CN114921393B - Double-gene mutant of rhizobium and application thereof - Google Patents

Abstract

The invention provides a rhizobia double-gene mutant and application thereof, belonging to the technical field of agricultural microorganisms. In order to reduce the number of root nodules on the premise of reducing the cost of workers, the technical problem that the number of soybean root nodules is difficult to control is solved. The invention provides a double-gene mutant of rhizobium HH103, which is obtained by taking rhizobium as a starting strain and carrying out mutation or silencing on nopT genes and nopP genes in the starting strain. Several experiments and verification of different groups show that HH103 omega NopT omega NopP can reduce the number of soybean rhizomes, provides a basis for subsequent research on soybean-rhizobium symbiotic system formation, and provides possibility for improving the symbiotic efficiency of soybean and rhizobium.

Description

Double-gene mutant of rhizobium and application thereof

Technical Field

The invention belongs to the field of agricultural microorganisms, and particularly relates to a rhizobia double-gene mutant and application thereof.

Background

Nitrogen is one of the most important elements limiting crop growth, but the nitrogen available to plants in the soil is very limited, mainly also provided by chemical fertilizers. However, with the increasing use of nitrogen fertilizer, this not only inhibits the symbiotic nitrogen fixation between rhizobia and leguminous plants, but also brings a number of adverse effects to the ecological environment. Therefore, symbiotic nitrogen fixation can provide a sufficient nitrogen source for the growth and development of legumes without chemical fertilizer supply. Symbiotic nodules can be formed after soybean root systems are infected by rhizobia, and the rhizobia can convert nitrogen in air into ammonia in a biological nitrogen fixation mode to provide nitrogen sources for soybeans. The nitrogen fixation capability between the soybeans and rhizobia is improved, so that the use of nitrogenous fertilizer can be greatly reduced, and the soybean yield can be improved. Therefore, the improvement of the nitrogen fixation capacity of leguminous plants has important significance for ecological environment and agricultural development.

Many signal molecules are involved in the symbiotic nodulation process of leguminous plants and rhizobium, wherein a type III effector secreted by the type III secretion system of rhizobium is one of the most important signal molecules, which affects the establishment of symbiotic relationship between rhizobium and host plants. However, it is not clear how the type III effector affects the molecular mechanism of plant nodulation, and the genes for interaction between rhizobia and leguminous plants have not been studied in depth.

The number of the soybean rhizomes is an important factor influencing the symbiotic nitrogen fixation and growth conditions of the soybean, the number of the soybean rhizomes is not controlled by manpower at present, the stable number of the soybean rhizomes can be maintained only by constantly replacing the rhizomes and searching for the rhizomes suitable for inoculating the soybean, the operation is troublesome, the engineering quantity is large, and unknown factors are relatively large. There is an urgent need for a method of controlling the number of soybean nodules.

Disclosure of Invention

The invention aims to reduce the number of root nodules on the premise of reducing the cost of workers, and solves the technical problem that the number of soybean root nodules is difficult to control.

The invention provides a rhizobia (Sinorhizobium fredii) HH103 double-gene mutant, which is obtained by taking rhizobia as a starting strain and carrying out mutation or silencing on nopT genes and nopP genes in the starting strain.

Further defined, the sequence of the NopT gene is shown as SEQ ID No. 1.

Further defined, the sequence of the NopP gene is shown in SEQ ID No. 2.

Further defined, the method of obtaining the double gene mutant: the NopT gene and the NopP gene are connected with a pJQ200SK vector to obtain a recombinant vector, and then the recombinant vector is introduced into rhizobium HH103 to obtain a double-gene mutant of the rhizobium HH 103.

The present invention provides an agent for reducing the number of soybean rhizomes, the active ingredient of which is the double gene mutant of rhizobium HH103 according to any one of claims 1 to 3.

Further defined, the agent of claim 5 is inoculated with soybean seedlings or wild-type soybean seedlings overexpressing the GmPBS1 gene.

The invention provides a method for reducing soybean root nodule, which comprises the steps of growing soybean seedlings or soybean seedlings over-expressing GmPBS1 gene to a true leaf stage, applying a bacterial solution containing the double-gene mutant to the soybean seedlings, wherein the bacterial grafting quantity is more than 2 multiplied by 10 ⁵ And (3) cultivating soybeans after inoculating the bacterial liquid for 30-40 days.

Further defined, the bacterial liquid is characterized by being prepared according to the following method:

(1) The double-gene mutant is cultivated and activated, and OD is controlled ₆₀₀ 0.65-0.86;

(2) Centrifuging the bacterial liquid obtained in the step (1), collecting bacterial cells, washing, and re-suspending the bacterial cells with a magnesium sulfate solution to obtain bacterial liquid OD ₆₀₀ Reaching 0.2.

The invention provides application of the reagent in reducing the number of soybean root nodules, and the soybean variety suitable for the reagent is seiner 14 or wild soybean ZYD00006.

The invention provides application of the double-gene mutant or the method in soybean breeding.

The beneficial effects are that: the invention constructs rhizobia HH103 omega NopT & NopP mutant by three-parent hybridization, and excavates III type effector NopT and NopP interaction genes. Successful construction of HH103 Ω NopT & NopP mutants was verified by PCR identification, southern identification, and nodulation identification was performed using SN14, ZYD00006 to observe nodulation phenotype differences. Successful construction of rhizobia HH103 Ω NopT & NopP mutants, resulted in the finding that vaccination with rhizobia HH103 Ω NopT & NopP resulted in a significant reduction in the number of nodules. The overexpression of GmPBS1 hairy root nodulation data further verifies the effect of effector on nodulation.

Drawings

FIG. 1 is a mutant screening process.

FIG. 2 is a graph of PCR identification results of mutant HH103 Ω NopT & NopP, wherein M: trans 2K Plus DNA marker:1: HH103 (NopP-LF-F/R) 2 HH 103. OMEGA. NopT & NopP (NopP-LF-F/R) 3 HH103 (NopT-LF-F/R) 4: HH103 Ω NopT & NopP (NopT-LF-F/R) 5:HH103 Ω NopT & NopP (NopP-F/R) 6:HH103 Ω NopT & NopP (NopT-F/R) Note M: trans 2K Plus DNA marker:1: HH103 (NopP-LF-F/R)

2:HH103ΩNopT&NopP(NopP-LF-F/R)3:HH103(NopT-LF-F/R)4：HH103Ω NopT&NopP(NopT-LF-F/R)5:HH103ΩNopT&NopP(NopP-F/R)6:HH103ΩNopT&NopP (NopT-F/R)。

FIG. 3 is a graph of Southern identification of HH 103. OMEGA. NopT & NopP wherein M: DL10000 DNA Ladder 1: HH103 genome (Xho i) 2: HH103 Ω NopT & NopP genome (Xho i) 3: HH103 genome (saci) 4: HH 103. OMEGA. NopT & NopP genome (SacI)

Note: M: DL10000 DNA Ladder 1: HH103 genome (Xho i) 2: HH103 Ω NopT & NopP genome (Xho i) 3: HH103 genome (saci) 4: HH 103. OMEGA. NopT & NopP genome (SacI)

FIG. 4 is a graph showing the results of the number of nodules and dry weight of SN14 inoculated with different mutants, wherein A: SN14 inoculated with a hairy root phenotype pattern of HH103 and mutants HH103 Ω NopT, HH103 Ω NopP, HH103 Ω NopT & NopP, HH103 Ω TtSI mutants, scale bar 1cm. B: the box plot of nodule number and dry weight nodule phenotype was analyzed for significance using Student's t test, where "×" represents P <0.001 and "×" represents P <0.01. n=20.

FIG. 5 is a graph showing the results of the number of nodules and dry weight of various mutants inoculated with ZYD00006, wherein A: ZYD00006 was inoculated with a hairy root phenotype pattern of HH103 and mutants HH 103. OMEGA. NopT, HH 103. OMEGA. NopP, HH 103. OMEGA. NopT & NopP, HH 103. OMEGA. TtSI mutant, scale bar 1cm. B: the box plot of nodule number and dry weight nodule phenotype was analyzed for significance using Student's t test, where "×" represents P <0.001 and "×" represents P <0.01. n=20.

FIG. 6 is a graph of Fu28-GmPBS1 vector construction results, wherein M: DNA Marker 2K Plus II; 1-3: fu28-GmPBS1.

FIG. 7 is a graph showing the construction result of pSOY10-35S: gmPBS1: GFP vector, wherein M: DNA Marker 2K Plus II; 1-3: pSOY10-35S: gmPBS1: GFP.

FIG. 8 shows pSOY10-35S: gmPBS1: GFP hairy root transformed plants.

FIG. 9 is a phenotypic statistic of pSOY10-35S: gmPBS1: GFP hairy root transformed plants, wherein: a: pSOY10-35S GmPBS1 GFP and empty vector were inoculated with HH103 and mutants HH 103. OMEGA. NopT, HH 103. OMEGA. NopP, and hairline root phenotypes of HH 103. OMEGA. NopT & NopP mutants, respectively, EV representing pSoY10 empty vector, scale 1cm. B: the hairy root transformation and overexpression of the box plot of the root nodule phenotype of pSOY10-35s: gmpbs1: gfp was performed using Student's t test for significance analysis, where "×" represents P <0.001 and "×" represents P <0.01. n=20.

FIG. 10 is a vector diagram of pSoy10 empty vector.

FIG. 11 is a vector diagram of Fu28 empty vector.

Detailed Description

pEASY-T1 vectors, helper (Km) vectors, pFAJ1702 (Tet) vectors and pGWC vectors are all commercially available.

pJQ200SK vector (Gm) is described in Quandt, J., & Hynes, M.F. (1993) Versatile suicide vectors which allow direct selection for gene replacement in Gram-negative bacteria. Gene,127 (1), 15-21.Doi:10.1016/0378-1119 (93) 90611-6.

The whole genome introgression line population (Chromosome Segments Substitution Lines, CSSL) is described in article Chen Qingshan, "construction and use of crop backcross introgression lines".

Recombinant inbred line populations (Recombinant Inbred Lines, RIL) are described in [1] Wang Honglin. Construction of soybean recombinant inbred line populations, identification, and studies of major agronomic trait QTL localization [ D ]. Nanjing university of agriculture, 2001.

SN14, wild beans ZYD00006 Suilong 14, charleston, dongnong 594, he 00-23, hongfeng 11, suil02-339, viola No.2, nattosan, heinong 44, heinong 35 and North Feng 11 are all common varieties in Heilongjiang, from the major laboratory of the university of northeast agricultural soybean biology education department.

Sinorhizobium freundii HH103 (from Francisco Javier L vopez-Baena laboratories, university of Sambura Severe, described in Weidner S, becker A, bonilla I, et al genome Sequence of the Soybean Symbiont Sinorhizobium fredii HH [ J ]. Journal of Bacteriology,2012,194 (6): 1617.)

2×ty liquid medium: 16g of tryptone (barrel-tryptone), 10g of yeast extract (barrel-yeast extract), 5g of NaCl, 1000mL of water, pH7.2 and sterilizing at 121 ℃ for 30min.

Fu series vectors include Fu28, which was given away by the Fu Yongfu institute (national academy of agricultural sciences crop science institute); the plant expression vector pSoy10 was given away by Fu Yongfu researchers (institute of crop science, national academy of agricultural sciences).

pSOY1 (spec) Fu series vectors include Fu28, a benefit of the Fu Yongfu institute (national academy of agricultural sciences crop science); the plant expression vector pSoy10 was given away by Fu Yongfu researchers (institute of crop science, national academy of agricultural sciences).

The following are available in the paper Lu M, cheng Z, zhang X M, et al spatial Divergence of PHR-PHT1 Modules Maintains Phosphorus Homeostasis in Soybean Nodules [ J ]]Plant Physiology 2020 article numbers correspond in the literature references. The carrier skeleton records the website:TAIR-Home Page(arabidopsis.org)。

this is used in all documents in which Fu vectors are designed as described in the BioVector, a flexible system for gene specific-expression in plants article. The paper is described in detail. FIG. 10 is a vector diagram of pSoy10 empty vector. FIG. 11 is a vector diagram of Fu28 empty vector.

Example 1 construction of mutant HH 103. Omega. NopT & NopP of Rhizobium HH103

NopC coding sequence: atgg tcggagtgat tggaagtgga gttggctcca tcggcgtttc cctggcccgc aaaggggggc atggacattc gactggacag ccgccgcgcg attcaggcgg gccctctggt cacaacaggc cggatcgcgg gagcggcgtt acggatggcc cgaccatttc tggggatcgc tcgcaggctg caattcaaag cgaagccttc gaactagctc ttcgatcggt tgcgctgcaa cttatgaacg atgccatggc tgatgccgac gaagctatgg cagaaactga agaggatgcc tga (SEQ ID NO. 1).

NopP coding sequence: atg tacggtcgaa ttgatagctc gtccgatttc cactacacgcagagtgccag caagcaaacg gatgcagaaa cccaagagtt cgcggacacg tttgcccgaa tgcacttaga cagatcggat tccaacggcg gttcatccag atataccctc gatcacgaacctccggtcgt gccgattgat ctgaagaggt tcaggaggga gatcaggaaa tttcgtggcaaagaaatcac tgacatcgcc gacaatccac aggaatattc agacttcgtg tccgcaaaag ccagacgcac tgcggacgtt gctcagcaat acggcattcg tcgggattct gagaacgctcgatatttcag ttaccagttg ggaaaccagt gtgttggact gatgagaacg gaaggtgggt tcagcatgga agaagagttc gaatccaaaa gttggagaga ccaatttcct ggtcaccaag agattacctc caccgtggat cttcaagtcg cccatcctct cgttgagaat gcaggcgatattctgctcga gtaccaactt cggagggacg gcgaacgacc gttgctgaac tggcgcgcggaaaacccaga ggcgaaagcc cgtgcagcga tgatggggtt tgttgaagtg gatgattgcg acatggtcct tgaccccaaa cagcatcccg acaaatggac gcagaccagt gccgctgaat ggcggcgtaa agacaaaccg ccgctctatc tctgcaaatt tgaggatgct gaaaccgcacagtgttcaac cagctgctct tacgagactt acgaagatga cttcatgtga (SEQ ID NO. 2)

1. Sinorhizobium freudenreichii HH103 Ω NopP (Identification of Soybean Genes Whose Expression is Affected by the Ensifer fredii HH103 Effector Protein NopP. [ J ]. International journal of molecular sciences, 2018.) (pJQ 200SK-NopT2000, pJQ-NopT2000 Ω (pJQ SK-NopT-Spec) (Mapping of Quantitative Trait Loci Underlying Nodule Traits in Soybean (Glycine max (L.)) Merr.) and Identification of Genes Whose Expression Is Affected by the Sinorhizobium fredii HH103 Effector Proteins NopL and NopT) pJQ SK-NopT is pJQ-NopT2000 Ω, pJQ-NopT2000 Ω is a Spec-resistant coding sequence inserted downstream of the NopT initiation codon of pJQ-NopT2000, resulting in mutation of the coding sequence of the NopT.

(1) Rhizobia HH 103. OMEGA. NopP, E.coli Helper and the constructed pJQ200SK-NopT-Spec were plated on corresponding medium TY solid medium, LB solid medium containing rifampin Rif (50 mg/L) resistance, kanamycin Km (50 mg/L) resistance and spectinomycin Spec/gentamycin Gent (50 mg/L) resistance, respectively. Culturing overnight in an incubator until the monoclonal grows out;

(2) Selecting the monoclonal of the three bacteria, culturing in 1.5mL centrifuge tube containing corresponding antibiotics and liquid culture medium under shaking overnight, transferring to 50mL centrifuge tube after overnight culturing, adding corresponding resistant culture medium, and culturing to OD ₆₀₀ After 0.6 to 0.8, the bacterial liquid is centrifuged at 12,000rpm for 30 seconds, the supernatant is discarded, and 1mL of non-antibiotic TY liquid culture medium is added into the bacterial mass for resuspension;

(3) Mixing the resuspended HH103 omega NopP bacterial liquid, the helper bacterial liquid and the pJQ-NopT2000 omega bacterial liquid in a 1.5mL centrifuge tube according to the ratio of 2:1:1 respectively, centrifuging at 12,000rpm for 30s after mixing, discarding the supernatant, and adding 20 mu L of non-antibiotic TY liquid culture medium into bacterial blocks for resuspension;

(4) Vertically dripping the resuspended 20 mu L mixed solution onto a non-anti TY solid culture medium plate, and culturing for 36h in a 28 ℃ incubator;

(5) The growing plaque was plated on TY solid medium containing Rif/Spec/Km resistance until the monoclonal grew again, and the process was repeated 3 times;

(6) The third grown monoclonal was streaked on TY solid medium containing Rif/Spec/Km antibiotic and 5% sucrose (FIG. 1), and the procedure was repeated 3 times;

(7) The final selection determined mutants were named HH 103. OMEGA. NopT & NopP.

HH101Ω NopT & NopP mutant identification: extraction of HH 103. OMEGA. NopT & NopP and wild-type HH103 genomes the whole genome of Rhizobium HH103 was extracted according to the TIANGEN company bacterial whole genome extraction kit (DP 302) instructions. HH103 genome and HH 103. OMEGA. NopT & NopP genome were amplified with primers NopT-LF-F/R, nopP-LF-F/R, respectively, and HH 103. OMEGA. NopT & NopP genome was amplified with primers NopP-F/R, nopT-F/R, respectively, and the method of amplifying the desired fragment was as follows.

The PCR amplification system is shown in Table 1:

TABLE 1

The reaction conditions are shown in table 2:

TABLE 2

The PCR amplified products were identified by 2% agarose gel electrophoresis.

Construction of HH101Ω NopT & NopP mutant

By means of three-parent hybridization, the mixed bacterial liquid is resuspended and then is dripped into the non-anti TY solid culture medium for concentrated culture for 36h, the large spots growing after the culture are uniformly coated on a TY solid culture medium of Rif/Spec/Km (100 mg/mL), after 5-7d of culture, monoclonal is selected and streaked on the TY solid culture medium containing Rif/Spec/Km (100 mg/mL) and 5% sucrose, and the culture is repeated for 3 times (as shown in figure 1). The strains after selection were individually picked in liquid TY medium resistant to Rif/Spec/Km (100 mg/mL) and Rif/Spec/Km/Gent (100 mg/mL) and incubated for 24h at 28 ℃. The cloudy strain was selected for subsequent PCR and Southern identification, and the selected mutant was designated HH 103. OMEGA. NopT & NopP.

HH103 Ω NopT & NopP mutant validation: HH103 genome and HH 103. OMEGA. NopT & NopP genome were amplified with primers NopP-LF-F/R, nopT-LF-F/R, respectively, and HH 103. OMEGA. NopT & NopP genome was amplified with primers NopP-F/R, nopT-F/R, and the PCR detection results are shown in FIG. 2. When the NopP-LF-F/R is used for PCR amplification, the size of the target fragment of the mutant is about 800bp longer than that of the wild-type target fragment, when the NopT-LF-F/R is used for PCR amplification, the size of the target fragment of the mutant is about 500bp longer than that of the wild-type target fragment, no strip appears when the primer NopP-F/R, nopT-F/R is used for amplification, and the sizes of the target fragments all meet the expected sizes, thus proving that the mutant is successfully constructed.

NopP-LF-F/R：F：GCTCTAGACTTCAGATATGTTTCGCGAGG(SEQ ID NO.3)； R：AACTGCAGAACACCGAATGGGTATCGCTC(SEQ ID NO.4)。

NopT-LF-F/R：NopT-LF-F：CATCTTCATCGGCATCATTGG(SEQ ID NO.5)；

NopT-LF-R：AAGCTTGATTTCCAGCCGATC(SEQ ID NO.6)。

NopP-F/R：nopP F：CTTCAGATATGTTTCGCGAGG(SEQ ID NO.7)；nopP R： AACACCGAATGGGTATCGCTC(SEQ ID NO.8)；

NopT-F/R：F：GTGCTGCGTGATCCGAAC(SEQ ID NO.9)；R：TCACCGTTGTAAAATGCTG (SEQ ID NO.10)。

Southern identification

Southern drug formulation:

(1) Apurinic solution 0.25M HCl (500 mL): 10.80mL of concentrated hydrochloric acid was added to 400mL of deionized water, and the volume was set to 500mL.

(2) Denatured liquid (0.5M NaOH,1.5M NaCl) (1L): 800mL of deionized water was added to the beaker, 87.7g of NaCl and 20g of NaOH were measured, and after sufficient stirring and dissolution, the volume was set to 1L.

(3) Neutralization solution (1.0M Tris-HCl, pH 7.5,1.5M NaCl) (1L): 121.1g of Tris Base, 87.75 g of NaCl and 60-70 mL of concentrated hydrochloric acid are measured and dissolved in 800mL of deionized water, the pH value is regulated to 7.5, and the volume is fixed to 1L.

(4) Transfer blotting solution 20 XSSC (3M NaCl,0.3M sodium citrate, pH 7.0) (1L): 175.3g NaCl, 88.2g sodium citrate 2H are measured out ₂ O is fully stirred and dissolved in 800mL of deionized water, 14N HCl is added dropwise to adjust the pH value to 7.0, and the volume is fixed to 1L.

(5) 2 Xwash (2 XSSC, 0.1% (W/V) SDS) (1L): 1g of SDS was measured, 100mL of 20 XSSC was dissolved in 800mL of deionized water by heating at 68℃and the pH was adjusted to 7.2 by dropwise addition of 14N HCl to a volume of 1L.

(6) 0.5 Xwash (0.5 XSSC, 0.1% (W/V) SDS) (1L): 1g of SDS, 25mL of 20 XSSC are weighed into 800mL of deionized water, heated to be dissolved at 68 ℃, 14N HCl is added dropwise to adjust the pH value to 7.2, and the volume is fixed to 1L.

(7) Maleic acid buffer (0.1M maleic acid, 0.15M NaCl,NaOH to pH 7.5) (1L): 8.77g NaCl and 11.607g maleic acid are weighed and dissolved in 800mL deionized water with sufficient stirring, the pH value is adjusted to 7.5 by NaOH, and the volume is fixed to 1L.

(8) Wash buffer (0.1M maleic acid, 0.15M NaCl (20 ℃ C.), pH 7.5,0.3% (V/V) Tween-20) (1L): 3mL of Tween-20 was measured and dissolved in 1L of maleic acid buffer.

(9) Detection Buffer (0.1M Tris-HCl,0.1M NaCl,pH 9.5) (1L): 12.11g Tris and 5.85g NaCl are weighed and dissolved in 800mL deionized water with sufficient stirring, the pH value is adjusted to 9.5 by NaOH, and the volume is fixed to 1L.

(10) 1X Blocking solution: 10X Blocking solution (visual 6) was diluted 10-fold with maleic acid buffer (as-prepared).

(11) Antibody solution: prior to each use, anti-Digoxigenin-AP (via 4) was centrifuged at 10000rpm for 5min, the required dose was carefully aspirated from the surface, and Anti-Digoxigenin-AP was diluted 1X Blocking solution at 1:10000 (75 mμ). Can be stably stored at 2-8deg.C for 12 hr.

(12) 10 XTBE Buffer (500 mL): 54g Tris Base, 3.72g Na ₂ EDTA·2H ₂ O and 27.5g boric acid are fully stirred and dissolved in 400mL deionized water, and the volume is fixed to 500mL.

(13) Salmon DNA (10 mg/mL) (100 mL): weighing 2g of salmon sperm DNA in a 500mL beaker, and adding 200mLTE Buffer; stirring for 2-4h at room temperature by a magnetic stirrer, and adding 4mL of 5M NaCl after dissolution; extracting with phenol and phenol/chloroform 1 time each; after recovering the aqueous solution, the solution was rapidly aspirated about 20 times with a 17 gauge needle to cut off the DNA; adding twice the volume of precooled ethanol for ethanol precipitation; after recovering DNA by centrifugation, the DNA was dissolved in 100mL of water, and the OD of the solution was measured ₂₆₀ A value; diluting the DNA solution to 10mg/mL, boiling for 10min, packaging and storing the small parts at-20deg.C; boiling in boiling water for 5min before use, and cooling in ice bath.

Southern procedures were as follows:

(1) The genomes of wild type HH103, mutant HH 103. OMEGA. NopT & NopP were extracted.

(2) Labeling probes:

the probe primer is designed to contain target gene and inserted resistant fragment 400-600 bp, the mutant genome is amplified, the fragment is recovered by glue, 1 mug template DNA is taken in a centrifuge tube, sterilized water is filled to 16 mug, boiling water is used for 10min, and the probe primer is quickly inserted into ice. Mixing DIG-High Prime (visual 1), taking 4 mu L of denatured DNA, mixing, and slightly centrifuging at 37deg.C

The reaction was stopped overnight in a 65℃water bath and kept at-20℃until use.

(3) The genome was digested and the system (50. Mu.l) was as shown in Table 3:

TABLE 3 Table 3

The digested sample was spotted on 2.0% (W/V) agarose gel for electrophoresis, and to ensure uniform dispersion of DNA in the wells, the sample was slowly added to the wells. While it should be jogged at low voltage, such as around 50V, until bromophenol blue reaches 3/4 of the gel.

(4) After the electrophoresis, the gel was subjected to alkali denaturation by treating it with the following reagents in order, and the gel was covered with the solution by gentle shaking at room temperature.

(5) Simultaneously with the alkaline denaturation of the gel, a transfer printing device was prepared. In the transfer well, a 20 XSSC solution is poured, a solid support is placed in the well, and the solid support is placed in sequence from bottom to top: two pieces of filter paper with the same width as the gel, the filter paper is vertically hung in a transfer trace groove from the solid support, the gel is arranged on the bottom surface, the filter film (the same size as the gel) is arranged on the filter film (the same size as the gel), the filter paper (the same size as the gel) is arranged on the filter paper, the water absorbing paper (the height of the filter paper is slightly smaller than that of the filter paper and is 5-8 cm), and the weight is 400-800 g. The gel was surrounded by a Parafilm to prevent shorting. The filters were labeled in advance, soaked with 2 XSSC for at least 5min, the filters were soaked in 20 XSSC in advance, and the membranes were spun for 10-18h. Note that: air bubbles between each layer of filter paper and the membrane in the membrane transferring device are removed. Once the transfer system is established, the filter membrane and gel are prevented from dislocating. Prevent the absorbent paper from collapsing and completely wetting out, and replace the absorbent paper after 10 hours.

(6) After the transfer, the filter was removed, shaken for 5min in 2 XSSC, and blotted with filter paper.

(7) Irradiation with UV cross-linking was performed for 4min on both sides (Energy 1200).

(8) The membrane may be immediately prehybridized and hybridized, or stored at 4℃for later use.

Prehybridization: a volume of digoxin prehybridization solution (DIG Easy Hyb) (10 mL/100 cm) was preheated (37 ℃ C.) ² Membrane), placing the hybridization membrane into hybridization solution at 37 ℃ for 1-2h;

denaturation probe: the denatured DNA probe was immersed in boiling water for 5min, rapidly inserted into ice, and the probe was added to the hybridization solution (3.5 ml/100 cm) ² membrane), and is uniformly mixed without bubbles.

Hybridization: pouring out the prehybridization solution, adding the hybridization solution into a hybridization bottle, and putting into a hybridization furnace. Hybridization was carried out overnight at 42℃at 15-20 rpm.

(9) The membrane washing treatment process after hybridization is as follows:

the Detection buffer was removed, the membrane was taken out, put into a mixed solution containing 200. Mu.L of solution No. 5 and 10mL Detection buffer, and shielded from light for 30 minutes to observe whether hybridization signals were present on the membrane.

To verify the successful construction of mutant HH 103. OMEGA. NopT & NopP at the genomic level, southern identification was performed. Mutant HH 103. OMEGA. NopT & NopP was used as the experimental group, and wild-type rhizobium HH103 was used as a control, and single restriction of the genome was performed with XhoI and SacI, respectively. As shown in FIG. 3, the result of Southern hybridization shows that the hybridization fragment of the mutant after digestion is about 1200bp larger than that of the wild-type hybridization fragment, thus proving that the mutant is constructed successfully.

Identification of the nodulation Capacity of HH101Ω NopT & NopP mutant

(1) Strains: rhizobia HH103, HH103 Ω NopT, HH103 Ω NopP, HH103 Ω NopT & NopP, HH103 Ω TtSI.

About 200 seeds of soybean variety needed by the experiment are taken, and the surface of the soybean seeds is sterilized by adopting a chlorine sterilization method for 12-16 hours. After chlorine on the surface of seeds is blown off in the ultra-clean bench, seeds with perfect shapes and sizes are planted in the sterilized double-layer pot in the ultra-clean bench. Removing the cover when the seedlings are jacked to the double-layer pot cover, covering the surface of vermiculite with sterilized small stones to prevent the roots of the plants from contacting fungi in the air, and placing the plants in an artificial climate chamber for cultivation.

The required strain is streaked on TY solid plates of the corresponding antibiotics, cultured for 2-3 days at 28 ℃, and then the monoclonal is picked up and cultured in a 1.5ml centrifuge tube overnight. 200 mu L of bacterial liquid is taken in 30mL of TY liquid culture medium and is continuously cultured until OD ₆₀₀ The value is 0.6-0.8. Centrifuging at 4000rpm for 10min, discarding supernatant, sterilizing with 10mM MgSO ₄ The pellet was resuspended 3 times. Finally using 10mM MgSO ₄ Resuspension of the cells to OD of the bacterial solution ₆₀₀ The value was 0.2, used to inoculate soybeans.

Inoculating 2mL OD at 1-2cm position of soybean root with syringe when three compound leaves of soybean seedling are fully unfolded ₆₀₀ Bacterial liquid with a value of 0.2, and each bacterial strain is inoculated with 25 soybean seedlings of each variety. The number and dry weight of nodules were investigated 28d after inoculation.

Results: rhizobia HH103, mutant HH 103. OMEGA. NopT, HH 103. OMEGA. NopP, HH 103. OMEGA. NopT & NopP, HH 103. OMEGA. TtsI were inoculated to Suilong 14, and wild bean ZYD00006 was identified as a nodulation phenotype. The number of tumors and the dry weight of the tumors were examined at 30d after inoculation, and the results of the examination are shown in fig. 4 and 5. The results, in which mutant HH103 Ω NopT was inoculated to reduce the number of nodules and mutant HH103 Ω NopT was inoculated to increase the number of nodules, mutant HH103 Ω NopT & NopP significantly reduced both in seinon 14 and wild bean ZYD00006 both in terms of nodule number and nodule dry weight, compared to wild-type rhizobium HH103, demonstrate that type iii effector NopT plays a promoting role in nodules and NopP plays an inhibiting role in nodules, but that the presence of interactions between type iii effector NopT and NopP results in a dramatic decrease in nodule number in the absence of both effectors. The differences in nodulation phenotype of different rhizobia and mutants in different soybean varieties also reflect the affinities of different type iii effectors for soybeans, and may also include differences in genotypes of the major interaction genes of different type iii effectors in different soybean varieties.

EXAMPLE 2 agent for reducing the number of Soy nodules

The components of the reagent: mutant bacterial liquid.

The using method comprises the following steps: (1) Culturing and activating rhizobia HH103 omega NopT & NopP mutant, and controlling OD600 to be 0.65-0.86;

(2) Centrifuging the bacterial liquid obtained in the step (1) at 4000rpm for 10min, and re-suspending and washing the bacterial liquid with 10mM magnesium sulfate solution for 4 times; bacterial liquid OD after resuspension of magnesium sulfate solution ₆₀₀ ＝0.2；

(3) The soybean seedling grows to a true leaf stage, and is inoculated with the soybean seedling, wherein the inoculation quantity is more than 2 multiplied by 10 ⁵ And (3) cultivating soybeans after inoculating the bacterial liquid for 30-40 days.

The rhizobia used by soybean varieties with excessive nodulation quantity is mutated, the nodulation quantity is reduced, the energy consumed by symbiotic nitrogen fixation is reduced, and the soybean yield is ensured. The nodulation number of the inoculated rhizobia on the soybeans is regulated by the mutant, so that the nodulation number is ensured to be in a reasonable range.

Rhizobia HH103 Ω NopT & NopP mutants to investigate the effect of type iii effectors NopT and NopP on soybean nodulation. After successful construction of the rhizobia HH103 Ω NopT & NopP mutant we performed a nodulation assay on it, and after statistical data we found that inoculation of the mutant HH103 Ω NopT significantly reduced the number of nodulation compared to the wild-type rhizobia HH 103.

Example 3A method of reducing the number of Soy nodules

1. Construction of GmPBS1 overexpressed soybean:

the target gene GmPBS1 (genes described in Asaf K, wadood S F, min C, et al Effector-triggered inhibition of nodulation: a rhizobial effector protease targets soybean kinase GmPBS1-1[ J ]. Plant Physiology, 2022.) was first amplified in soybean using PBS1-F and PBS1-F, and the entry vector Fu28 and the cloned target gene fragment were ligated by digestion with EcoR V and KpnI, respectively, and the ligated vector was designated Fu28-GmPBS1 as shown in FIG. 6. Then ligated into pSOY10 vector by LR reaction followed by GFP gene following GmPBS1 gene, resulting in FIG. 7, the ligated vector was named pSOY10-35S: gmPBS1:GFP. pSOY10-35S: gmPBS1: GFP vector was transferred into K599 Agrobacterium rhizogenes to complete hairy root transformation experiments.

Effect of GmPBS1 overexpression on nodulation

(1) Strains: rhizobia HH103, HH103 Ω NopT, HH103 Ω NopP, HH103 Ω NopT & NopP, HH103 Ω TtSI

(2) Plant material: DN50.

3. To investigate how GmPBS1 affects the soybean nodulation process and how it responds to type iii effector NopT, we constructed here GmPBS1 overexpressing soybean plants by inoculating rhizobia with different HH103 and HH103 Ω NopT, HH103 Ω NopP, HH103 Ω NopT & NopP mutants to determine its effect on soybean nodulation and how to respond to type iii effector.

After transferring pSOY10-35S: gmPBS1: GFP hairy root transformed plants into vermiculite and culturing for 3d, rhizobia HH103, HH103 omega NopT, HH103 omega NopP, HH103 omega NopT & NopP are respectively inoculated, and after inoculation, culturing is carried out for 24d for carrying out nodulation phenotype investigation. As shown in FIG. 8, non-transgenic root hairs and chimeras were knocked out for microscopic pictures of pSOY10-35S: gmPBS1: GFP hairy root transformed plants to observe the nodulation phenotype.

After all non-positive roots and chimeras were removed, the number of nodules was counted as shown in FIG. 9. By statistics we found that there was no significant change in the number of HH103 nodules inoculated into pSOY10-35s: gmpbs1:gfp over-expressed plants compared to EV, but a significant decrease in the number of HH103 Ω NopP nodules compared to HH103 Ω NopT nodules, while the number of transgenic plants inoculated with HH103 Ω NopT & NopP nodules was also slightly decreased compared to HH103 Ω NopT. PBS1 in plants in the absence of NopT cannot be hydrolyzed by NopT, thus enhancing the immune response leading to reduced nodulation.

SEQUENCE LISTING

<110> northeast agricultural university

<120> double-gene mutant of rhizobia and application thereof

<160> 10

<170> PatentIn version 3.5

<210> 1

<211> 297

<212> DNA

<213> Synthesis

<400> 1

atggtcggag tgattggaag tggagttggc tccatcggcg tttccctggc ccgcaaaggg 60

gggcatggac attcgactgg acagccgccg cgcgattcag gcgggccctc tggtcacaac 120

aggccggatc gcgggagcgg cgttacggat ggcccgacca tttctgggga tcgctcgcag 180

gctgcaattc aaagcgaagc cttcgaacta gctcttcgat cggttgcgct gcaacttatg 240

aacgatgcca tggctgatgc cgacgaagct atggcagaaa ctgaagagga tgcctga 297

<210> 2

<211> 813

<212> DNA

<213> Synthesis

<400> 2

atgtacggtc gaattgatag ctcgtccgat ttccactaca cgcagagtgc cagcaagcaa 60

acggatgcag aaacccaaga gttcgcggac acgtttgccc gaatgcactt agacagatcg 120

gattccaacg gcggttcatc cagatatacc ctcgatcacg aacctccggt cgtgccgatt 180

gatctgaaga ggttcaggag ggagatcagg aaatttcgtg gcaaagaaat cactgacatc 240

gccgacaatc cacaggaata ttcagacttc gtgtccgcaa aagccagacg cactgcggac 300

gttgctcagc aatacggcat tcgtcgggat tctgagaacg ctcgatattt cagttaccag 360

ttgggaaacc agtgtgttgg actgatgaga acggaaggtg ggttcagcat ggaagaagag 420

ttcgaatcca aaagttggag agaccaattt cctggtcacc aagagattac ctccaccgtg 480

gatcttcaag tcgcccatcc tctcgttgag aatgcaggcg atattctgct cgagtaccaa 540

cttcggaggg acggcgaacg accgttgctg aactggcgcg cggaaaaccc agaggcgaaa 600

gcccgtgcag cgatgatggg gtttgttgaa gtggatgatt gcgacatggt ccttgacccc 660

aaacagcatc ccgacaaatg gacgcagacc agtgccgctg aatggcggcg taaagacaaa 720

ccgccgctct atctctgcaa atttgaggat gctgaaaccg cacagtgttc aaccagctgc 780

tcttacgaga cttacgaaga tgacttcatg tga 813

<210> 3

<211> 29

<212> DNA

<213> Synthesis

<400> 3

gctctagact tcagatatgt ttcgcgagg 29

<210> 4

<211> 29

<212> DNA

<213> Synthesis

<400> 4

aactgcagaa caccgaatgg gtatcgctc 29

<210> 5

<211> 21

<212> DNA

<213> Synthesis

<400> 5

catcttcatc ggcatcattg g 21

<210> 6

<211> 21

<212> DNA

<213> Synthesis

<400> 6

aagcttgatt tccagccgat c 21

<210> 7

<211> 21

<212> DNA

<213> Synthesis

<400> 7

cttcagatat gtttcgcgag g 21

<210> 8

<211> 21

<212> DNA

<213> Synthesis

<400> 8

aacaccgaat gggtatcgct c 21

<210> 9

<211> 18

<212> DNA

<213> Synthesis

<400> 9

gtgctgcgtg atccgaac 18

<210> 10

<211> 19

<212> DNA

<213> Synthesis

<400> 10

tcaccgttgt aaaatgctg 19

Claims (5)

1. A double-gene mutant of rhizobia (Sinorhizobium fredii) HH103, which is obtained by taking rhizobia as a starting strain and carrying out mutation or silencing on NopT genes and nopP genes in the starting strain; the sequence of the NopP gene is shown as SEQ ID NO. 2; the NopT gene has the accession number Glyma03g06640.

2. An agent for reducing the number of soybean nodules, wherein the active ingredient of the agent is the double gene mutant of rhizobium HH103 according to claim 1.

3. The agent of claim 2, wherein the agent of claim 2 is inoculated with soybean seedlings or wild-type soybean seedlings overexpressing the GmPBS1 gene.

4. A method for reducing soybean nodule, characterized in that, in the growth of soybean seedling or soybean seedling over-expressing GmPBS1 gene to the true leaf stage, applying the bacterial liquid containing the double gene mutant of claim 1 to soybean seedling, the inoculation quantity is more than 2×10 ⁵ The soybean variety suitable for the method is seiulus 14 or wild soybean ZYD00006 after cultivating soybean inoculated with bacterial liquid for 30-40 days.

5. The method according to claim 4, wherein the bacterial liquid is prepared by the following method:

(1) Activating the double-gene mutant according to claim 1, controlling the OD600 to be 0.65-0.86;

(2) Centrifuging the bacterial liquid obtained in the step (1), collecting bacterial cells, washing, and re-suspending the bacterial cells with a magnesium sulfate solution to enable the OD600 of the bacterial liquid to reach 0.2, wherein the soybean variety suitable for the method is seismoid 14 or wild soybean ZYD00006.