recognize that amino acid additions and/or substitutions are generally based on the relative similarity of amino acid side chain substituents, e.g., hydrophobicity, charge, size, etc., of the substituents. Exemplary amino acid substituents having various of the aforementioned contemplated properties are well known to those skilled in the art and include arginine and lysine; glutamic acid and aspartic acid; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine. Guidelines for suitable amino acid substitutions that do not affect the biological activity of the protein of interest can be found in the model of Dayhoff et al (1978) Atlas of Protein Sequence and Structure (protein sequence and structure atlas) (Natl. Biomed. Res. Foundation, washington, D.C.), incorporated herein by reference. Conservative substitutions, such as substitution of one amino acid for another with similar properties, may be made. Identification of sequence identity includes hybridization techniques. For example, all or part of a known nucleotide sequence is used as a probe for selective hybridization with other corresponding nucleotide sequences present in a cloned genomic DNA fragment or population of cDNA fragments (i.e., a genomic library or cDNA library) from a selected organism. The hybridization probes may be genomic DNA fragments, cDNA fragments, RNA fragments, or other oligonucleotides, and may be labeled with a detectable group such as 32P or other detectable marker. Thus, for example, hybridization probes can be prepared by labeling synthetic oligonucleotides based on the sequences of the embodiments. Methods for preparing hybridization probes and constructing cDNA and genomic libraries are generally known in the art. Hybridization of the sequences may be performed under stringent conditions. As used herein, the term "stringent conditions" or "stringent hybridization conditions" refers to conditions under which a probe will hybridize to its target sequence to a detectably greater extent (e.g., at least 2-fold, 5-fold, or 10-fold over background) relative to hybridization to other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. By controlling the hybridization stringency and/or controlling the washing conditions, target sequences 100% complementary to the probes can be identified (homologous probe method). Alternatively, stringent conditions can be adjusted to allow for some sequence mismatches in order to detect lower similarity (heterologous probe method). Typically, the probe is less than about 1000 or 500 nucleotides in length. Typically, stringent conditions are those in which the salt concentration is less than about 1.5M Na ion, typically about 0.01M to 1.0M Na ion concentration (or other salt) at a pH of 7.0 to 8.3, and the temperature conditions are: when used with short probes (e.g., 10 to 50 nucleotides), at least about 30 ℃; when used with long probes (e.g., greater than 50 nucleotides), at least about 60 ℃. Stringent conditions can also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization at 37 ℃ with 30% to 35% formamide buffer, 1M NaCl, 1% sds (sodium dodecyl sulfate), washing in 1 x to 2 x SSC (20 x SSC = 3.0M NaCl/0.3M trisodium citrate) at 50 ℃ to 55 ℃. Exemplary moderately stringent conditions include hybridization in 40% to 45% formamide, 1.0M NaCl, 1% SDS at 37℃and washing in 0.5 XSSC to 1 XSSC at 55℃to 60 ℃. Exemplary high stringency conditions include hybridization in 50% formamide, 1M NaCl, 1% sds at 37 ℃ and a final wash in 0.1 x SSC at 60 ℃ to 65 ℃ for at least about 20 minutes. Optionally, the wash buffer may comprise about 0.1% to about 1% sds. The duration of hybridization is typically less than about 24 hours, typically from about 4 hours to about 12 hours. Specificity generally depends on post-hybridization washing, the key factors being the ionic strength and temperature of the final wash solution. The Tm (thermodynamic melting point) of DNA-DNA hybrids can be approximated from the formula Meinkoth and Wahl (1984) Anal. Biochem. 138:267-284: tm=81.5 ℃ +16.6 (log) +0.41 (% GC) -0.61 (% formamide) -500/L; where M is the molar concentration of monovalent cations,% GC is the percentage of guanosine and cytosine nucleotides in the DNA,% formamide is the percentage of formamide in the hybridization solution, and L is the base pair length of the hybrid. Tm is the temperature (at a defined ionic strength and pH) at which 50% of the complementary target sequence hybridizes to a perfectly matched probe. Washing is typically performed at least until equilibrium is reached and a low hybridization background level is reached, such as 2 hours, 1 hour, or 30 minutes. Each 1% mismatch corresponds to a decrease in Tm of about 1 ℃; thus, tm, hybridization, and/or wash conditions can be adjusted to hybridize to sequences of desired identity. For example, if sequences with ≡90% identity are desired, the Tm can be reduced by 10 ℃. Typically, stringent conditions are selected to be about 5 ℃ lower than the Tm for the specific sequence and its complement at a defined ionic strength and pH. However, under very stringent conditions, hybridization and/or washing may be performed at 4℃below the Tm; hybridization and/or washing may be performed at 6 ℃ below the Tm under moderately stringent conditions; hybridization and/or washing can be performed at 11℃below the Tm under low stringency conditions.
In some embodiments, fragments of the nucleotide sequence and the amino acid sequence encoded thereby are also included. As used herein, the term "fragment" refers to a portion of the nucleotide sequence of a polynucleotide or a portion of the amino acid sequence of a polypeptide of an embodiment. Fragments of a nucleotide sequence may encode protein fragments that retain the biological activity of the native or corresponding full-length protein and thus have protein activity. Mutant proteins include biologically active fragments of a native protein that comprise consecutive amino acid residues that retain the biological activity of the native protein. Some embodiments also include a transformed plant cell or transgenic plant comprising the nucleotide sequence of at least one embodiment. In some embodiments, the plant is transformed with an expression vector comprising the nucleotide sequence of at least one embodiment and operably linked thereto a promoter that drives expression in a plant cell. Transformed plant cells and transgenic plants refer to plant cells or plants comprising a heterologous polynucleotide within the genome. In general, the heterologous polynucleotide is stably integrated within the genome of the transformed plant cell or transgenic plant, such that the polynucleotide is delivered to the offspring. The heterologous polynucleotide may be integrated into the genome, either alone or as part of an expression vector. In some embodiments, the plants contemplated herein include plant cells, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps, and plant cells, which are whole plants or parts of plants, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, nuts, ears, cobs, hulls, stalks, roots, root tips, anthers, and the like. The present application also includes plant cells, protoplasts, tissues, calli, embryos and flowers, stems, fruits, leaves and roots derived from the transgenic plants of the present application or progeny thereof, and thus comprising at least in part the nucleotide sequences of the present application.
The term "amplification" in the context of nucleic acid amplification is any process in which additional copies of a selected nucleic acid (or transcribed form thereof) are produced. Typical amplification methods include replication methods based on a variety of polymerases, including Polymerase Chain Reaction (PCR), ligase mediated methods such as Ligase Chain Reaction (LCR), and RNA polymerase based amplification (e.g., by transcription) methods.
Alleles are "associated" with a trait when the allele is linked to the trait, and when the presence of the allele is an indication that the desired trait or trait form will occur in a plant comprising the allele.
The term "quantitative trait locus" or "QTL" as used herein refers to a polymorphic locus having at least one allele associated with differential expression of a phenotypic trait in at least one genetic background (e.g., in at least one breeding population or progeny). QTL can function by a single gene mechanism or by a multiple gene mechanism.
The term "QTL localization" as used herein refers to the localization of QTL on a genetic map using a method similar to single gene localization, determining the distance (expressed as recombination rate) between QTL and genetic markers. Depending on the number of labels, there are several methods of single-label, double-label and multi-label. According to the difference of statistical analysis methods, the methods can be classified into variance and mean analysis, regression and correlation analysis, moment estimation, maximum likelihood method, and the like. The number of marked intervals can be classified into zero interval mapping, single interval mapping and multi-interval mapping. In addition, there are comprehensive analysis methods combining different methods, such as QTL Complex Interval Mapping (CIM) multiregion mapping (MIM), multi-QTL mapping, multi-trait mapping (MTM), and the like.
The term "molecular marker" as used herein refers to a specific DNA fragment that reflects a certain difference in the genome of an individual or population of an organism.
The term "major gene" as used herein refers to a gene that determines a trait from a single gene, referred to as a major gene, and the term "minor gene" as used herein refers to the effect of each of several non-alleles only in part on the phenotype of the same trait, such several genes being referred to as additive genes or polygenes. Each gene has only a small portion of the phenotypic effects in the accumulated genes, and is therefore also referred to as a "minigene".
The term "inbred line" used herein refers to a line which is obtained by continuously eliminating bad spike lines for a plurality of generations under the condition of manually controlling self-pollination, and selecting an individual plant with better agronomic characteristics for selfing, thereby obtaining the line with tidier and consistent agronomic characteristics and simpler genetic basis.
The term "backcrossing" as used herein refers to a method of crossing a sub-generation with either of two parents.
The term "crossing" or "crossed" as used herein refers to gamete fusion (e.g., cell, seed, or plant) that produces progeny via pollination. The term includes sexual crosses (pollination of one plant by another) and selfing (self-pollination, e.g., when pollen and ovules are from the same plant). The term "crossing" refers to gamete fusion behavior that produces progeny via pollination.
The term "backcrossing" as used herein refers to a process in which progeny of a cross repeatedly backcross with one of the parents. In one backcrossing scheme, the "donor" parent refers to a parent plant having the desired gene or locus to be introgressed. The "recipient" parent (used one or more times) or the "recurrent" parent (used two or more times) refers to the parent plant into which the gene or locus is introgressed. Initial hybridization to produce F 1 Substitution; then, the term "BC 1 "second use of the thumbwheel parent," BC 2 "third use of the thumbwheel parent, etc.
The term "closely linked" as used herein refers to recombination between two linked loci occurring at a frequency of equal to or less than about 10% (i.e., no more than 10cM in frequency of separation on a genetic map). In other words, closely linked loci co-segregate at least 90% of the time. Marker loci are particularly useful in the present invention when they exhibit a significant probability of co-segregation (linkage) with a desired trait (e.g., pathogen resistance). Closely linked loci, such as marker loci, and second loci, can exhibit an intra-locus recombination frequency of 10% or less, preferably about 9% or less, more preferably about 8% or less, more preferably about 7% or less, more preferably about 6% or less, more preferably about 5% or less, more preferably about 4% or less, more preferably about 3% or less, more preferably about 2% or less. In highly preferred embodiments, the cognate loci exhibit a recombination frequency of about 1% or less, such as about 0.75% or less, more preferably about 0.5% or less, and more preferably about 0.25% or less. Two loci that are located on the same chromosome and that are separated by a distance such that recombination between the two loci occurs less than 10% (e.g., about 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.75%, 0.5%, 0.25%, or less) frequently are also referred to as being "close" to each other. In some cases, two different markers can have the same genetic map coordinates. In that case, the two markers are sufficiently close to each other that recombination between them occurs at a low frequency that is undetectable.
Centimorgan ("cM") is a measure of recombination frequency. 1cM is equal to 1% of the probability that a marker at one locus will be separated from a marker at a second locus by a single generation of hybridization.
An "advantageous allele" is an allele at a particular locus that confers or contributes to an agronomically desirable phenotype, such as increased moisture content of a long kernel of corn, and allows for the identification of plants having an agronomically desirable phenotype. A "favorable" allele of a marker is a marker allele that is cosegregated with a favorable phenotype.
"Gene maps" are descriptions of gene linkage relationships between loci on one or more chromosomes in a given species, typically depicted in a graphical or tabular format. For each genetic map, the distance between loci is measured by the frequency of recombination between them, and recombination between loci can be detected using a variety of markers. Genetic maps are the products of the polymorphism potential of individual markers between different populations, the population mapped, the type of marker used. The order and genetic distance between loci may differ from one genetic map to another. However, a generic box using common labels can correlate one atlas with information of another atlas. One of ordinary skill in the art can use a framework of common markers to identify the location of the markers and loci of interest on each individual genetic map.
"genetic map location" is the location on a genetic map relative to surrounding genetic markers on the same linkage group, where a given marker can be found in a given population.
"Gene mapping" is a method of defining linkage relationships of loci by using standard genetic principles of genetic markers, population segregation of markers, and recombination frequency.
"genetic recombination frequency" is the frequency of crossover events (recombination) between two loci. Recombination frequencies can be observed after isolation of markers and/or post-meiotic traits.
The term "genotype" is the genetic composition of an individual (or group of individuals) at one or more loci, which is in contrast to an observable trait (phenotype). The genotype is defined by the alleles of one or more known loci that an individual has inherited from its parent. The term genotype may be used to refer to the genetic composition of an individual at a single locus, the genetic composition at multiple loci, or more generally, the term genotype may be used to refer to the genetic composition of an individual for all genes in its genome.
"germplasm" refers to an individual (e.g., a plant), a group of individuals (e.g., a plant line, variety, or family), or genetic material cloned or derived from a line, variety, species, or culture. The germplasm may be part of the organism or cell, or may be isolated from the organism or cell. Germplasm typically provides genetic material with specific molecular constituents that provide the physical basis for some or all of the genetic traits of an organism or cell culture. As used herein, germplasm includes cells, seeds, or tissues from which new plants can be grown, or plant parts such as leaves, stems, pollen, or cells, which can be cultured into whole plants.
A "tag" is a nucleotide sequence or encoded product (e.g., a protein) thereof that serves as a reference point. For markers to detect recombination, they need to detect differences or polymorphisms within the monitored population. For molecular markers, this means that the difference at the DNA level is due to polynucleotide sequence differences (e.g., SSR, RFLP, FLP and SNPs). Genomic variability can be of any origin, for example, insertions, deletions, replications, repetitive elements, point mutations, recombination events or the presence and sequence of transposable elements. The molecular markers may be derived from genomic or expressed nucleic acids (e.g., ESTs), and may also refer to nucleic acids that serve as probes or primer pairs that are capable of amplifying sequence fragments using a PCR-based method.
Markers corresponding to genetic polymorphisms between population members can be detected by methods established in the art. Such methods include, for example, DNA sequencing, PCR-based sequence-specific amplification methods, restriction fragment length polymorphism detection (RFLP), isozymal marker detection, polynucleotide polymorphism detection by allele-specific hybridization (ASH), amplified variable sequence detection of plant genomes, autonomous sequence replication detection, simple repeat sequence detection (SSR), single nucleotide polymorphism detection (SNP), or amplified fragment length polymorphism detection (AFLP). Established methods are also known for detecting Expressed Sequence Tags (ESTs) and SSR markers derived from EST sequences, as well as Randomly Amplified Polymorphic DNA (RAPD).
"marker allele" or "allele of a marker locus" may refer to one of a plurality of polymorphic nucleotide sequences at the marker locus in a population, which is polymorphic with respect to the marker locus.
A "marker probe" is a nucleic acid sequence or molecule that can be used to identify the presence or absence of a marker locus by nucleic acid hybridization, e.g., a nucleic acid molecular probe that is complementary to the marker locus sequence. A label probe comprising 30 or more contiguous nucleotides of a marker locus (a "full or partial" marker locus sequence) can be used for nucleic acid hybridization. Alternatively, in certain aspects a molecular probe refers to any type of probe that is capable of distinguishing (i.e., genotyping) a particular allele present at a marker locus.
As described above, the term "molecular marker" may be used to refer to a genetic marker, or a coded product (e.g., a protein) thereof that serves as a reference point when identifying linked loci. The tag can be derived from genomic nucleotide sequences or from expressed nucleotide sequences (e.g., from spliced RNA, cDNA, etc.), or from the encoded polypeptide. The term also refers to a nucleic acid sequence that is complementary to or flanked by marker sequences, such as a nucleic acid that serves as a probe or primer pair capable of amplifying the marker sequences. A "molecular marker probe" is a nucleic acid sequence or molecule that can be used to identify the presence or absence of a marker locus, e.g., a nucleic acid probe that is complementary to a marker locus sequence. Alternatively, in certain aspects a molecular probe refers to any type of probe that is capable of distinguishing (i.e., genotyping) a particular allele present at a marker locus. A nucleic acid is "complementary" when it hybridizes specifically in solution, e.g., according to Watson-Crick base pairing rules. When located in an indel region, such as a non-collinear region as described herein, some of the markers described herein are also referred to as hybridization markers. This is because the region of insertion is a polymorphism with respect to plants without insertion. Thus, the tag need only indicate whether an indel region is present. Any suitable label detection technique may be used to identify such hybridization labels, e.g., KASP techniques, PCR amplification.
The invention locates a gene ZmEIN2-1 affecting corn kernel moisture content and dehydration rate character from a corn association population, the gene is located at the position of B73V 5 version reference genome chromosome1:270891072-270897163, and the genome sequence is shown in SEQ ID NO. 2. By determining transcripts of ZmEIN2-1 genes, nucleotide sequences of coding regions of the genes and encoded protein sequences were determined.
The invention further analyzes the variation sites in the corn materials expressed by different grain water contents, finds 2 variation sites (InDel_7/0 and InDel_303/000) linked with the characters, wherein InDel_7/0 is positioned at the position 1045-1051 of the sequence shown in SEQ ID NO.2 and is expressed as insertion of 7 bases (AGTACT);
InDel_303/000 is located at position 2513-2815 of the sequence shown in SEQ ID NO.2, representing an InDel of 303 bases.
Based on InDel_7/0 and InDel_303/000 sites, the invention develops a molecular marker detection method, which can identify InDel_7/0 and InDel_303/000 genotypes and identify or assist in identifying corn grain moisture content or dehydration rate characteristics according to genotype identification results.
The invention provides a method embodiment for driving ZmEIN2-1 gene to be overexpressed by utilizing a corn ubiquitin promoter, reducing corn kernel water content or improving dehydration rate.
The following examples are illustrative of the invention and are not intended to limit the scope of the invention. Modifications and substitutions to methods, procedures, or conditions of the present invention without departing from the spirit and nature of the invention are intended to be within the scope of the present application. Examples follow conventional experimental conditions, such as the molecular cloning laboratory manual of Sambrook et al (Sambrook J & Russell D W, molecular cloning: a laboratory manual, 2001), or conditions recommended by the manufacturer's instructions, unless otherwise indicated. Unless otherwise indicated, all chemical reagents used in the examples were conventional commercial reagents, and the technical means used in the examples were conventional means well known to those skilled in the art.
EXAMPLE 1 cloning of corn kernel moisture Gene
The invention utilizes a laboratory-constructed association population (the construction method of the association population is referred to as Yang X, gao S, xu S, zhang Z, prasanna B.M., li L, li J, yan J. Charabacteria of a global germplasm collection and its potential utilization for analysis of complex quantitative traits in maize [ J)]Molecular Breeding,2011,28 (4): 511-526.). By measuring the grain moisture content of 5 environments, the phenotype value of the corn grain moisture content (GM) of 5 stages was obtained: 34 days, 40 days, 46 days, 52 days, 58 days after pollination, respectively, designated 34DAP,40DAP,45DAP,52DAP,58DAP. The optimum unordered estimation method (BLUP) is simultaneously applied to calculate BLUP phenotype values of 5 environments, and the grain moisture content change index (AUDDC) is calculated through the phenotype values, and the estimation method is referred to as Yang J Carena M and Uphaus J area under the dry down curve (AUDDC): a method to evaluate rate of dry down in maize [ J ] ]Crop sci, 2010,50 (6): 2347-2354.), denoted auddc_2_1, auddc_3_2, auddc_4_3, auddc_5_4, auddc_3_1, auddc_4_2, auddc_5_3, auddc_4_1, auddc_5_2, auddc_5_1 (where the numbers represent the grain moisture content of the 5 stages, for example: auddc_2_1 is the AUDDC value between the second kernel moisture content (40 DAP) and the first kernel moisture content (34 DAP). Genotype data derived from association of 1.25M SNP markers in a population and population structure and kindred relationship deduced from the genotype (genotype data from Liu H, luo X, niu L, xiao Y, chen L, liu J, wang X, jin M, li W, zhang) Q,Yan J.Distant eQTLs and Non-coding Sequences Play Critical Roles in Regulating Gene Expression and Quantitative Trait Variation in Maize[J]Mol Plant,2017,10 (3): 414-426), whole genome correlation analysis was performed on the 15 personalities using a mixed linear model, with a threshold of P.ltoreq.2.0X10 -6 The SNP sites chr1.S_264272396 and BLUP_GM (BLUP_34_DAP, BLUP_46_DAP), BLUP_AUDDC (BLUP_AUDDC_4_1, BLUP_AUDDC_3_1, BLUP_AUDDC_5_1, BLUP_AUDDC_4_2, BLUP_AUDDC_2_1, BLUP_AUDDC_4_3, BLUP_AUDDC_3_2, BLUP_AUDDC_5_2) were identified,
the properties of 14jl_gm (14jl_40_dap, 14jl_46_dap) and 14jl_blup (14JL_AUDDC_3_1, 14JL_AUDDC_2_1, 14JL_AUDDC_3_2, 14JL_AUDDC_4_1, 14JL_AUDDC_4_2, 14JL_AUDDC_5_1) are significantly associated (table 1; fig. 1). Meanwhile, a RIL group constructed by K22X Dan340 is utilized, a phenotype data collection method is associated with an analysis experimental part, then a QTL locus is positioned by utilizing a high-density genetic linkage map (Pan Q, li L, yang X, tong H, xu S, li Z, li W, muehlbauer GJ, li J, yan J. Genome-wide recombination dynamics are associated with phenotypic variation in maize [ J ]. New Phytol,2016,210 (3): 1083-1094), a QTL locus is positioned at a major QTL of chromosome 1.09, the locus of the locus positioned to the QTL mainly comprises a 13HN_GM (13HN_52DAP, 13HN_58DAP), 13HN_AUDDC (13HN_AUDDC_5_3, 13HN_AUDDC_5_4), 14JGM (14JSY_46_46_DAP), SY_AUDDC (14SY_AUDDC_3_1, 14SY_AUDDC_3_2, 14SY_AUDDC_4_1, 14SY_AUDDC_4_2, 14SY_AUDDC_4_3, 14SY_AUDDC_5_1, 14SY_AUDDC_5_2, 14SY_AUDDC_5_3, 14SY_AUDDC_5_4), WH_AUDDC (14WH_AUDDC_5_2, 14SY_AUDDC_3_1) and UP_AUDDC (UP_AUDDC_4) (Table 2; FIG. 2) which are associated with the SNP of the same type as that of the BL1-2. Through map-based cloning, the QTL interval is reduced to 60kb, two genes are arranged in the interval (figure 3), and the gene in which the SNP with the most obvious correlation analysis is positioned is taken as a candidate gene and is named ZmEIN2-1.
TABLE 1 significant SNP (Chr1. S_ 264272396) and trait association analysis results
TABLE 2QTL (qDR 1-1) basic information
Example 2 analysis of Gene Structure and functional site
The ZmEIN2-1 gene is numbered Zm00001eb054060 in B73 reference genome, and the gene is positioned in Chr1:270891072-270897163 and is 6092bp. The sequence is shown as SEQ ID NO. 2. The function of this gene was annotated as ethylene insensitive and has not been studied to indicate that this function is related to the rate of dehydration of maize. The ZmEIN2-1 gene has 3 transcripts, and the sequences are shown as SEQ ID NO.3 (transcript T1), SEQ ID NO.13 (transcript T2) and SEQ ID NO.15 (transcript T3). Wherein, transcript 1 contains 8 exons, 6 of which are coding exons (the structure is shown in figure 4), the coding region sequence is shown in SEQ ID NO.4, and the coded amino acid sequence is shown in SEQ ID NO. 1.
By sequencing and PCR identification of the whole gene region of the different sex-exhibiting materials in the related population, the gene is found to have 2 mutation sites. The first mutation site is located at the position of the colorime 1:270892115-270892116 (SEQ ID NO.2, sequences 1044-1045), and there is a 7bp indel on exon 1: AGTATCT (positions shown in fig. 4). Insertion of 7 bases into this position results in premature termination of gene transcription, which is significantly related to the moisture content trait. Thus, the variation can be developed as a molecular marker InDel_7/0 to assist in identifying corn kernel moisture content and dehydration rate. Corn kernels containing the 7-base genotype InDel_7 have higher moisture content and slower dehydration; corn kernels of genotype indel_0, which do not contain 7 bases, are lower in moisture and dehydrate faster.
The second mutation site is located at the position of chromosome1:270893584-270893886 (sequence 2506-2808 shown in SEQ ID NO. 2), and is a 303bp indel on the intron between the 4 th and 5 th exons:
CTTGATCACCAATTCGCGAAAGGGCCTCTAGCTGAGTTGGTTAGGTGGTCT
GAATAGCACTCCTCAGGTCCTGGGTTCGACTCCCCGTGGGAGCGAATTTCA
GGCTGTGGTTAAAAAAATCCCCTCGTCTGTCCCACGCCAAAGCACAGGTCT
AAGACTCAGCCCGGTCGTGGTCGTTCTCACATGGGCTTCGATGCCGCTGTG
TATGGGTGGGGTAGGGGTTCGGGGGTTTTCTTGACCTGTGTGAGAAGGTATTTTTCTTAATACAATACCCGGGGCTGTCTTACCCCCCGCAGGTCAAGT (position shown in fig. 4). This marker was found to be significantly associated with the phenotype BLUP_AUDDC_4_1 by T-test analysis (Table 3). Thus, the variation can be developed as a molecular marker InDel_303/000 to aid in the identification of corn kernel moisture content and dehydration rate. Corn kernels with genotype InDel 303 of 303 bases have higher moisture content and slower dehydration; corn kernels of genotype indel_000, which do not contain 303 bases, are lower in moisture and dehydrate faster.
TABLE 3 molecular marker InDel_303/000 affects corn kernel moisture and its variation (BLUP_AUDDC_4_1)
The higher the AUDDC_4_1 value, the higher the kernel moisture content, and the lower the dewatering rate.
Example 3 corn kernel moisture content related molecular marker detection method
Based on genomic sequences near the InDel_7/0 and InDel_303/000 positions, PCR methods can be used to identify the molecular markers. The primer pair used for PCR identification at the InDel_7/0 position is shown as SEQ ID NO.5 and SEQ ID NO. 6. The primer pairs used for PCR identification at the InDel_303/000 position are shown in SEQ ID NO.9 and SEQ ID NO. 10.
The molecular marker detection adopts the following method:
(1) Extraction of corn genome DNA:
1. about 1.5g of corn leaf is ground in liquid nitrogen and transferred into a 2mL centrifuge tube.
2. 750 μl of CTAB extraction buffer preheated to 65deg.C was added and mixed rapidly. The centrifuge tube is gently shaken for 2 to 3 times in the middle of water bath for about 30 minutes in a water bath kettle at the temperature of 65 ℃.
3. The tube was removed and an equal volume of chloroform was added: isoamyl alcohol (24:1), the tube was shaken on a shaker for 10 minutes until the solution was layered, the lower layer being greenish black and the upper layer being pale yellow.
4. Centrifuge at 12000rpm for 10 minutes at room temperature and transfer the supernatant to a 1.5mL centrifuge tube.
5. Add 2/3 of the pre-chilled isopropyl alcohol to the supernatant and mix carefully. Placed in a-20 degree freezer for 30 minutes.
6. Then centrifuged at 12000rpm at 4℃for 10 minutes.
7. The supernatant was decanted, and 1mL of 75% ethanol was added thereto and the mixture was immersed for 5 minutes. The wash was repeated one more time. Then, the liquid was poured off, the centrifugal tube was left for 30min, and the mixture was dried at room temperature, and 200. Mu.l of water was added to dissolve DNA.
8. The DNA mass was detected with 1% agarose and the DNA concentration was determined. The DNA was placed in a-20℃refrigerator for further use.
(2) The PCR system and the procedure are:
PCR system:
PCR procedure:
(3) Gel imaging
Detection on a 1% agarose gel.
The primer pair used for PCR at the InDel_7/0 position is shown as SEQ ID NO.5 and SEQ ID NO. 6. The material with the genotype InDel_7 is amplified into a band of 84bp (the sequence is shown as SEQ ID NO. 7), and the material is characterized by high grain water content and slow dehydration rate; the material with genotype InDel_0 is amplified into a 77bp band (the sequence is shown as SEQ ID NO. 8), and the material is characterized by low grain water content and high dehydration rate.
The primer pair used at position InDel_303/000 is shown in SEQ ID NO.9 and SEQ ID NO. 10. The material with the genotype InDel_303 is amplified into 935bp bands (the sequence is shown as SEQ ID NO. 11), and the material is characterized by high grain water content and slow dehydration rate; the material with genotype InDel_000 amplified a 632bp band (sequence shown as SEQ ID NO. 12) and showed low kernel moisture content and fast dehydration rate.
The detection of multiple inbred materials using the methods described above showed that the detection of the marker is able to distinguish well between different materials the grain moisture content or dehydration rate profile.
Example 4 inactivation of ZmEIN2-1 protein, modification of corn kernel moisture content and dehydration Rate
The ZmEIN2-1 gene has the function of controlling the moisture content and the dehydration rate of corn kernels, and in order to further verify the regulation mode of the gene on the moisture content and the dehydration rate of the kernels, the gene is knocked out by using a CRISPR-Cas9 gene editing technology. The gene encodes a protein containing an Nramp-like domain (FIG. 6) by protein structure prediction. For genomic sequences, two targets, GTAATGTTCCCCAAGTTGAG and GCAGGTTCAGAGAAGATTTC (target positions see fig. 4), were designed at the 5 th and 6 th exons, respectively, sgrnas (sgrna_1 and sgrna_2) were synthesized, and gene editing vectors were constructed. The corn variety KN5585 is transformed by the vector, and finally, a transformant with successfully edited genes is obtained, 714 bases are lost by the transformant, 76 bases are inserted into the transformant, gene translation is terminated in advance, the protein domain is lost, and the edited protein structure is shown in figure 6. The genetic editing material investigated the property data such as AUDDC and water content change in the three-and Jilin princess mountains in Hainan province, and confirmed that the water content of corn kernels was increased and the dehydration rate was slowed down after the genetic editing (tables 4 and 5).
TABLE 4ZmEIN2-1 Gene editing affects corn kernel moisture changes
WT: wild type; KO: gene editing
TABLE 5ZmEIN2-1 Gene editing effects on corn kernel moisture content
WT: wild type; KO: gene editing
In addition, a mutant of the insert transposon in the 5' UTR region of the EIN2-1 gene was obtained from the selection of the maize mutant pool (FIG. 4). The mutant and wild type materials were found to have phenotypically different, the water content of the mutant seeds became higher and the dehydration was slowed down (tables 6 and 7).
TABLE 6 influence of ZmEIN2-1 Gene mutants on corn kernel moisture variation
WT: wild type; MU: mutant
TABLE 7 influence of ZmEIN2-1 Gene mutants on corn kernel moisture content
WT: wild type; MU: mutant
Example 5 overexpression of EIN2-1 Gene to reduce corn kernel moisture content and increase dehydration Rate
After the EIN2-1 gene is knocked out, the water content of corn kernels is increased, and dehydration is slowed down. Thus, to reduce the moisture content of corn kernels, increasing the dehydration rate of corn kernels can be achieved by over-expressing the gene.
Overexpression can be achieved by selecting a strong promoter (such as ubiquitin, actin, 35S, etc.) to drive the expression of the EIN2-1 gene (genomic sequence shown as SEQ ID NO.2, cDNA sequence shown as SEQ ID NO.3, SEQ ID NO.13, or SEQ ID NO.15, or coding region sequence shown as SEQ ID NO.4, or SEQ ID NO.14, or SEQ ID NO. 16). In this example, a maize strong promoter ubiquitin (SEQ ID NO. 19) was selected to drive expression of a genomic sequence containing the coding region (specifically, the sequence at positions 210-4530 of SEQ ID NO. 2), and an overexpression vector was constructed (vector diagram is shown in FIG. 7). The maize inbred line KN5585 is transformed by the overexpression vector, the obtained transformed seedlings are detected, and transformation events ZMEIN2-1#OE1 and ZMEIN2-1#OE2 with stable overexpression of two target genes are identified, and the gene expression quantity results are shown in figure 8. After investigation of the moisture content and dehydration rate of the kernels, it was found that the moisture content of the kernels of the overexpressing maize plants was reduced and the dehydration rate was faster (tables 8 and 9).
Table 8ZmEIN2-1 Gene overexpression affects corn kernel moisture variation
OE1: overexpressing material 1; WT1: wild type control 1; OE2: overexpressing material 2; WT2: wild type control 2.
Table 9ZmEIN2-1 Gene overexpression affecting corn kernel moisture content
OE1: overexpression 1; WT1: wild type control 1; OE2: overexpressing material 2; WT2: wild type control 2; na: and not detected.
While the invention has been described in detail in the foregoing general description and with reference to specific embodiments thereof, it will be apparent to one skilled in the art that modifications and improvements can be made thereto. Accordingly, such modifications or improvements may be made without departing from the spirit of the invention and are intended to be within the scope of the invention as claimed.
Sequence listing
<110> university of agriculture in China
<120> a corn kernel moisture content controlling Gene ZmEIN2-1 and molecular markers thereof
<130> 1
<160> 19
<170> SIPOSequenceListing 1.0
<210> 1
<211> 476
<212> PRT
<213> Zea mays
<400> 1
Met Asp Gly Val Arg Cys Met Glu Ser Pro Ala Ala Gly Asp Ala Pro
1 5 10 15
His Ser Ser Phe Arg Thr Leu Gly Pro Thr Leu Leu Val Ser Met Gly
20 25 30
Tyr Leu Asp Phe Gly Lys Trp Leu Val Ala Val Glu Ala Gly Ser Arg
35 40 45
Phe Gly Tyr Asp Leu Val Leu Leu Val Leu Leu Phe Asn Leu Ser Ala
50 55 60
Ile Leu Cys Gln Tyr Leu Ser Ser Cys Ile Gly Ile Val Thr Lys Lys
65 70 75 80
Asn Leu Ala Glu Ile Cys His Gln Glu Tyr Asp Gln Lys Ile Cys Val
85 90 95
Val Leu Gly Leu Gln Ala Gly Leu Ser Leu Leu Thr Ser Glu Phe Thr
100 105 110
Met Ile Ala Gly Ile Val Val Gly Phe Asn Leu Val Phe Glu Ser Asn
115 120 125
Asn Pro Ile Thr Val Val Cys Phe Thr Ser Val Val Val Asn Leu Leu
130 135 140
Pro Tyr Thr Leu Ser Leu Leu Asp Lys Arg Lys Ala Gly Met Phe Asn
145 150 155 160
Ala Tyr Ala Ser Gly Phe Thr Leu Val Cys Phe Val Leu Gly Leu Leu
165 170 175
Val Ser His Pro Lys Thr Pro Val Asn Thr Asn Val Met Phe Pro Lys
180 185 190
Leu Ser Gly Glu Ser Ala Tyr Ser Leu Met Val Leu Leu Gly Thr Asn
195 200 205
Ile Ile Val His Asn Phe Tyr Thr His Ser Ser Val Val Gln Val Gln
210 215 220
Arg Arg Phe Gln Gly His Thr Leu Gly Thr Leu Phe His Asp His Leu
225 230 235 240
Phe Ser Val Leu Phe Ala Phe Ser Gly Ile Phe Leu Val Asn Tyr Ile
245 250 255
Leu Met Ser Ser Ala Val Asp Glu Ser Lys Asn Thr Met Ala Ile Asn
260 265 270
Phe Gln Asp Ala Arg Gln Leu Met Asn Gln Val Phe Thr Ser Pro Val
275 280 285
Ala Pro Ile Val Leu Leu Val Val Leu Leu Phe Ser Gly His Ile Val
290 295 300
Ser Met Thr Cys Ile Ile Gly Ser Asp Val Ile Ser Glu Asp Leu Phe
305 310 315 320
Gly Ile Lys Leu Pro Leu Phe Val His His Leu Leu Pro Lys Val Phe
325 330 335
Ala Met Ile Thr Thr Ile Tyr His Ala Lys Val Val Gly Phe Glu Gly
340 345 350
Leu Tyr Gln Leu Leu Met Val Cys Pro Ile Ile Gln Ala Met Leu Leu
355 360 365
Pro Ser Ser Val Ile Pro Val Phe Arg Ile Ser Ser Ser Arg Ser Leu
370 375 380
Met Gly Arg Tyr Arg Ile Ser Arg Cys Val Glu Ile Leu Cys Phe Leu
385 390 395 400
Ala Phe Leu Leu Thr Leu Phe Thr Asn Ile Ile Phe Val Ala Glu Val
405 410 415
Leu Phe Gly Asp Ser Thr Trp Thr Asn Asp Leu Lys Gly Asn Thr Glu
420 425 430
Asn Pro Ile Leu Leu Pro Tyr Ile Val Val Val Leu Ile Ser Cys Gly
435 440 445
Ser Ile Gly Phe Ala Leu Phe Leu Ala Val Thr Pro Leu Lys Ser Ala
450 455 460
Cys Asn Glu Ala Glu Arg Ala Leu Ser Val His Ser
465 470 475
<210> 2
<211> 6091
<212> DNA
<213> Zea mays
<400> 2
tagcttgtaa gtttgcatct gattgcacaa ccgttgttcc cgtgcgtggg ggactgcggc 60
tcgttcttgg atgaggttct gacttctgag gaggatgggg atggctcacg gcgccgtgac 120
gcgacgatcg gcgtcggcag cggcgcgtcc ctgctgtccc tcctgcatgc ttgccaccca 180
gcttcgcctc gccacgcgtc tcgtggacca ttgcgcgcgt ccctcgtgcc acggcgcacc 240
cgcagccatg agtgccagcg ctcccgtctc ccgactcccg agcaaatcgc tcggcgccta 300
ctactagccc gaaacctagg tggtgggaac tcgggatacg aggtcctctt ctccgccgct 360
tgtcctcggc aagcacaaac gcggtaagcc accaaccgcc tttcgatcgc cgggctccat 420
ccctaagcca tctcgccgcc tcgtgagtcg tgagccgtga gccaaccgac ctgccatcat 480
caattagtga cttcctgaac ctgcttcgtg cgtcctacca ctccaaagtt ccaacaatca 540
agagatttaa acaaagcctt ccataacttg ttgccaataa ggtaactgtc actattgtgc 600
tgctcatcct ttccatctaa gagaaaactt tactgtgtcc tgtgcatact cctctttcat 660
ccgtaactct ccgtaaccat ttgcgggaaa taatgtaaag ttcattctcg gcaaagtatt 720
gtggcgtgtg atggatagag cttaaatcag gagcgtcttc atattgttgt aattggctcg 780
ttgcagtgca ggatttggag gccactgggc tttggaaatt caaagtagac tgcttggatc 840
ataacgagag agcacaaagg gcctgggttt tgtaaacagt tggctttcac tagagtcgat 900
ccattccata ctgagctttt gcatatcatc aattcatcac acaatggatg gtgtgcgatg 960
catggagtcc ccagctgctg gtgatgcccc gcatagttct ttccgaaccc ttgggccaac 1020
actcctggtt tcaatggggt atcttgactt cggaaaatgg ttggtggcag tggaagctgg 1080
gtctcggttt ggctatgatc ttgtcctgct cgtgctgctt tttaatctat cagctattct 1140
gtgtcagtac ctctcgagct gtatcggcat tgtcaccaaa aagaatcttg cggaggtaaa 1200
aatttactca gtcctctctt gccattgtaa actgtagaat tttcaccaga actacggtgt 1260
ggagatctca gttgataaga atggtgattc attaggatag ggtgggccca ccataaattt 1320
ctgtacccgt aatattggtg ttaatttgtt ttgcgtttat gagagatgtc tggggaaaaa 1380
aagctcatgg agtcatggca tcctaactcc taagcgttgt agctatgctg tcgtacttct 1440
gttgaaaaaa tgccatcatc gttcaaatga aaacatcaga tatccacatg tgacaacaat 1500
agaagtatcc cttttatttt acattttctt catctatttt caacagtgtc ttgtgcagat 1560
cttgacttct ttcttgttat atttgtacat gaacaaatag atttgccacc aggagtatga 1620
tcagaaaata tgtgttgttc ttggtcttca agcaggactg tccttgctaa cttctgaatt 1680
taccatggta tgtctacaaa tacttcagaa aatccatttt ctgatgatgg ttgatcttgg 1740
acttttatgt gctcatgata catttgcttg caccattcct aattaacaga gcatgtaagc 1800
agctcggtac atttgaaaca cttagggctg gtttggtgac agtcacctaa ccagcactta 1860
acattttcaa gagaaaaaca cttaacatat gatacttttc agattgcagg catcgtagtt 1920
gggttcaacc ttgtatttga aagcaacaat cccatcacag tcgtatgttt tacaagtgtt 1980
gtagttaatc tgctaccata tacactctcc cttctggtaa atttataagt ctctccaaag 2040
aactgtatat aaaagctgac ttgctctaaa acattttata atttattcta gttcctatat 2100
ttgtgctgat tgtaggacaa gaggaaggct ggaatgttta atgcctacgc atctggcttt 2160
acactagttt gttttgtgct tggtttatta gtgagccatc ccaaaacccc tgtcaatacc 2220
aacgtaatgt tccccaagtt gagtggtgaa agtgcttact cactgatggt actacttggc 2280
acaaatataa tagtacacaa cttttatact cattcatcag ttgttcaggt aaatttctga 2340
caattccatt cccatgttta tgcaattagc tttgtcaagc atgtcttcca ttaaaagttt 2400
gtcttatcaa acctgaatgc atctttcatg gcgaaagtga tgttttgtgt taggattatg 2460
tacaaaaaaa tggtttatgt tagggtactg agtgtattgg ttgttcttga tcaccaattc 2520
gcgaaagggc ctctagctga gttggttagg tggtctgaat agcactcctc aggtcctggg 2580
ttcgactccc cgtgggagcg aatttcaggc tgtggttaaa aaaatcccct cgtctgtccc 2640
acgccaaagc acaggtctaa gactcagccc ggtcgtggtc gttctcacat gggcttcgat 2700
gccgctgtgt atgggtgggg taggggttcg ggggttttct tgacctgtgt gagaaggtat 2760
ttttcttaat acaatacccg gggctgtctt accccccgca ggtcaagttt tgatcaccaa 2820
ttcaccatag gggtgctgaa tgcactgagt tgttcttgat tcattctttg ctagtttggt 2880
ctgctttggc ttcatgtatc agtgttcatt cagatatatt atcacttgtg caggttcaga 2940
gaagatttca gggtcatacc cttggtactc tgtttcatga tcaccttttt tctgtactat 3000
ttgcattttc tggtatcttt cttgtgaatt atattctgat gagttcagca gttgatgagt 3060
ccaaaaacac aatggccatt aacttccaag atgctagaca gctaatgaat caggttcatg 3120
tcattgttct cttcttatcc gtcaagtctt ttgtttaatt ggctatttgt tctccgttca 3180
ccttcctatt aatgtaaaga gcagcattcg aattctcaaa ttataagaca tgaccatagg 3240
tttggtgttg tggcatgcta ctatacttgc atgtttggat tttcaacttt gtgaagttat 3300
tgtattataa gtacattacc tattttttgg gttgaccaaa tggtgcacga gtttcaatat 3360
tttactatgg tcaaaaggac ctaattggag tagcagagtt ttaggaaaaa tatagttcta 3420
gtatatttgg ggttcaagtt atagatatta gaaatcctat agtgtgtgtt tgctttgtgg 3480
aagtgcctca tgctagatca ggtcgtgtat catgagttta ttccatgaat ttttgggtgg 3540
aacaaaccca ttcttcatgt gtatacatta gcttgtgaga attgagttgg tgatgcatca 3600
actcattcta ttctacagac caaacaaaaa gtgatcatga tggatcacca tattactcaa 3660
acccaataca cgttgttcta aacaagggct aaggttggga gaaatgatgt gttctaggga 3720
agccactggg gacactctct taggctcatt ccctgaatag ggacataaag actgagttat 3780
aagtaagctg ctgggatgct ctttttctct tcaactttct tgaaaactta gcctccgcat 3840
gaactggcca gcgcatattc aataaaaata gtatcccttt gagcttggag tgtgcattga 3900
aggaggaagc tccttcctga atttcgtctg gattcttgta ttttgcaggt gttcacaagt 3960
cctgtggcgc caattgtatt attagtggtc cttctctttt caggccacat cgtgtcaatg 4020
acatgtatta ttggtagtga tgtaatttca gaggatctct tcggcataaa gctgcctctt 4080
tttgtgcacc atctgttacc taaggttttt gccatgatta ctactatata ccatgcgaag 4140
gttgtgggtt ttgaagggtt atatcagtta ctcatggtct gcccaattat ccaagctatg 4200
ctccttcctt cgtctgttat acctgttttc cgcatttcct cgtcgagatc attgatggga 4260
agataccgga tatctcgatg tgttgaaata ttgtgcttcc tagcatttct tctaacactg 4320
tttacaaata tcatttttgt ggcggaagtt ctttttggtg atagcacttg gacaaatgac 4380
ctgaaaggga acactgaaaa ccctattcta cttccatata tcgtcgtagt cctgatatca 4440
tgtggatcta ttggttttgc actgttcctt gctgttactc cactaaaatc agcatgtaat 4500
gaagctgaga gagcgttgtc tgtgcactca taacagagag aaacgttgga tgccactcgt 4560
cacagcaaaa ccgacttctc tgagaatagg gcacatgaag catatgaaga acagaggtcc 4620
ttagccatcc ttgttccaca ggattcactg aaaggtgata gaaataattt tcgtagcata 4680
tccgtcatct caaattagct tttgatcaca agggcagttt ctgacgctac tctacatgca 4740
aatcatatgt ctagtaatcc agaagttcat ccttagcatt gactggacag agcctatgtc 4800
aactgaaggt tgtgccctta aaattgactg gacagagagc ctatgtcaac tgaaaaaggt 4860
tgtgcaaata gactcggatg cctgcacgga caacgctctg tttgtggaga agtctgaata 4920
tttcttttat caatcactat ttctcttcca tttaaattca caattaacag gatggttctt 4980
atcatgactg tacctctgtt tgtgggagtg gaagtgttgg cttatctacc tattactcaa 5040
agaaacacca ctgtctcacc tgacacctcc ggtgattgct gcaaacagaa tgctttgttg 5100
gttgttgaat gaagcaaatt aatgtggaca gtggtactgc aaatcaggtg gttcctctat 5160
aggatacacc atgtgtggag tctgcaacaa ggttctagtc tcaacttgca catatggtgg 5220
ctcttgcgag ttgtgacatg atcgtctgac atcaaagcgt gaaagacgtt aataaatctg 5280
ttcaggagaa gcagtcatct agcgtggcaa gcttggaatt gacaatgagt gaggtggaca 5340
ctggtagatc tagtagcagg gtcaaaggat gatttctttt accaagtatg cttgcattcg 5400
tgaggtgatc cttttctctt cttacctgtt tttagtaaaa atagaagtag aaactgtaat 5460
cttcccatga gaaagacgag cttcttgaga tctagatcca ctcaatgagt tgtggcctgt 5520
gggttttgga aaggtttttg ttttagtcga gcatcccatc tttgcagctg aatttcacat 5580
tttagtaaac aacagctaat tggaccatag aaggttgatc atattgcatc tctttttttc 5640
gtgaccatgt ctaagcacat ttttcattag gaggaaggag agtttacaac acacatctta 5700
gtaagcatga tccttgggta gtttacatca tatgatgaat ggttacttct agtatttgcg 5760
tatgccttca gtagtacatt ggatatatcc tctatatttg aactttcgat ggaaagaatt 5820
tgtaggccgc ttatatagac cctatttgga accacttata atcgattcaa ttataatcat 5880
cttactgtga ggatcttttc tattctcgat tatgctagtc caaagttata aacggagatc 5940
aaaagaatca gaaataatct gtgccatagt ctcagtggtg aacaatgcag ttgcccagtt 6000
gtcccgttca aattcctgaa ctattccgct cattgtcgcc accagtttgc tgatttcttc 6060
tttgatttcc ttgatgtagg caaatcaatg a 6091
<210> 3
<211> 3093
<212> DNA
<213> Zea mays
<400> 3
ttagcttgta agtttgcatc tgattgcaca accgttgttc ccgtgcgtgg gggactgcgg 60
ctcgttcttg gatgaggttc tgacttctga ggaggatggg gatggctcac ggcgccgtga 120
cgcgacgatc ggcgtcggca gcggcgcgtc cctgctgtcc ctcctgcatg cttgccaccc 180
agcttcgcct cgccacgcgt ctcgtggacc attgcgcgcg tccctcgtgc cacggcgcac 240
ccgcagccat gagtgccagc gctcccgtct cccgactccc gagcaaatcg ctcggcgcct 300
actactagcc cgaaacctag gtggtgggaa ctcgggatac gaggtcctct tctccgccgc 360
ttgtcctcgg caagcacaaa cgcggtaagc caccaaccgc ctttcgatcg ccgggctcca 420
tccctaagcc atctcgccgc ctcgtgagtc gtgagccgtg agccaaccga cctgccatca 480
tcaattagtg acttcctgaa cctgcttcgt gcgtcctacc actccaaagt tccaacaatc 540
aagagattta aacaaagcct tccataactt gttgccaata agtgcaggat ttggaggcca 600
ctgggctttg gaaattcaaa gtagactgct tggatcataa cgagagagca caaagggcct 660
gggttttgta aacagttggc tttcactaga gtcgatccat tccatactga gcttttgcat 720
atcatcaatt catcacacaa tggatggtgt gcgatgcatg gagtccccag ctgctggtga 780
tgccccgcat agttctttcc gaacccttgg gccaacactc ctggtttcaa tggggtatct 840
tgacttcgga aaatggttgg tggcagtgga agctgggtct cggtttggct atgatcttgt 900
cctgctcgtg ctgcttttta atctatcagc tattctgtgt cagtacctct cgagctgtat 960
cggcattgtc accaaaaaga atcttgcgga gatttgccac caggagtatg atcagaaaat 1020
atgtgttgtt cttggtcttc aagcaggact gtccttgcta acttctgaat ttaccatgat 1080
tgcaggcatc gtagttgggt tcaaccttgt atttgaaagc aacaatccca tcacagtcgt 1140
atgttttaca agtgttgtag ttaatctgct accatataca ctctcccttc tggacaagag 1200
gaaggctgga atgtttaatg cctacgcatc tggctttaca ctagtttgtt ttgtgcttgg 1260
tttattagtg agccatccca aaacccctgt caataccaac gtaatgttcc ccaagttgag 1320
tggtgaaagt gcttactcac tgatggtact acttggcaca aatataatag tacacaactt 1380
ttatactcat tcatcagttg ttcaggttca gagaagattt cagggtcata cccttggtac 1440
tctgtttcat gatcaccttt tttctgtact atttgcattt tctggtatct ttcttgtgaa 1500
ttatattctg atgagttcag cagttgatga gtccaaaaac acaatggcca ttaacttcca 1560
agatgctaga cagctaatga atcaggtgtt cacaagtcct gtggcgccaa ttgtattatt 1620
agtggtcctt ctcttttcag gccacatcgt gtcaatgaca tgtattattg gtagtgatgt 1680
aatttcagag gatctcttcg gcataaagct gcctcttttt gtgcaccatc tgttacctaa 1740
ggtttttgcc atgattacta ctatatacca tgcgaaggtt gtgggttttg aagggttata 1800
tcagttactc atggtctgcc caattatcca agctatgctc cttccttcgt ctgttatacc 1860
tgttttccgc atttcctcgt cgagatcatt gatgggaaga taccggatat ctcgatgtgt 1920
tgaaatattg tgcttcctag catttcttct aacactgttt acaaatatca tttttgtggc 1980
ggaagttctt tttggtgata gcacttggac aaatgacctg aaagggaaca ctgaaaaccc 2040
tattctactt ccatatatcg tcgtagtcct gatatcatgt ggatctattg gttttgcact 2100
gttccttgct gttactccac taaaatcagc atgtaatgaa gctgagagag cgttgtctgt 2160
gcactcataa cagagagaaa cgttggatgc cactcgtcac agcaaaaccg acttctctga 2220
gaatagggca catgaagcat atgaagaaca gaggtcctta gccatccttg ttccacagga 2280
ttcactgaaa gtaatccaga agttcatcct tagcattgac tggacagagc ctatgtcaac 2340
tgaaggttgt gcccttaaaa ttgactggac agagagccta tgtcaactga aaaaggttgt 2400
gcaaatagac tcggatgcct gcacggacaa cgctctgttt gtggagaagt ctgaatattt 2460
cttttatcaa tcactatttc tcttccattt aaattcacaa ttaacaggat ggttcttatc 2520
atgactgtac ctctgtttgt gggagtggaa gtgttggctt atctacctat tactcaaaga 2580
aacaccactg tctcacctga cacctccggt gattgctgca aacagaatgc tttgttggtt 2640
gttgaatgaa gcaaattaat gtggacagtg gtactgcaaa tcaggtggtt cctctatagg 2700
atacaccatg tgtggagtct gcaacaaggt tctagtctca acttgcacat atggtggctc 2760
ttgcgagttg tgacatgatc gtctgacatc aaagcgtgaa agacgttaat aaatctgttc 2820
aggagaagca gtcatctagc gtggcaagct tggaattgac aatgagtgag gtggacactg 2880
gtagatctag tagcagggtc aaaggatgat ttcttttacc aagtatgctt gcattcgtga 2940
ggtgatcctt ttctcttctt acctgttttt agtaaaaata gaagtagaaa ctgtaatctt 3000
cccatgagaa agacgagctt cttgagatct agatccactc aatgagttgt ggcctgtggg 3060
ttttggaaag gtttttgttt tagtcgagca tcc 3093
<210> 4
<211> 1431
<212> DNA
<213> Zea mays
<400> 4
atggatggtg tgcgatgcat ggagtcccca gctgctggtg atgccccgca tagttctttc 60
cgaacccttg ggccaacact cctggtttca atggggtatc ttgacttcgg aaaatggttg 120
gtggcagtgg aagctgggtc tcggtttggc tatgatcttg tcctgctcgt gctgcttttt 180
aatctatcag ctattctgtg tcagtacctc tcgagctgta tcggcattgt caccaaaaag 240
aatcttgcgg agatttgcca ccaggagtat gatcagaaaa tatgtgttgt tcttggtctt 300
caagcaggac tgtccttgct aacttctgaa tttaccatga ttgcaggcat cgtagttggg 360
ttcaaccttg tatttgaaag caacaatccc atcacagtcg tatgttttac aagtgttgta 420
gttaatctgc taccatatac actctccctt ctggacaaga ggaaggctgg aatgtttaat 480
gcctacgcat ctggctttac actagtttgt tttgtgcttg gtttattagt gagccatccc 540
aaaacccctg tcaataccaa cgtaatgttc cccaagttga gtggtgaaag tgcttactca 600
ctgatggtac tacttggcac aaatataata gtacacaact tttatactca ttcatcagtt 660
gttcaggttc agagaagatt tcagggtcat acccttggta ctctgtttca tgatcacctt 720
ttttctgtac tatttgcatt ttctggtatc tttcttgtga attatattct gatgagttca 780
gcagttgatg agtccaaaaa cacaatggcc attaacttcc aagatgctag acagctaatg 840
aatcaggtgt tcacaagtcc tgtggcgcca attgtattat tagtggtcct tctcttttca 900
ggccacatcg tgtcaatgac atgtattatt ggtagtgatg taatttcaga ggatctcttc 960
ggcataaagc tgcctctttt tgtgcaccat ctgttaccta aggtttttgc catgattact 1020
actatatacc atgcgaaggt tgtgggtttt gaagggttat atcagttact catggtctgc 1080
ccaattatcc aagctatgct ccttccttcg tctgttatac ctgttttccg catttcctcg 1140
tcgagatcat tgatgggaag ataccggata tctcgatgtg ttgaaatatt gtgcttccta 1200
gcatttcttc taacactgtt tacaaatatc atttttgtgg cggaagttct ttttggtgat 1260
agcacttgga caaatgacct gaaagggaac actgaaaacc ctattctact tccatatatc 1320
gtcgtagtcc tgatatcatg tggatctatt ggttttgcac tgttccttgc tgttactcca 1380
ctaaaatcag catgtaatga agctgagaga gcgttgtctg tgcactcata a 1431
<210> 5
<211> 20
<212> DNA
<213> unowns (synthetic)
<400> 5
cgcatagttc tttccgaacc 20
<210> 6
<211> 19
<212> DNA
<213> unowns (synthetic)
<400> 6
caccaaccat tttccgaag 19
<210> 7
<211> 84
<212> DNA
<213> Zea mays
<400> 7
cgcatagttc tttccgaacc cttgggccaa cactcctggt ttcaatgggg tatctagtat 60
cttgacttcg gaaaatggtt ggtg 84
<210> 8
<211> 77
<212> DNA
<213> Zea mays
<400> 8
cgcatagttc tttccgaacc cttgggccaa cactcctggt ttcaatgggg tatcttgact 60
tcggaaaatg gttggtg 77
<210> 9
<211> 20
<212> DNA
<213> unowns (synthetic)
<400> 9
gcctacgcat ctggctttac 20
<210> 10
<211> 20
<212> DNA
<213> unowns (synthetic)
<400> 10
ggccattgtg tttttggact 20
<210> 11
<211> 935
<212> DNA
<213> Zea mays
<400> 11
gcctacgcat ctggctttac actagtttgt tttgtgcttg gtttattagt gagccatccc 60
aaaacccctg tcaataccaa cgtaatgttc cccaagttga gtggtgaaag tgcttactca 120
ctgatggtac tacttggcac aaatataata gtacacaact tttatactca ttcatcagtt 180
gttcaggtaa atttctgaca attccattcc catgtttatg caattagctt tgtcaagcat 240
gtcttccatt aaaagtttgt cttatcaaac ctgaatgcat ctttcatggc gaaagtgatg 300
ttttgtgtta ggattatgta caaaaaaatg gtttatgtta gggtactgag tgtattggtt 360
gttcttgatc accaattcgc gaaagggcct ctagctgagt tggttaggtg gtctgaatag 420
cactcctcag gtcctgggtt cgactccccg tgggagcgaa tttcaggctg tggttaaaaa 480
aatcccctcg tctgtcccac gccaaagcac aggtctaaga ctcagcccgg tcgtggtcgt 540
tctcacatgg gcttcgatgc cgctgtgtat gggtggggta ggggttcggg ggttttcttg 600
acctgtgtga gaaggtattt ttcttaatac aatacccggg gctgtcttac cccccgcagg 660
tcaagttttg atcaccaatt caccataggg gtgctgaatg cactgagttg ttcttgattc 720
attctttgct agtttggtct gctttggctt catgtatcag tgttcattca gatatattat 780
cacttgtgca ggttcagaga agatttcagg gtcataccct tggtactctg tttcatgatc 840
accttttttc tgtactattt gcattttctg gtatctttct tgtgaattat attctgatga 900
gttcagcagt tgatgagtcc aaaaacacaa tggcc 935
<210> 12
<211> 632
<212> DNA
<213> Zea mays
<400> 12
gcctacgcat ctggctttac actagtttgt tttgtgcttg gtttattagt gagccatccc 60
aaaacccctg tcaataccaa cgtaatgttc cccaagttga gtggtgaaag tgcttactca 120
ctgatggtac tacttggcac aaatataata gtacacaact tttatactca ttcatcagtt 180
gttcaggtaa atttctgaca attccattcc catgtttatg caattagctt tgtcaagcat 240
gtcttccatt aaaagtttgt cttatcaaac ctgaatgcat ctttcatggc gaaagtgatg 300
ttttgtgtta ggattatgta caaaaaaatg gtttatgtta gggtactgag tgtattggtt 360
gtttttgatc accaattcac cataggggtg ctgaatgcac tgagttgttc ttgattcatt 420
ctttgctagt ttggtctgct ttggcttcat gtatcagtgt tcattcagat atattatcac 480
ttgtgcaggt tcagagaaga tttcagggtc atacccttgg tactctgttt catgatcacc 540
ttttttctgt actatttgca ttttctggta tctttcttgt gaattatatt ctgatgagtt 600
cagcagttga tgagtccaaa aacacaatgg cc 632
<210> 13
<211> 1313
<212> DNA
<213> Zea mays
<400> 13
aaatcgctcg gcgcctacta ctagcccgaa acctaggtgg tgggaactcg ggatacgagg 60
tcctcttctc cgccgcttgt cctcggcaag cacaaacgcg gtaagccacc aaccgccttt 120
cgatcgccgg gctccatccc taagccatct cgccgcctcg tgagtcgtga gccgtgagcc 180
aaccgacctg ccatcatcaa ttagtgactt cctgaacctg cttcgtgcgt cctaccactc 240
caaagttcca acaatcaaga gatttaaaca aagccttcca taacttgttg ccaataagtg 300
caggatttgg aggccactgg gctttggaaa ttcaaagtag actgcttgga tcataacgag 360
agagcacaaa gggcctgggt tttgtaaaca gttggctttc actagagtcg atccattcca 420
tactgagctt ttgcatatca tcaattcatc acacaatgga tggtgtgcga tgcatggagt 480
ccccagctgc tggtgatgcc ccgcatagtt ctttccgaac ccttgggcca acactcctgg 540
tttcaatggg gtatcttgac ttcggaaaat ggttggtggc agtggaagct gggtctcggt 600
ttggctatga tcttgtcctg ctcgtgctgc tttttaatct atcagctatt ctgtgtcagt 660
acctctcgag ctgtatcggc attgtcacca aaaagaatct tgcggagatt tgccaccagg 720
agtatgatca gaaaatatgt gttgttcttg gtcttcaagc aggactgtcc ttgctaactt 780
ctgaatttac catgattgca ggcatcgtag ttgggttcaa ccttgtattt gaaagcaaca 840
atcccatcac agtcgtatgt tttacaagtg ttgtagttaa tctgctacca tatacactct 900
cccttctgga caagaggaag gctggaatgt ttaatgccta cgcatctggc tttacactag 960
tttgttttgt gcttggttta ttagtgagcc atcccaaaac ccctgtcaat accaacgtaa 1020
tgttccccaa gttgagtggt gaaagtgctt actcactgat ggtactactt ggcacaaata 1080
taatagtaca caacttttat actcattcat cagttgttca ggttcagaga agatttcagg 1140
gtcataccct tggtactctg tttcatgatc accttttttc tgtactattt gcattttctg 1200
gtatctttct tgtgaattat attctgatga gttcagcagt tgatgagtcc aaaaacacaa 1260
tggccattaa cttccaagat gctagacagc taatgaatca ggcaaatcaa tga 1313
<210> 14
<211> 858
<212> DNA
<213> Zea mays
<400> 14
atggatggtg tgcgatgcat ggagtcccca gctgctggtg atgccccgca tagttctttc 60
cgaacccttg ggccaacact cctggtttca atggggtatc ttgacttcgg aaaatggttg 120
gtggcagtgg aagctgggtc tcggtttggc tatgatcttg tcctgctcgt gctgcttttt 180
aatctatcag ctattctgtg tcagtacctc tcgagctgta tcggcattgt caccaaaaag 240
aatcttgcgg agatttgcca ccaggagtat gatcagaaaa tatgtgttgt tcttggtctt 300
caagcaggac tgtccttgct aacttctgaa tttaccatga ttgcaggcat cgtagttggg 360
ttcaaccttg tatttgaaag caacaatccc atcacagtcg tatgttttac aagtgttgta 420
gttaatctgc taccatatac actctccctt ctggacaaga ggaaggctgg aatgtttaat 480
gcctacgcat ctggctttac actagtttgt tttgtgcttg gtttattagt gagccatccc 540
aaaacccctg tcaataccaa cgtaatgttc cccaagttga gtggtgaaag tgcttactca 600
ctgatggtac tacttggcac aaatataata gtacacaact tttatactca ttcatcagtt 660
gttcaggttc agagaagatt tcagggtcat acccttggta ctctgtttca tgatcacctt 720
ttttctgtac tatttgcatt ttctggtatc tttcttgtga attatattct gatgagttca 780
gcagttgatg agtccaaaaa cacaatggcc attaacttcc aagatgctag acagctaatg 840
aatcaggcaa atcaatga 858
<210> 15
<211> 1526
<212> DNA
<213> Zea mays
<400> 15
aaatcgctcg gcgcctacta ctagcccgaa acctaggtgg tgggaactcg ggatacgagg 60
tcctcttctc cgccgcttgt cctcggcaag cacaaacgcg gtaagccacc aaccgccttt 120
cgatcgccgg gctccatccc taagccatct cgccgcctcg tgagtcgtga gccgtgagcc 180
aaccgacctg ccatcatcaa ttagtgactt cctgaacctg cttcgtgcgt cctaccactc 240
caaagttcca acaatcaaga gatttaaaca aagccttcca taacttgttg ccaataagtg 300
caggatttgg aggccactgg gctttggaaa ttcaaagtag actgcttgga tcataacgag 360
agagcacaaa gggcctgggt tttgtaaaca gttggctttc actagagtcg atccattcca 420
tactgagctt ttgcatatca tcaattcatc acacaatgga tggtgtgcga tgcatggagt 480
ccccagctgc tggtgatgcc ccgcatagtt ctttccgaac ccttgggcca acactcctgg 540
tttcaatggg gtatcttgac ttcggaaaat ggttggtggc agtggaagct gggtctcggt 600
ttggctatga tcttgtcctg ctcgtgctgc tttttaatct atcagctatt ctgtgtcagt 660
acctctcgag ctgtatcggc attgtcacca aaaagaatct tgcggagatt tgccaccagg 720
agtatgatca gaaaatatgt gttgttcttg gtcttcaagc aggactgtcc ttgctaactt 780
ctgaatttac catgattgca ggcatcgtag ttgggttcaa ccttgtattt gaaagcaaca 840
atcccatcac agtcgtatgt tttacaagtg ttgtagttaa tctgctacca tatacactct 900
cccttctgga caagaggaag gctggaatgt ttaatgccta cgcatctggc tttacactag 960
tttgttttgt gcttggttta ttagtgagcc atcccaaaac ccctgtcaat accaacgtaa 1020
tgttccccaa gttgagtggt gaaagtgctt actcactgat ggtactactt ggcacaaata 1080
taatagtaca caacttttat actcattcat cagttgttca ggttcagaga agatttcagg 1140
gtcataccct tggtactctg tttcatgatc accttttttc tgtactattt gcattttctg 1200
gtatctttct tgtgaattat attctgatga gttcagcagt tgatgagtcc aaaaacacaa 1260
tggccattaa cttccaagat gctagacagc taatgaatca ggttcatgtc attgttctct 1320
tcttatccgt caagtctttt gtttaattgg ctatttgttc tccgttcacc ttcctattaa 1380
tgtaaagagc agcattcgaa ttctcaaatt ataagacatg accataggtt tggtgttgtg 1440
gcatgctact atacttgcat gtttggattt tcaactttgt gaagttattg tattataagt 1500
acattaccta ttttttgggt tgacca 1526
<210> 16
<211> 891
<212> DNA
<213> Zea mays
<400> 16
atggatggtg tgcgatgcat ggagtcccca gctgctggtg atgccccgca tagttctttc 60
cgaacccttg ggccaacact cctggtttca atggggtatc ttgacttcgg aaaatggttg 120
gtggcagtgg aagctgggtc tcggtttggc tatgatcttg tcctgctcgt gctgcttttt 180
aatctatcag ctattctgtg tcagtacctc tcgagctgta tcggcattgt caccaaaaag 240
aatcttgcgg agatttgcca ccaggagtat gatcagaaaa tatgtgttgt tcttggtctt 300
caagcaggac tgtccttgct aacttctgaa tttaccatga ttgcaggcat cgtagttggg 360
ttcaaccttg tatttgaaag caacaatccc atcacagtcg tatgttttac aagtgttgta 420
gttaatctgc taccatatac actctccctt ctggacaaga ggaaggctgg aatgtttaat 480
gcctacgcat ctggctttac actagtttgt tttgtgcttg gtttattagt gagccatccc 540
aaaacccctg tcaataccaa cgtaatgttc cccaagttga gtggtgaaag tgcttactca 600
ctgatggtac tacttggcac aaatataata gtacacaact tttatactca ttcatcagtt 660
gttcaggttc agagaagatt tcagggtcat acccttggta ctctgtttca tgatcacctt 720
ttttctgtac tatttgcatt ttctggtatc tttcttgtga attatattct gatgagttca 780
gcagttgatg agtccaaaaa cacaatggcc attaacttcc aagatgctag acagctaatg 840
aatcaggttc atgtcattgt tctcttctta tccgtcaagt cttttgttta a 891
<210> 17
<211> 285
<212> PRT
<213> Zea mays
<400> 17
Met Asp Gly Val Arg Cys Met Glu Ser Pro Ala Ala Gly Asp Ala Pro
1 5 10 15
His Ser Ser Phe Arg Thr Leu Gly Pro Thr Leu Leu Val Ser Met Gly
20 25 30
Tyr Leu Asp Phe Gly Lys Trp Leu Val Ala Val Glu Ala Gly Ser Arg
35 40 45
Phe Gly Tyr Asp Leu Val Leu Leu Val Leu Leu Phe Asn Leu Ser Ala
50 55 60
Ile Leu Cys Gln Tyr Leu Ser Ser Cys Ile Gly Ile Val Thr Lys Lys
65 70 75 80
Asn Leu Ala Glu Ile Cys His Gln Glu Tyr Asp Gln Lys Ile Cys Val
85 90 95
Val Leu Gly Leu Gln Ala Gly Leu Ser Leu Leu Thr Ser Glu Phe Thr
100 105 110
Met Ile Ala Gly Ile Val Val Gly Phe Asn Leu Val Phe Glu Ser Asn
115 120 125
Asn Pro Ile Thr Val Val Cys Phe Thr Ser Val Val Val Asn Leu Leu
130 135 140
Pro Tyr Thr Leu Ser Leu Leu Asp Lys Arg Lys Ala Gly Met Phe Asn
145 150 155 160
Ala Tyr Ala Ser Gly Phe Thr Leu Val Cys Phe Val Leu Gly Leu Leu
165 170 175
Val Ser His Pro Lys Thr Pro Val Asn Thr Asn Val Met Phe Pro Lys
180 185 190
Leu Ser Gly Glu Ser Ala Tyr Ser Leu Met Val Leu Leu Gly Thr Asn
195 200 205
Ile Ile Val His Asn Phe Tyr Thr His Ser Ser Val Val Gln Val Gln
210 215 220
Arg Arg Phe Gln Gly His Thr Leu Gly Thr Leu Phe His Asp His Leu
225 230 235 240
Phe Ser Val Leu Phe Ala Phe Ser Gly Ile Phe Leu Val Asn Tyr Ile
245 250 255
Leu Met Ser Ser Ala Val Asp Glu Ser Lys Asn Thr Met Ala Ile Asn
260 265 270
Phe Gln Asp Ala Arg Gln Leu Met Asn Gln Ala Asn Gln
275 280 285
<210> 18
<211> 296
<212> PRT
<213> Zea mays
<400> 18
Met Asp Gly Val Arg Cys Met Glu Ser Pro Ala Ala Gly Asp Ala Pro
1 5 10 15
His Ser Ser Phe Arg Thr Leu Gly Pro Thr Leu Leu Val Ser Met Gly
20 25 30
Tyr Leu Asp Phe Gly Lys Trp Leu Val Ala Val Glu Ala Gly Ser Arg
35 40 45
Phe Gly Tyr Asp Leu Val Leu Leu Val Leu Leu Phe Asn Leu Ser Ala
50 55 60
Ile Leu Cys Gln Tyr Leu Ser Ser Cys Ile Gly Ile Val Thr Lys Lys
65 70 75 80
Asn Leu Ala Glu Ile Cys His Gln Glu Tyr Asp Gln Lys Ile Cys Val
85 90 95
Val Leu Gly Leu Gln Ala Gly Leu Ser Leu Leu Thr Ser Glu Phe Thr
100 105 110
Met Ile Ala Gly Ile Val Val Gly Phe Asn Leu Val Phe Glu Ser Asn
115 120 125
Asn Pro Ile Thr Val Val Cys Phe Thr Ser Val Val Val Asn Leu Leu
130 135 140
Pro Tyr Thr Leu Ser Leu Leu Asp Lys Arg Lys Ala Gly Met Phe Asn
145 150 155 160
Ala Tyr Ala Ser Gly Phe Thr Leu Val Cys Phe Val Leu Gly Leu Leu
165 170 175
Val Ser His Pro Lys Thr Pro Val Asn Thr Asn Val Met Phe Pro Lys
180 185 190
Leu Ser Gly Glu Ser Ala Tyr Ser Leu Met Val Leu Leu Gly Thr Asn
195 200 205
Ile Ile Val His Asn Phe Tyr Thr His Ser Ser Val Val Gln Val Gln
210 215 220
Arg Arg Phe Gln Gly His Thr Leu Gly Thr Leu Phe His Asp His Leu
225 230 235 240
Phe Ser Val Leu Phe Ala Phe Ser Gly Ile Phe Leu Val Asn Tyr Ile
245 250 255
Leu Met Ser Ser Ala Val Asp Glu Ser Lys Asn Thr Met Ala Ile Asn
260 265 270
Phe Gln Asp Ala Arg Gln Leu Met Asn Gln Val His Val Ile Val Leu
275 280 285
Phe Leu Ser Val Lys Ser Phe Val
290 295
<210> 19
<211> 1991
<212> DNA
<213> Zea mays
<400> 19
ctgcagtgca gcgtgacccg gtcgtgcccc tctctagaga taatgagcat tgcatgtcta 60
agttataaaa aattaccaca tatttttttt gtcacacttg tttgaagtgc agtttatcta 120
tctttataca tatatttaaa ctttactcta cgaataatat aatctatagt actacaataa 180
tatcagtgtt ttagagaatc atataaatga acagttagac atggtctaaa ggacaattga 240
gtattttgac aacaggactc tacagtttta tctttttagt gtgcatgtgt tctccttttt 300
ttttgcaaat agcttcacct atataatact tcatccattt tattagtaca tccatttagg 360
gtttagggtt aatggttttt atagactaat ttttttagta catctatttt attctatttt 420
agcctctaaa ttaagaaaac taaaactcta ttttagtttt tttatttaat aatttagata 480
taaaatagaa taaaataaag tgactaaaaa ttaaacaaat accctttaag aaattaaaaa 540
aactaaggaa acatttttct tgtttcgagt agataatgcc agcctgttaa acgccgtcga 600
cgagtctaac ggacaccaac cagcgaacca gcagcgtcgc gtcgggccaa gcgaagcaga 660
cggcacggca tctctgtcgc tgcctctgga cccctctcga gagttccgct ccaccgttgg 720
acttgctccg ctgtcggcat ccagaaattg cgtggcggag cggcagacgt gagccggcac 780
ggcaggcggc ctcctcctcc tctcacggca ccggcagcta cgggggattc ctttcccacc 840
gctccttcgc tttcccttcc tcgcccgccg taataaatag acaccccctc cacaccctct 900
ttccccaacc tcgtgttgtt cggagcgcac acacacacaa ccagatctcc cccaaatcca 960
cccgtcggca cctccgcttc aaggtacgcc gctcgtcctc cccccccccc tctctacctt 1020
ctctagatcg gcgttccggt ccatggttag ggcccggtag ttctacttct gttcatgttt 1080
gtgttagatc cgtgtttgtg ttagatccgt gctgctagcg ttcgtacacg gatgcgacct 1140
gtacgtcaga cacgttctga ttgctaactt gccagtgttt ctctttgggg aatcctggga 1200
tggctctagc cgttccgcag acgggatcga tttcatgatt ttttttgttt cgttgcatag 1260
ggtttggttt gcccttttcc tttatttcaa tatatgccgt gcacttgttt gtcgggtcat 1320
cttttcatgc ttttttttgt cttggttgtg atgatgtggt ctggttgggc ggtcgttcta 1380
gatcggagta gaattctgtt tcaaactacc tggtggattt attaattttg gatctgtatg 1440
tgtgtgccat acatattcat agttacgaat tgaagatgat ggatggaaat atcgatctag 1500
gataggtata catgttgatg cgggttttac tgatgcatat acagagatgc tttttgttcg 1560
cttggttgtg ttgatgtggt gtggttgggc ggtcgttcat tcgttctaga tcggagtaga 1620
atactgtttc aaactacctg gtgtatttat taattttgga actgtatgtg tgtgtcatac 1680
atcttcatag ttacgagttt aagatggatg gaaatatcga tctaggatag gtatacatgt 1740
tgatgtgggt tttactgatg catatacatg atggcatatg cagcatctat tcatatgctc 1800
taaccttgag tacctatcta ttataataaa caagtatgtt ttataattat tttgatcttg 1860
atatacttgg atgatggcat atgcagcagc tatatgtgga tttttttagc cctgccttca 1920
tacgctattt atttgcttgg tactgtttct tttgtcgatg ctcaccctgt tgtttggtgt 1980
tacttctgca g 1991

Claims (14)

1. The application of the protein in controlling the moisture content or dehydration rate of corn kernels is characterized in that: the amino acid sequence of the protein is shown as SEQ ID NO. 1.
2. Use of a nucleic acid encoding a protein according to claim 1 for controlling moisture content or dehydration rate traits in corn kernels.
3. The use according to claim 2, wherein the nucleotide sequence or reverse complement of the nucleic acid is as set forth in any one of positions 210 to 4530 of SEQ ID No.2 or SEQ ID No. 2.
4. The molecular marker is characterized in that the marker is 7 bases AGTATT inserted at 1044-1045 positions of a sequence shown in SEQ ID NO. 2; or 303 bases CTTGATCACCAATTCGCGAAAGGGCCTCTAGCTGAGTTGGTTAGGTGGTCTGAATAGCACTCCTCAGGTCCTGGGTTCGACTCCCCGTGGGAGCGAATTTCAGGCTGTGGTTAAAAAAATCCCCTCGTCTGTCCCACGCCAAAGCACAGGTCTAAGACTCAGCCCGGTCGTGGTCGTTCTCACATGGGCTTCGATGCCGCTGTGTATGGGTGGGGTAGGGGTTCGGGGGTTTTCTTGACCTGTGTGAGAAGGTATTTTTCTTAATACAATACCCGGGGCTGTCTTACCCCCCGCAGGTCAAGT at positions 2506 to 2808 of the sequence shown in SEQ ID NO. 2.
5. A method for identifying or aiding in the identification of moisture content or dehydration rate traits in corn kernels comprising the steps of: (1) Detecting the molecular marker of claim 4 in the material to be detected; (2) If the detection result is that the mark is contained, the material to be detected shows the characteristics of high grain water content or slow dehydration rate; if the detection result is that the mark is not contained, the material to be detected shows the characteristics of low water content of the grains or high dehydration rate.
6. The method of claim 5, wherein the molecular marker detection method employs PCR amplification.
7. The method of claim 6, wherein the primer pair used for PCR amplification consists of SEQ ID NO.5/SEQ ID NO.6 or SEQ ID NO.9/SEQ ID NO. 10.
8. The method of claim 5, wherein the PCR amplification product comprising the label is shown as SEQ ID NO.7 or SEQ ID NO. 11; the PCR amplification products without the above markers are shown as SEQ ID NO.8 or SEQ ID NO. 12.
9. A method for screening corn materials having a low kernel moisture content or a fast dehydration rate, characterized in that the molecular marker according to claim 4 is detected in a test material according to the method according to any one of claims 5 to 8, and materials not comprising the molecular marker according to claim 4 are screened.
10. A method for reducing the moisture content of corn kernels or increasing the dehydration rate, characterized in that the expression and/or activity of the protein of claim 1 is increased in the corn material to be modified, and plants are selected which have low moisture content or a fast dehydration rate.
11. The method of claim 10, wherein the method of increasing protein expression is by driving expression of a nucleic acid sequence encoding the protein using a highly active promoter.
12. The method of claim 11, wherein the high activity promoter is maize ubiquitin promoter.
13. The method of claim 12, wherein the maize ubiquitin promoter sequence is set forth in SEQ ID No. 19.
14. Use of the molecular marker of claim 4, or the method of any one of claims 5 to 13, for improving the moisture content or dehydration rate trait of corn kernels.
CN202210595676.4A 2022-05-30 2022-05-30 Corn kernel water content control gene ZmEIN2-1 and molecular marker thereof Active CN114989281B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210595676.4A CN114989281B (en) 2022-05-30 2022-05-30 Corn kernel water content control gene ZmEIN2-1 and molecular marker thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210595676.4A CN114989281B (en) 2022-05-30 2022-05-30 Corn kernel water content control gene ZmEIN2-1 and molecular marker thereof

Publications (2)

Publication Number Publication Date
CN114989281A CN114989281A (en) 2022-09-02
CN114989281B true CN114989281B (en) 2024-04-05

Family

ID=83028735

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210595676.4A Active CN114989281B (en) 2022-05-30 2022-05-30 Corn kernel water content control gene ZmEIN2-1 and molecular marker thereof

Country Status (1)

Country Link
CN (1) CN114989281B (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111719012A (en) * 2020-06-29 2020-09-29 吉林省农业科学院 dCAPS molecular marker primer pair for identifying dehydration rate genotype of corn kernel and application
CN112521471A (en) * 2020-11-27 2021-03-19 华中农业大学 Gene and molecular marker for controlling water content of corn kernels and application thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111719012A (en) * 2020-06-29 2020-09-29 吉林省农业科学院 dCAPS molecular marker primer pair for identifying dehydration rate genotype of corn kernel and application
CN112521471A (en) * 2020-11-27 2021-03-19 华中农业大学 Gene and molecular marker for controlling water content of corn kernels and application thereof

Also Published As

Publication number Publication date
CN114989281A (en) 2022-09-02

Similar Documents

Publication Publication Date Title
US9663794B2 (en) Heat-resistance rice gene OsZFP, screening marker and separation method thereof
CN112375130B (en) Corn ear length gene and molecular marker and application thereof
CN110938120B (en) StSCI protein for changing self-incompatibility of diploid potato material
CN106086064B (en) Gene for controlling rice plant height, improving lodging resistance and increasing effective tiller number and yield and application thereof
CN108165554B (en) Corn leaf width control gene ZmNL4 and application thereof
CN111153974A (en) Corn disease-resistant gene and molecular marker and application thereof
US11479784B2 (en) Modulation of seed vigor
CN110903368B (en) Gene for controlling female character of corn, kit for creating female sterile line of corn, mutant genotype and method
CN110862993A (en) Gene ZKM89 for controlling plant height and ear position height of corn and application thereof
CN112521471B (en) Gene and molecular marker for controlling water content of corn kernels and application thereof
CN110643589B (en) Protein for improving drought resistance of plants and application thereof
JP6639382B2 (en) Brassica plant comprising mutant DA1 allele
WO2019129145A1 (en) Flowering time-regulating gene cmp1 and related constructs and applications thereof
CN101747420B (en) Dominant dwarf rice related protein, encoding gene thereof and application
CN116445446B (en) Wild cabbage glycosyltransferase BoUGT C2 gene and application
CN110862440B (en) Gene ZKM465 for controlling corn plant height and application thereof
CN108484741B (en) Protein for controlling grain weight of crop seeds and application thereof
CN114989281B (en) Corn kernel water content control gene ZmEIN2-1 and molecular marker thereof
CN114958867A (en) Corn ear grain weight and yield regulation gene KWE2, and encoding protein, functional marker, expression vector and application thereof
CN110862994A (en) Gene ZKM76 for controlling plant height and ear position height of corn and application thereof
CN110959043A (en) Method for improving agronomic traits of plants by using BCS1L gene and guide RNA/CAS endonuclease system
CN110229801B (en) Gene for controlling rice leaf senescence and protein coded by same
CN116426562A (en) Corn kernel type gene and application thereof
WO2024146898A1 (en) Nal1 in rice
CN116732050A (en) Method for increasing corn yield

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
CB03 Change of inventor or designer information
CB03 Change of inventor or designer information

Inventor after: Yan Jianbing

Inventor after: Li Wenqiang

Inventor after: Yu Yanhui

Inventor after: Liu Longyu

Inventor after: Wu Shenshen

Inventor before: Yan Jianbing

Inventor before: Li Wenqiang

Inventor before: Jin Yanhui

Inventor before: Liu Longyu

Inventor before: Wu Shenshen

GR01 Patent grant
GR01 Patent grant