CN116789786B - Rice Xa48 (t) protein and application of coding gene thereof - Google Patents

Abstract

The application belongs to the technical field of molecular biology, and particularly relates to application of a rice Xa48 (t) protein and a coding gene thereof, wherein the amino acid sequence of the rice Xa48 (t) protein is shown as SEQ ID NO.1, the application comprises enhancing the resistance of rice to bacterial blight, enhancing the resistance of rice to rice blast or breeding rice disease resistance, and the RNAi interference technology, the gene knockout technology and the gene overexpression technology implemented by the application treat target plants and select HNY as the backgroundXa48(T) Gene, knockout plant T ₃ Generation, RNAi interference plant T ₃ Substituted and against Japanese sunXa48(T) Gene-overexpressing plant T ₃ The generation is a research object, and rice bacterial leaf blight inoculation investigation is carried out on the plants, and the result shows that the knockout and the interference genes are provedXa48After (t), the resistance of the rice plants to bacterial leaf blight is obviously reduced.

Description

Rice Xa48 (t) protein and application of coding gene thereof

Technical Field

The application belongs to the technical field of molecular biology, and in particular relates to riceXa48(t) use of the protein and the coding gene thereof.

Background

Gram-negative bacterium Monilinia flavescens rice varietyXanthomonas oryzaepv.Oryzae，Xoo) The length is about 0.7 to 2.0 [ mu ] m, the width is 0.4 to 0.7 [ mu ] m, and the optimal growth temperature is 25 to 30 ℃. Infection withXooThe disease type of the rice after the process is mainly divided into 3 types of leaf withering type, wilting type and wilting type, and the yield reduction of the rice at different degrees can be caused. In recent years, bacterial leaf blight of rice is highly developed in regions in the south of the Yangtze river, and also occurs in other provinces, and is considered to be one of the main agricultural diseases in China. Along withXooThe diseases show a tendency of reemission due to frequent disastrous weather caused by small continuous evolution variation, climate, global warming and the like, continuous change of domestic rice planting varieties and the like.

In agricultural production, chemical agent control, biological control, improved cultivation technology, cultivation of disease-resistant varieties and other methods are generally adopted for controlling bacterial leaf blight.

The chemical agent has the characteristics of quick response and wide control range for preventing and treating bacterial leaf blight, and rice bacterial leaf blight has the characteristics of popularity and multiple occurrence, and the long-term use of the chemical agent reduces the bearing capacity of soil environment and causes irreversible influence on the environment. The method for preventing and treating bacterial leaf blight by using the improved cultivation technology has higher requirement and longer time labor investment, and the labor cost for preventing and treating bacterial leaf blight by using the method is too high because the number of workers engaged in agricultural production in China is smaller.

Years of agricultural production practices show that the discovery of new genes for resisting bacterial leaf blight and the cultivation of disease-resistant germplasm with broad-spectrum resistance are the most reliable methods for preventing bacterial leaf blight, can be fundamentally achieved, and are characterized in thatXooAfter invasion, plants carrying disease-resistant genes can still grow normally, so that the yield of the rice is maintained at the original level basically. Up to now, the objective genes are polymerized and utilized mainly by conventional crossbreeding in agricultural production, and along with the updating of transgenic technology means, the gene editing breeding and transgenic breeding modes gradually provide new views for breeding disease-resistant varieties.

Yunnan rice seeds are rich in resources, and one of the Oryza Glutinosa (HNY) of the local indica rice seeds from Geng Ma county of Yunnan province is used as Yunnan plateau due to the characteristic of high bacterial leaf blight resistanceXooIs characterized by specific variety identification. Current research Yu Tengqiong et al uses HNY and other multiple identified varieties to collect 180 or more from regions in Yunnan, acquired in 2003, 2005, 2007, 2009XooThe strain pathotype identification, HNY shows medium to high resistance to all the reference strains, the local rice HNY can still keep the stability of the resistance of the strain in the near 10 years when facing to high-speed differentiation and Yunnan highland bacterial blight bacteria with rich pathogenic types and population types, which indicates that the strain has durable resistance to the carried resistance gene in the long-term growth and evolution process, has very high research value, and is particularly specific to the isolated resistance gene of the applicationXa48(t) there have been no reports on the correlation.

Disclosure of Invention

The main purpose of the application is to provide a riceXa48(t) protein and its coding gene, pairXa48(t) fine positioning and separation cloning of the gene, analyzing the related functions of the gene, and creating disease-resistant germplasm carrying the gene, enriching the rice disease-resistant gene resource library.

In order to achieve the above object, the present application provides the following technical solutions:

the application provides application of a rice Xa48 (t) protein, wherein the amino acid sequence of the rice Xa48 (t) protein is shown as SEQ ID NO.1, and the application comprises the steps of enhancing the resistance of rice to bacterial leaf blight, enhancing the resistance of rice to rice blast or breeding rice disease resistance.

The application further provides a gene for encoding the Xa48 (t) protein of rice, and the nucleotide sequence is shown as SEQ ID NO. 2.

Further, an amplification is providedXa48The primer pair of the (t) gene can be a primer pair shown as Xa48 (+) and Xa48 (-), or can be other primer pairs which can amplify the gene and are designed by the existing primer design software.

Xa48(+):acaacatggccaacccagaggattt Xa48(-):atacacagccgcagcccactctccc

Further, the above genes or primer pairs can be applied to: (1) identifying or assisting in identifying bacterial leaf blight resistance of rice; (2) Preparing a product for identifying or assisting in identifying rice bacterial leaf blight resistance; (3) Screening or breeding single plants or lines or varieties of rice with bacterial leaf blight resistance; (4) Screening or breeding single plants or strains or varieties of rice with bacterial leaf blight; (5) Preparing a product for screening or breeding single plants or lines or varieties of rice with bacterial leaf blight resistance; (6) And (3) preparing a product for screening or breeding single plants or lines or varieties of rice with bacterial leaf blight. It will be appreciated that bacterial blight resistance genes that have been isolated and cloned in the prior art are:Xa1、Xa2、Xa3 /Xa26、Xa4、xa5、Xa7、Xa10、xa13、Xa14、Xa21、Xa23、xa24(t)、xa25、Xa27、Xa31、xa41、Xa45、Xa47(t) etcThe application discloses a new disease-resistant geneXa48(t) can be used alone or in combination with these genes for identification, assisted identification, screening or breeding of rice with good traits, and specific methods of application can be referred to the methods of the prior art by those skilled in the art, in particular the applications related to bacterial leaf blight genes which have been found.

Further, the application of the rice disease-resistant breeding comprises any one of the following applications: (1) MAS breeding of bacterial leaf blight resistance genes, detecting genetic conditions of target genes in any offspring group through closely linked molecular markers, selecting offspring excellent germplasm with target genetic information, and improving breeding efficiency; single gene MAS breeding and multiple gene MAS breeding are common in agricultural production. Single gene MAS breeding is to introduce a single target gene into an excellent strain, such as Wu Hao, introduce Xa7 into variety "meib", identify offspring population by Xa7 specific markers, create new maintainer line material carrying bacterial blight resistance Xa7, and multi-gene MAS polymerization breeding is to polymerize 2 or more than 2 excellent genes according to the needs of agricultural production, thereby creating germplasm material with a plurality of excellent traits. For example: liu Wuge and the like are polymerized to form a plurality of rice blast resistance genes and bacterial leaf blight resistance genes, so that a plurality of sterile line excellent xenogenic substances with broad-spectrum resistance are cultivated, and the Xa48 (t) protein coding genes discovered by the application can be used for MAS breeding by adopting a method in the prior art;

(2) Transgenic breeding of bacterial leaf blight resistance genes; it will be appreciated that in a plant breeding history, researchers have found that homologous genes of a single gene in other varieties may play a unique role, thereby breaking cross-species and distant hybridization incompatibility problems using transgenic breeding techniques. For example Gao Lifen, etc. have been constructed using Agrobacterium-mediated transgenic techniquesXa21The gene system CX8621 has high resistance to bacterial leaf blight of rice; zhang Xiaogong and the like, broad-spectrum disease-resistant genes are introduced by using transgenic technologyXa23To target material, finally obtaining the carrying object through multi-generation inoculation identificationXa23And stably inherited transgenic lines, as a specific mode of application, the application can be used in the prior artBased on the operation, the application is used to findXa48And (t) carrying out transgenic breeding on the gene.

(3) The gene editing technology can change the original genome sequence by precisely modifying the target genome, and the technical means has great prospect in plant breeding at present. The TALENs, ZFN and CRISPR are the main technical means of the gene editing system and are relatively mature, and the application can also be used on the basis of the prior artXa48And (t) carrying out gene editing breeding on the gene.

Furthermore, the application also provides a method for regulating and controlling the bacterial leaf blight resistance of rice, which specifically comprises the step of increasing the expression level of a Xa48 (t) protein coding gene of the rice, wherein the nucleotide sequence of the Xa48 (t) protein coding gene is shown as SEQ ID NO. 2.

Further, the application also provides a method for cultivating bacterial leaf blight resistant rice strains, which comprises the following steps:

s1: taking rice HNY expressing Xa48 (t) protein coding gene as a male parent; hybridization is carried out by taking Minghui 63, IRBB1 and yellow jade as female parent respectively;

s2: hybrid harvesting F ₁ The seeds of the generation continue to be sown and grown until the booting stage is inoculated for investigation and screening; culturing the plants with the resistance phenotype of more than medium resistance to seed collection to obtain F ₂ Seed generation, inoculating rice white leaf blight again and screening phenotype;

s3: sowing rice with good resistance, growing to booting stage, inoculating bacterial leaf blight bacteria, selecting hybrid offspring with genetic stability, and harvesting F ₃ Seed generation.

RNAi interference technology, gene knockout technology and gene over-expression technology implemented by the application treat target plants, and HNY is selected as backgroundXa48(T) Gene, knockout plant T ₃ Generation, RNAi interference plant T ₃ Substituted and against Japanese sunXa48(T) Gene-overexpressing plant T ₃ The generation is a research object, and rice bacterial leaf blight inoculation investigation is carried out on the plants, and the result shows that the knockout and the interference genes are provedXa48After (t), rice plants are infected with bacterial leaf blightResistance is significantly reduced, and candidate genes are overexpressedXa48After (t), the resistance of rice plants to bacterial leaf blight is obviously enhanced.

The application discovers genes through analysis of salt tolerance, drought tolerance and rice blast resistance of riceXa48(t) has no obvious effect on the salt tolerance and drought tolerance of rice, but has a certain effect in the process of resisting rice blast.

By analysis ofXa48(t) the action relationship with other disease-resistant related genes and hormone genes, and the gene is primarily defined to be controlled by JA pathway, so that PR gene expression is caused, and a plurality of types of disease-resistant reactions are mediated.

By hybridization of HNY with high-quality materials, 3 excellent bacterial blight-resistant strains with good resistance and multiple bacterial blight-resistant gene polymerization are created, and more than 1000 high-quality offspring rice seeds are harvested, so that the strain capable of being used for offspring population detection is developedXa48(t) a related molecular marker.

In conclusion, through excavation, separation cloning, functional analysis and germplasm creation research of bacterial leaf blight resistance genes, the research field of disease resistance genes is widened, disease resistance gene resource libraries are enriched, and a rich theory and material foundation is provided for rice disease resistance breeding.

Drawings

RNAi vector diagram constructed in FIG. 1;

FIG. 2 EcorV shows an electrophoresis chart for verifying the size correctness of recombinant plasmids;

constructed in FIG. 3Xa48A knockout vector map of (t);

the 17-strain mutant sequencing by knockout obtained in FIG. 4 is a diagram (3-strain homozygous mutation) (note: mutation result if two chromosomal mutations are separated by "|" if the two chromosomal mutation results are identical, chromosome mutation number 1 represents a single chromosomal mutation, chromosome mutation number 2 represents 2 chromosomal allelic genes are all mutated, and if the two chromosomal mutation results are identical, it is a double allele homozygous mutation, otherwise it is a double allele heterozygous mutation)

FIG. 5 shows PCR profile of positive plants obtained by gene knockout;

FIG. 6 is a graph showing the phenotypic identification effect of transgenic plants; (note: A: HNY andXa48(t) knock-out plant (900-9) lesion length comparison; b: HNY is compared with the length of the plant disease spots of JG 30; c: HNY compared to RNAi interference plant (G8-6) lesion length; d: nippon sunny and JapaneseXa48(t) overexpressing plants (H9-7) lesion length contrast);

FIG. 7 after spraying the response to exogenous hormonesXa48The effect of the relative expression level of (t) is shown (note: A: after spraying GAXa48(t) relative expression in HNY; b: after JA sprayingXa48(t) relative expression in HNY; c: after spraying SAXa48(t) relative expression in HNY);

FIG. 8XooAn AOS1 gene relative expression analysis chart under stress;

FIG. 9XooA graph of relative expression level of LOX gene under stress;

FIG. 10XooAnalysis of PAL gene relative expression amount under stress;

FIG. 11XooA PR1A gene relative expression analysis chart under stress;

FIG. 12XooAnalysis of PR10 gene relative expression under stress.

Description of the embodiments

The application is further described below with reference to the drawings and examples.

The application identifies a local rice seed from Yunnan Geng Ma county, oryza glutinosa (Haoneoyang, HNY) which shows the above resistance level to bacterial leaf blight, uses HNY and a disease-sensitive variety of adamantine 30 (Jinmanng 30, JG 30) hybridization and selfing test to find HNY that the local variety carries a pair of dominant disease-resistant genes, and uses a BSA method to position the disease-resistant gene carried by HNY in a 0.12 Mb section between 22887903-23002998bp on the long arm end of chromosome 11 of rice, wherein the positioning section has 14 genes. Hybridization backcross to BC was performed using the HNY near isogenic line H197 (HNY near isogenic line H197 is a precursor with adamantine 30 (JG 30) as the female parent and recurrent parent, HNY as the male parent ₄ F ₁ Instead, the BC is obtained by selfing 2 times ₄ F ₃ The generation stabilizing material is the segregation population pair of the near isogenic line with the number of H197 and the filial generation of JG30Xa48(t)Fine localization was performed and candidate genes were screened. Further screening and obtaining the resistance gene fragment by the method of ORFs prediction, qRT-PCR expression quantity detection and transgenic plant functional complementation verificationXa48(t) the amino acid sequence is shown as SEQ ID NO.1, and the nucleotide sequence for encoding the protein is shown as SEQ ID NO. 2. In the process of separating and cloning the gene, the nucleotide sequence of the gene is predicted to be 1738bp (shown as SEQ ID NO. 4) according to NCBI website in the early stage, but in the actual amplification process, only SEQ ID NO.2 is amplified, because a stop codon appears at the position of 1486-1488bp of SEQ ID NO.4, and the sequence after 1489bp cannot be amplified; the amino acid sequence predicted by DNASTAR software translation was 576aa (as shown in SEQ ID NO. 3), but the terminator was actually present at position 496 aa.

The sequences shown as SEQ ID NO.1 and SEQ ID NO.2 are implemented and the effect is verified as follows:

EXAMPLE 1 construction of Rice RNAi plants

Construction of Rice RNAi interference plants As shown in FIG. 1, reference is made to two steps of construction of target gene vector and genetic transformation (Xiaoping, wang Nan, kuang Xiaoming, etc.. Rice is studied by RNA interferenceOsROSES1Gene function [ J]University of southwest (natural science edition), 2020, 42 (06): 1-10). To be used forXa48The corresponding sequence of (t) was used as a template to design a specific primer, PCR amplification was performed using HNY cDNA as a template (Table 1), pBWA (V) HS: xa48 RNA interference vector was constructed, and BsaI/Eco31I cleavage was performed on the amplified product (Table 2). Table 1 shows the results ofXa48The primer constructed by the RNA interference vector of the (t) gene is prepared byXa48The nucleotide sequence of the coding GRAS functional domain in the ORFs of the (t) gene is taken as a template to design an isRNA primer, RNAi vector construction is carried out according to a method of carrying out vector construction by homologous recombination and golden gate seamless cloning, and two ends of a target fragment after construction do not contain enzyme cutting sites, so that the target gene fragment and a vector skeleton fragment cannot be obtained by double enzyme cutting. However, to ensure the accuracy of the recombinant plasmid, we used EcoRV endonucleases to cleave the recombinant plasmid outside of the sequencing, verifying that the actual fragment size of the recombinant plasmid was consistent with the theoretical value (see FIG. 2), and converting the cleaved ligation product (Table 3) to competent DH 5. Alpha; selecting raw materialsA single colony with better growth condition is subjected to 10 forward sequencing, and positive monoclonal conforming to the target is used for subsequent genetic transformation.

Selecting full and normal HNY seeds, sterilizing with 75% alcohol, delivering the plasmids and HNY seeds which are correctly identified in the early stage to a primary biotechnology company, entrusting the company to cultivate and screen HNY callus, infecting the callus by using a correctly identified competent cell suspension, transferring the callus with infection resistance to a newly configured culture medium (the culture medium and the culture process are completed by the primary biotechnology company) under a sterile environment, carrying out secondary screening until rooting, packaging and sealing, and culturing and growing in a greenhouse environment. Extracting DNA pairs from rice leaves growing to seedling stageXa48(T) Gene detection, RNAi plant T correctly detected ₀ Standing at room temperature for hardening seedlings for 2-3 days after the substitution and return, and transplanting into a greenhouse. RNAi T ₀ Culture of strain line and inoculation in booting stageXooPost-investigation of lesion length, extraction of DNA from young leaves of plant line meeting target characteristics, and detection of target gene by using specific primersXa48(t). RNAi plants are screened and marked, and seeds are harvested until the next year after the rice ears are mature, and the plants are sown again. The process is repeated for 2 times, and RNAi strain T is finally harvested ₃ The seeds were used for this study after sowing and growth.

TABLE 1 PCR reaction System for constructing RNAi Strain vector

Component (A)	Dosage (50. Mu.L system)
		DNTP	2 μL
Buffer	5 μL
		Mg 2+	4 μL
Taq	2 μL
		G8F(+)：cagtGGTCTCacaacCGGGATGCTGCTGATCCAGTGT	1 μL
G8F(-)：cgatGGTCTCacaggGTCGACATGCGCACATGATTCT	1 μL
		G8R(+)：cagtGGTCTCagggcgtCGACATGCGCACATGATTCT	1 μL
G8R(-)：cgatGGTCTCatacacgGGATGCTGCTGATCCAGTGT	1 μL
		G8-loop(+)：cgatGGTCTCacctgcaggtctagtttttct	1 μL
G8-loop(-)：cgatGGTCTCagcccgggctctgtaactatc	1 μL
		Deionized water	31μL

The PCR reaction conditions are as follows: pre-denaturation at 94℃for 5 min; denaturation at 94℃for 30 sec, annealing at 50℃for 45sec, elongation at 72℃for 14 sec, and 32 cycles; extending at 72 deg.C for 10min, and maintaining at 4 deg.C for 30min.

TABLE 2 BsaI/Eco31I cleavage reaction System

Component (A)	Dosage (20. Mu.L system)
		Buffer	2 μL
BsaI/Eco31I	1μL
		Deionized water	13 μL
pBWA (V) HS or rDNAtlt3 (3 fragments of about 200bp, respectively)	4 μL

TABLE 3 T4 ligation reaction System

Component (A)	Dosage (10. Mu.L system)
		Buffer	1μL
T4 ligase	1μL
		Deionized water	5.5μL
rDNAtlt3 (after enzyme digestion)	1.25 μL
		pBWA (V) HS (after enzyme cutting)	1.25 μL

And (3) injection: the connection reaction system is at 37 ℃ for 20 min; 10min at 37 ℃ and 10min at 20 ℃ for 5 cycles; the temperature is kept at 37 ℃ for 20 min and 80 ℃ for 5 min.

Transformation of 5-10ul ligation products E.coli competent (see E.coli competent transformation standard methods) transformation of (calicheamicin) resistant plates, incubation at 37℃for 12 hours, plaque PCR identification was performed. Sequence ggatgctgctgatccagtgtgcacaggccatgg with 200bp size between 647bp and 846bp of the gene SEQ ID NO.2 is found by comparing the amplified fragments after sequencing and splicing with the sequence shown by Xa48 gene as SEQ ID NO.2

cgacagacaaccagcaatctgcaggcgagctgctgaagaagatcaagcagcacgctttggcgacaggcgacgccatgcagcgagtggctcactacttcgccaaggggcttgaggcacggctagctggCagcgggaagcatctgtatcagaatcatgtgcgcatgtcg, the RNAi vector construction accuracy of the application is verified.

Example 2 construction of Rice over-expression plants

The construction of the rice over-expression plant comprises two steps of target gene vector construction and genetic transformation. Vector construction methods reference (Chen S, songakumarn P, liu J, et al A versatile zero background T-vector system forgene cloning and functional genomics [ J)]Plant Physiol, 2009, 150 (3): 1111-1121): by target geneXa48(t) designing specific primers H1 (+) and H1 (-) on NCBI as templates and performing PCR amplification (Table 4), naming the amplified product as rDNAH1, and performing double digestion treatment on pBWA (V) HS (empty vector) and rDNAH1, respectively (digestion of vector with restriction enzyme BsaI/Eco31I, reaction body)See Table 5, the digested products were recovered and purified by ligation with T4 ligase onto the pBWA (V) HS vector (Table 6). Single colonies with better growth conditions are selected and sent to the primary and distant biotechnology limited company for sequencing, and positive monoclonal meeting the target is used for subsequent genetic transformation.

Selecting full and normal-color Japanese sunny seeds, sterilizing with 75% alcohol, delivering the plasmids and Japanese sunny seeds identified correctly in the early stage to Boyu biotechnology company, entrusting the company to cultivate and screen Japanese sunny callus, infecting with the correctly identified competent cell suspension, transferring the infected callus to newly configured rooting culture medium (the culture medium and the culture process are completed by Boyu biotechnology company) under sterile environment, performing secondary screening to root, packaging and sealing, and culturing and growing in greenhouse environment. Extracting DNA from the over-expressed plants grown to seedling stage and the leaves of control HNY by designXa48(T) Gene-specific primer amplification, detecting the true or false of the overexpressed plant, and taking the plant amplified with the band as the overexpressed plant T ₀ Instead, standing at room temperature for hardening seedlings for 2-3 days after returning, and transplanting into a greenhouse. Overexpression of plant T ₀ And culturing the strain of the generation, inoculating Xoo during the booting stage, investigating the length of the lesion, taking and screening the over-expression strain which accords with experimental expectation, and harvesting seeds after the rice is mature until the next year for re-sowing. The process is repeated for 2 times, and finally harvestingXa48(T) Gene overexpression line T ₃ The seeds were used for this study after sowing and growth.

TABLE 4 PCR reaction System for constructing Gene overexpression Strain vectors

Component (A)	Dosage (50. Mu.L system)
		DNTP	2 μL
Buffer	5 μL
		H 2 O*Mg 2+	4 μL
Taq	2 μL
		H1(+):cagtCACCTGCacaacatggccaacccagaggattt	2 μL
H1(-):cagtCACCTGCatacacagccgcagcccactctccc	2 μL
		Deionized water	33 μL

And (3) injection: PCR reaction system in the construction of the over-expression plant vector: pre-denaturation for 5min (94 ℃); denaturation for 30 sec (94 ℃), annealing for 45sec (50 ℃), extension for 120sec (72 ℃), 30 cycles of this process; the final extension was carried out for 10min (72 ℃) and the amplified product was stored at 4 ℃.

Table 5 BsaI/Eco31I cleavage reaction System

Component (A)	Dosage (20. Mu.L system)
		Buffer	2 μL
BsaI/Eco31I	1μL
		Deionized water	13 μL
pBWA (V) HS (empty) or rDNAH1 (template)	4 μL

TABLE 6 T4 ligation reaction System

Component (A)	Dosage (10. Mu.L system)
		Buffer	1μL
T4 ligase	1μL
		Deionized water	5.5μL
rDNAH1 (after enzyme cutting)	1.25 μL
		pBWA (V) HS (after enzyme cutting)	1.25 μL

And (3) injection: the ligation reaction was carried out at 37℃for 1 hour.

EXAMPLE 3 construction of Rice Gene knockout Strain

Construction of the present research referenceXa48CRISPR/Cas9 vector pYL-Hu-Cas9pl of (t) (reference MaX, zhang Q, zhu Q, et al A robust CRISPR/Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicotplants [ J)]Mol Plant, 2015, 8 (8): 1274-1284): by target geneXa48(t) the corresponding Japanese sunny sequences on NCBI as templates were designed for specific target sequences TACAGATCCCTCGTCATTGTTGG and GACGAATGCAGGGACGGAGGAGG, PCR reaction systems are shown in Table 7 and the amplification systems are shown in Table 8. The rDNAG1 obtained by successful amplification is subjected to target and carrier digestion by using Buffer and BsaI/Eco31I synthesized by Botelogen company (Table 8), then a T4 ligase and the carrier and template after digestion are used as raw materials to prepare a connection reaction system (Table 9), the connection reaction system is subjected to digestion at 37 ℃ for 2 hours, finally the carrier pYL-Hu-cas9pl-G6 is constructed and transformed into competent cells of escherichia coli by electric shock (figure 3), after the transformation is successful, monoclonal thalli which grow correctly are selected and coated with monoclonal antibody LB medium (kanamycin), after a logarithmic growth period is cultivated, bacterial plaques which grow singly are selected and sent to Botelogen company for sequencing identification (figure 4), and the competent cells which are identified correctly are stored in a-80 ℃ environment.

The genetic transformation of the transgenic plants is as follows: selecting full and normal HNY seeds, sterilizing with 75% alcohol, transporting the plasmids and HNY seeds which are correctly identified in the early stage to a primary biotechnology company, entrusting the company to cultivate and screen HNY callus, infecting the callus by using a correctly identified competent cell suspension, transferring the callus with resistance after infection to a newly configured rooting culture medium (the culture medium and the culture process are completed by the primary biotechnology company) under a sterile environment, carrying out secondary screening until rooting, packaging and sealing, and culturing and growing in a greenhouse environment. Taking rice leaves growing to a seedling stage to extract DNA (deoxyribonucleic acid) for knockout gene detection, and correctly detecting a gene knockout plant T ₀ Placing the seedlings at room temperature for hardening for 2-3 days after the seedlings are sent back, and transplanting the seedlings into a greenhouse for use. Knocking out genesExcept T ₀ Culture of strain line and inoculation in booting stageXooPost-investigation of lesion length, extraction of DNA from young leaves of plant line meeting target characteristics, and detection of target gene by using specific primerXa48(t) presence of G6 (+): AAAGGCTACCACCATTGAATGAT, G6 (-): GCCCTTCTTTTTGA in Gene knockout plants

TGGTCTTA (fig. 5). Screening and marking gene knockout plants which meet the experiment expectations, and harvesting seeds until the second year after the rice ears are mature for re-sowing. The process is repeated for 2 times, and finally harvestingXa48(T) Gene knockout Strain T ₃ The seeds were used for this study after sowing and growth.

TABLE 7 construction of PCR reaction System for Gene knockout Strain vector

Component (A)	Dosage (50. Mu.L system)
		Deionized water	20μL
Pfu PCR mixture	25μL
		25619（+）:cagtGGTCTCatgcaTACAGATCCCTCGTCATTGT(100μM)	2μL
25619（-）:cagtGGTCTCaaaacCCTCCGTCCCTGCATTCGTC(100μM)	2μL
		Template	1μL

And (3) injection: the amplification procedure was 94℃for 5min pre-denaturation, 94℃for 30 sec,50℃for 45sec,72℃for 54 sec (30 cycles), 72℃for 10min and 4℃for 30min.

Table 8 cleavage reaction System for constructing knockout Strain

Component (A)	Dosage (20. Mu.L system)
		Deionized water	13μL
Buffer 10	2μL
		BsaI/Eco31I	1μL
pYL-Hu-cas9pl (empty) or rDNAG1 (template)	4μL

TABLE 9 T4 ligation reaction System

Component (A)	Dosage (10. Mu.L system)
		Buffer	1μL
T4 ligase	1μL
		Deionized water	5.5μL
rDNAG1 (after enzyme cutting)	1.25μL
		pYL-Hu-cas9pl (after cleavage)	1.25 μL

Note that: the connection reaction system is that the connection is carried out for 2 hours at 37 DEG C

In the present application, it is further clarified that after the implementation of example 1, example 2 and example 3Xa48(t) correlation with bacterial leaf blight resistance, and the RNA interference technique, the gene knockout technique and the gene overexpression technique of the application treat target plants by selecting HNY as the backgroundXa48(T) Gene, knockout plant T ₃ Generation, RNA interference plant T ₃ Substituted and against Japanese sunXa48(T) Gene-overexpressing plant T ₃ Instead, these plants were investigated for rice bacterial leaf blight inoculation (FIG. 6). The results show that: the ratio of the spots after 146 strains of the control material HNY are inoculated with the bacterial leaf blight of rice is 7.146 percent, the ratio of the spots after 123 strains of the JG30 (adamantine 30) are inoculated with the bacterial leaf blight of rice is 30.32 percent, the ratio of the spots after 87 strains of the Japanese sun-shading 87 are inoculated with the bacterial leaf blight of rice is 18.76 percent,Xa48 (t) the total 21 plants 900-9 of the gene knockout plants are inoculated with 16.77 percent of bacterial leaf blight disease spot ratio of rice;Xa48the ratio of the bacterial leaf blight spot of the inoculated rice of 96 plants G8-6 of the RNA interference plant G8-6 of the (t) gene is 14.11%, and the ratio of the bacterial leaf blight spot of the inoculated rice of 71 plants H9-7 of the over-expression plant G9-7 is 6.45%. Elucidating knockout and interference genesXa4After 8 (t), the resistance of the rice plants to bacterial leaf blight is obviously reduced, but the rice plants passExpression candidate genesXa48After (t), the resistance of rice plants to bacterial leaf blight is obviously enhanced.

EXAMPLE 4 salt stress, drought stress and Rice blast Vaccination experiments

Salt tolerance determination: 100 rice seeds were cultivated in water with or without 150mmol NaCl. Germination was carried out at 28 ℃/25 ℃ (day/night) for 6 days with a photoperiod of 12 hours light/12 hours dark, and the seedling height and fresh weight of each line were determined in triplicate and averaged. Analysis of experimental data refers to an analytical method of first-friend formation and the like (first-friend formation, yan Youwei, feng Mengshi, and the like, salt resistance identification of the rice bud stage and the seedling stage of the transgenic OsEBP-89 gene [ J ]. Tianjin agriculture science, 2014, 20 (10): 1-4), and salt tolerance of plants is judged according to relative salt damage rate.

Drought tolerance assay: 10 seedlings with the growth condition similar to that of 4 weeks are taken and placed in the same growth environment, drought stress is carried out for 12 days, and water is poured again to restore normal water supply for 7 days. And (3) after 12 days of rehydration growth, taking the plants with green and healthy young leaves as survival plants, and calculating the survival rate of the plants, namely the survival plants account for the total number of the treated plants.

Rice blast inoculation identification method: preparing quantitative oat agar culture medium, sterilizing for 15min, placing rice blast fungus on the oat culture medium under aseptic condition, culturing at 28deg.C until mycelia are fully distributed on culture dish (usually 5-7 days), carefully wiping aerial mycelia, culturing under moisture-retaining condition, and waiting in dark condition for spore production. Preparing a rice blast fungus spore suspension, diluting and subpackaging until spraying is carried out to inoculate rice blast fungus on rice plants in a 3.5-4.0 leaf period. And (3) placing the material in a plant artificial climate box at 28 ℃ for dark culture for 18-20 hours, transferring to a greenhouse for routine management, investigating the disease condition according to disease index standards after 8 days, investigating and judging the anti-infection condition, and repeating the test for 2 times.

Example 4 of the application further investigatedXa48(t) roles in salt stress, drought stress and rice blast resistance, based on the results of studies of fine localization and isolation of clones, studies were madeXa48(t) role in other resistance functions. In salt stress experiments, japanese sunny and Japanese sunny are used as the backgroundXa48(t) overexpressing plants as subjects of investigation according to relative salt damage rateTo determine the salt tolerance of the plants (Table 10). The results show that the over-expression plant with 150mmol NaCl stress has no obvious difference in root length, seedling height and comprehensive relative salt damage rate compared with the control Japanese sunny.

Table 10 relative salt damage rate of rice material

Strain of strain	Root length relative salt damage rate	High relative salt damage rate of seedlings	Comprehensive relative salt damage rate in seedling stage
				Nippon sunny day	43.60%	72.31%	57.95%
H9-3	46.68%	55.43%	51.06%
				H9-5	43.26%	66.02%	54.64%
H9-11	31.50%	56.42%	43.96%
				H9-16	50.67%	70.35%	60.51%

Note that: h9-3 is of the background of JapaneseXa48(t) line 3 of the overexpressing plant; h9-5 is of the background of JapaneseXa48(t) line 5 of the overexpressing plant; h9-11 is of the background of JapaneseXa48(t) line 11 of the overexpressing plant; h9-16 is of the background of JapaneseXa48(t) line 16 of the overexpressing plant

In drought stress experiments, both Nipponbare and Nipponbare are used as backgroundsXa48(t) over-expressed plants were used as subjects, and the survival rate of plants was calculated from plants grown in rehydration for 12 days with green healthy young leaves as surviving plants, and the results are shown in the following table (table 11): the survival rate of the over-expressed plants H9-7 and H9-16 is lower than 80% of that of a control, the survival rates of H9-3 and H9-9 are 100% higher than that of the control Japanese sunny, and the average survival rate of the over-expressed strains is not obviously different from that of the control.

Table 11 drought stress test rice survival rates

Variety of species	Total number of plants	Surviving tree	Survival rate/%
				Nippon sunny day	10	8	80
H9-3	10	10	100
				H9-7	10	7	70
H9-9	10	10	100
				H9-16	10	6	60

Note that: h9-3 is of the background of JapaneseXa48(t) line 3 of the overexpressing plant; h9-7 is of the background of JapaneseXa48(t) line 5 of the expression plant; h9-9 is of the background of JapaneseXa48(t) line 11 of the overexpressing plant; h9-16 is of the background of JapaneseXa48(t) line 16 of the overexpressing plant.

In the rice blast inoculation experiment, the rice blast inoculation method, against the background of Japanese sunny daysXa48(t) overexpressing plants, HNY, against HNYXa48(t) RNA interference plants were studied and the onset of disease was as shown in Table 12:Xa48(t) the incidence of rice blast in plants over-expressed with the gene is generally lower than that in control Japanese sunny,Xa48(t) Gene RNA interference plants have higher morbidity than control HNY, indicatingXa48The (t) gene enhances the resistance of rice plants to rice blast.

TABLE 12 Rice plant inoculation rice blast resistance

Variety of species	Number of blades	0 level/tablet	Grade 1/tablet	Grade 2/tablet	3 grade/tablet	Grade 4/tablet	5 grade/tablet	Incidence of disease	Index of disease condition
										Nippon sunny day	49	31	5	5	4	4	0	36.73%	8.62
HNY	49	36	2	5	4	2	0	26.53%	7.26
										JG30	46	30	4	6	5	1	0	34.78%	8.45
H9-3	49	37	6	2	2	1	0	24.49%	4.54
										H9-7	45	35	6	3	1	0	0	22.22%	3.70
H9-9	48	37	5	5	1	0	0	22.92%	4.17
										H9-10	47	29	5	7	3	3	0	38.30%	9.46
H9-16	46	34	6	2	3	1	0	26.09%	5.56
										G9-1	46	25	3	10	7	1	0	45.65%	11.59
G5-4	47	32	6	7	3	1	0	31.91%	7.80
										G4-1	50	38	4	2	4	2	0	24.00%	6.22
G8-6	53	31	1	4	8	5	3	41.51%	14.26

Note that: h9-3 is of the background of JapaneseXa48(t) line 3 of the overexpressing plant; h9-5 is of the background of JapaneseXa48(t) line 5 of the overexpressing plant; h9-11 is of the background of JapaneseXa48(t) line 11 of the overexpressing plant; h9-16 is of the background of JapaneseXa48(t) line 16 of the overexpressing plant; g9-1, G5-4, G4-1, G8-6 are post RNAi against milli-glutinous-lifting, respectivelyXa48The No.1 transgenic plant of the 9 th strain, the No.4 transgenic plant of the 5 th strain, the No.1 transgenic plant of the 4 th strain and the No. 6 transgenic plant of the 8 th strain of (t).

EXAMPLE 5 disease resistant germplasm creation

HNY is used as male parent, and Minghui 63, IRBB1 and yellow jade which are used as female parent are used for hybridization. Hybrid harvesting F ₁ And continuing sowing and growing the generation seeds until the booting stage is inoculated for investigation and screening. Culturing the plants with the resistance phenotype of more than medium resistance to seed collection to obtain F ₂ Seed generation, re-inoculating rice white leaf cake and screening phenotype. Sowing rice with good resistance, growing to gestation period, inoculating bacterial leaf blight bacteria, researching genetic stability of filial generation and harvesting F ₃ Seed generation. The early research results show that although bright 63, IRBB1 and yellow jade carry disease-resistant genes, the rice bacterial blight bacterial race PXO99 can overcome the disease-resistant genes carried by the 3 varieties, and the application carriesXa48The milliwaxy of the (t) gene, exhibited moderate to disease resistance (MR, R) to the strain (Table 13). Therefore, the male parent of the Oryza Glutinosa is hybridized with other 3 varieties to obtain offspring with improved resistance, which can be further provedXa48Disease resistance of the (t) gene.

TABLE 13 Gene carrying cases for each parent and PXO99 response

Parent name	Carrying known bacterial leaf blight resistance genes	Average lesion length	Reaction to PXO99
				Bright glow 63	Xa26(t)	7.12 cm	S
IRBB1	Xa1	6.3cm	S
				Topaz	Xa1，Xa12	7.3cm	S
Oryza Glutinosa (Hao Zhao)	Xa48(t)	3.2cm	R

Evaluation of bacterial leaf blight resistance of Rice in booting stage

Population of offspring to be crossed F ₃ Instead of growing to the booting stage, bacterial leaf blight is inoculated, the length of the rice lesion (the length from the inoculation position to the middle stem margin of the wilt leaves) is investigated after 21 days, and the average lesion length or average lesion area of each plant is calculated. Inoculating and identifying the filial generation by using bacterial strain of rice PXO99, wherein the disease spot length and the disease spot ratio are shown in table 14:

TABLE 14 filial generation F ₃ Inoculation of bacterial leaf blight and resistance to infection

Population of hybrid offspring	Average lesion length	Average sword leaf length	Ratio of disease to plaque
				HNY XMinghui 63	2.91 cm	25.77 cm	11.3%
HNY × IRBB1	3.02cm	22.25 cm	13.6%
				HNY Xyellow jade	2.44 cm	19.89 cm	12.3%

Note that: minghui 63 is a indica type conventional rice, bred by Sanming city agricultural science institute, and carries a bacterial leaf blight resistance geneXa26(t); IRBB1 is a bacterial leaf blight resisting gene bred by International institute of riceXa1Is a near isogenic line of (2); yellow jade, indica type conventional rice carrying bacterial leaf blight resistance geneXa1，Xa12But lose disease resistance to PXO99 strain.

The minimum disease spot ratio of HNY XMinghui 63 after inoculation of rice bacterial leaf blight is 11.3%, the next is HNY Xyellow jade is 12.3%, and the highest disease spot ratio in the offspring group is HNY XIRBB 1 is 13.6%. According to the classification standard described above, the disease-spot ratio of the three materials after PXO99 inoculation is obviously lower than that of the infected variety JG30, and the three materials all belong to the bacterial blight resistance medium and the bacterial blight resistance medium, which shows that the three materials are carriedXa48The filial generation of (t) has the resistance to bacterial leaf blight, and the filial generation population material can be directly used as a disease-resistant strain material for bacterial leaf blight in rice production.

Agricultural character investigation of rice hybrid offspring material

The results of investigation and statistics of the average values (plant height, rice spike length, spike neck length, total grain number per spike, solid grain number per spike, and seed setting rate) of 5 agronomic traits of 28 plants in total of 3 hybrid offspring against bacterial leaf blight are shown in Table 15:

TABLE 15 filial generation F ₃ Agronomic trait questionnaire

Traits (3)	Height of plant (cm)	Spike length (cm)	Neck length (cm)	Total grain number per spike	Number of solid grains per ear	Set percentage (%)
							HNY XMinghui 63	112.3	23.16	7.3	104	66	63.46
HNY × IRBB1	124.7	28.55	9.1	89	41	46.06
							HNY Xyellow jade	117.5	24.73	5.8	85	34	40.00

Final statistical co-harvest of hybrid offspring F ₃ Seed 893 grains, wherein HNY ×Minghui 63 total 414 grains, HNY ×topaz total 230 grains, HNY ×irbb1 total 249 grains; hybrid offspring F ₃ Seed 641, wherein HNY ×Minghui 63 total 314, HNY ×topaz total 130 and HNY ×irbb1 total 197. The agronomic traits of the hybrid offspring were shown to be in the normal range according to the table, but in general HNY x F of Minghui 63 ₃ Instead, the overall performance is better.

EXAMPLE 6 analysis of the relationship between Xa48 (t) and disease resistance-related Gene

In order to explore whether Xa48 (t) mediates plant endogenous hormone genes and other disease-resistant related genes to participate in disease-resistant reaction, the application relates to key genes of endogenous hormone signal paths of rice according to literature dataAOS1、LOXGenes (gene),PALGene and PR gene of ricePR1AGene and genePR10Gene-designed specific primers are shown in Table 16, against HNY, JG30, japanese sunny and HNY as the backgroundXa48(t) knockout plants and Japanese-sunny backgroundXa48(t) qRT-PCR analysis of overexpressed plants, explorationXa48(t) relationships to these genes, the results are as follows:

after the bacterial leaf blight bacteria of the rice are inoculated,AOS1genes (gene),PR10The gene may be subjected toXa48Positive control of (t), in comparison to controlXa48(t) Gene after knockoutAOS1AndPR10down-regulating the relative expression level of (C) and over-expressingXa48Post (t) GeneAOS1AndPR10up-regulation of relative expression level (FIGS. 8 and 12) indicates thatXa48(t) can regulate and trigger in the forward directionAOS1Genes (gene),PR10The genes are involved in disease resistance reaction of plants.

After the bacterial leaf blight bacteria of the rice are inoculated,LOXgenes (gene),PALGenes (gene),PR1AAnd (3) withXa48The correlation of (t) is not great, and the gene is compared with the controlXa48(t) relative expression level and/or amount of LOX Gene and PAL Gene after knock-out and overexpressionXa48(t) the correlation was not obvious (FIG. 9, FIG. 10, FIG. 11), indicatingXa48(t) mediated disease resistance was not significantly related to the LOX gene, PAL gene.

TABLE 16 example 6 qRT-PCR analysis primers used

PR1A-F	CGTCTTCATCACCTGCAACTACTC	qRT-PCR
			PR1A-R	CATGCATAAACACGTAGCATAGCA	qRT-PCR
PR10-F	CGCCTTCCTTGAACCTGT	qRT-PCR
			PR10-R	TACATTGCAAATGAAGATATTATATCATGTAGGAG	qRT-PCR
OsLOX-F	AAACGCTCGCTGGCATCAAC	qRT-PCR
			OsLOX-R	ATCGCCTCCTCCACCGTCAT	qRT-PCR
OsAOS1-F	GGTGAAGAAGGACTACGACCGC	qRT-PCR
			OsAOS1-R	CCGAACGAGTTGAAGCAGAGC	qRT-PCR
OsPAL-F	CACAAGCTGAAGCACCACCC	qRT-PCR
			OsPAL-R	GAGTTCACGTCCTGGTTGTG	qRT-PCR

Example 7Xa48(t) analysis of relationship with exogenous hormone

To exploreXa48(t) whether the plant exogenous hormone is regulated and controlled by plant exogenous hormone genes JA (jasmonic acid), SA (salicylic acid) and GA (gibberellin), the application respectively dilutes the plant exogenous hormone genes SA, JA and GA to the final concentration: JA 100 umol/L, SA 100 umol/L, GA 100 umol/L, packaging diluted liquid into spray cans, uniformly spraying on rice plants, and performing qRT-PCR analysis to obtain primer sequences as shown in Table 17Xa48(t) and rice response exogenous hormone (FIG. 7), the results were as follows:Xa48(t) is positively regulated by exogenous GA, JA and SA, and the relative expression quantity of the gene is obviously increased after treatment of 2-8 h.

TABLE 17 primers used in example 7 qRT-PCR analysis

Xa48-1F	TGGTAGCTATGGTGCCTCCT	qRT-PCR
			Xa48-1R	CAGGTCTGCACCCTCACAG	qRT-PCR
OsActin-F	GAGTATGATGAGTCGGGTCCAG	qRT-PCR
			OsActin-R	ACACCAACAATCCCAAACAGAG	qRT-PCR

The partial operations in the above embodiments are specifically:

1. cultivation and field management of rice materials

Putting the rice seeds to be tested into a culture dish subjected to pre-sterilization treatment, soaking and accelerating germination by using distilled water, standing in a dark room temperature environment until the seeds are exposed to white, selecting germinated seeds, putting the germinated seeds into a seedling water culture box for root accelerating, regulating the temperature of an illumination incubator to 28 ℃, standing and culturing, and adding water to the top of the seedling water culture box during 2-3 days. And (3) when the rice is cultured to a three-to-four-leaf stage, the rice is moved to a room temperature environment and placed for 3 days for hardening seedlings, then the rice is transplanted to a field for transplanting seedlings, and the rice is cultured to a booting stage for inoculation Xoo identification investigation.

2. Culture medium and other reagents

Nutrient agar medium (NA medium) formulation: yeast extract 1 g, sucrose 12 g, agar powder 18 g, peptone 5 g, beef extract 3 g; distilled water is added to 1L, the pH is regulated to 6.8-7.0, and the mixture is stirred uniformly, and then the mixture is injected: the optimal growth pH value of bacterial leaf blight bacteria is 6.8-7.0, and the bacterial leaf blight bacteria are autoclaved for 15min at 121 ℃.

The formula of the oat culture medium is as follows: 3g of oat, 10g of sucrose and 16-20 g of agar powder g, adding distilled water to about 1L, adjusting the pH of the mixed solution to 6.8-7.0, subpackaging, and sterilizing at 121 ℃ for 15 min.

LB medium: active yeast extract 3 g; tryptone 12 g; solid sodium chloride 8 g; distilled water 1L, pH value is regulated to 6.9-7.0, and single or compound antibiotics can be added according to experimental requirements.

In the embodiment, mix, plant RNA extraction kit and real-time fluorescent dye reagent used for PCR amplification are provided by Nanjinouzan biological company; the plasmid extracting set and the RNA reverse transcription kit are provided by Tiangen scientific biology Co., ltd; TAE, TBE, CTAB the screening process from RNAi plant, over-expression plant and callus of gene knockout plant to seedling is completed by Boyu biotechnology company, which adopts conventional rice culture technique.

3. Cultivation, inoculation and investigation of pathogenic bacteria

XooThe strain is usually stored in an environment of-80 ℃, 20-ul dispersed and dripped on NA culture medium for rejuvenation at 28 ℃ by a pre-sterilized pipette, bright yellow colonies are formed on the surface of the culture medium after 3 days of culture, bacterial blight bacteria are suspended by sterile water, and the bacterial blight bacteria are diluted to OD ₆₀₀ The value is 0.7-1.0.

The rice material in booting stage is inoculated with the bacterial wilt, the sterilized clean scissors are dipped with the bacterial liquid, the position with the length of 2 cm to 3cm of the tip end of the rice sword blade is used as the optimal inoculation port, and 7 sword blades are inoculated by a single plant for inoculation. And re-dipping the bacterial liquid when the bacterial liquid is inoculated for 3 times or the bacterial liquid of the scissor edge is slightly dry. After inoculation, the rice plants were placed in an environment of 28-30 ℃ and grown for 21 days. After determining The disease condition, the length of The lesion (length from The inoculation site to The edge of The middle stem of The wilt leaf) after 21 days of inoculation of The rice was examined, and The average lesion length or average lesion area per plant was calculated (Hong Y, liu Q, cao Y, et al, the OsMPK15 negatively regulates magnaporthe oryza and)Xoodisease resistance via SA and JA signaling pathway in rice[J]. Frontiers in plant science, 2019, 10: 752）。

4. Extraction of genomic DNA from rice

Using the CTAB method: cutting young rice leaves as much as possible, placing the young rice leaves into a centrifuge tube, adding 2 pre-sterilized steel balls, symmetrically placing the centrifuge tube into a freezing crusher for freezing and vibrating treatment to powder, adding 800 mu L of 1.5 XCTAB buffer solution preheated at 65 ℃ and slightly reversing the solution for 6-8 times repeatedly, placing the solution into a water bath kettle for mild soaking for 30min, taking out the centrifuge tube at intervals of 5min, and slightly reversing the top and bottom of the centrifuge tube for several times; adding a pre-chargeFirstly, the following steps are carried out: 1, about 600-800 mu L of the prepared chloroform/isoamyl alcohol mixed solution is slowly shaken until milky floccule is suspended in the mixed solution; centrifuging at-4deg.C for 10min (8000-10000 r), and slightly sucking supernatant 600 ul by pre-sterilized pipette, wherein plant tissue is not easy to adsorb; adding equal volume of isopropanol into the supernatant by a pipetting gun, slightly blowing and shaking, standing and refrigerating the mixed solution in an environment of-20 ℃ for preferably 30-90 min; 10000-12600 r, wherein white solid DNA is attached to the bottom of the centrifuge tube, and the supernatant is discarded; repeatedly adding 400-600 mu L of 75% ethanol twice to rinse the solution to be transparent for the last time, and sucking out waste liquid at the bottom of the centrifuge tube; standing the centrifuge tube in an air circulation environment overnight; finally, adding proper sterile ddH according to the precipitation amount ₂ O-dissolution (typically 30-50 ul).

5. PCR reaction system and amplification program

Other PCR reactions not specifically described in the present application, the amplification procedure is: pre-denaturation for 2 min (98 ℃); denaturation for 10 sec (98 ℃), annealing for 15sec (Tm ℃) and extension for 15sec (72 ℃), 33 cycles of this process; the final extension was carried out for 5min (72 ℃) and the amplified product was stored at 4 ℃.

PCR reaction system: the amount (50. Mu.L system), 2X Flash Hot Start MasterMix (Dye) 25. Mu.L; forward primer (10. Mu.M) 2. Mu.L; reverse primer (10. Mu.M) 2. Mu.L; 1. Mu.L of Template DNA; ddH ₂ O20. Mu.L, note: when the target fragment cannot be amplified, the annealing temperature can be changed by using a gradient method to explore the optimal annealing temperature of the target fragment.

6. Agarose gel electrophoresis experiments

120 g ul distilled water is measured and 1.2g agarose is added, and the mixture is heated until the solid particles are dissolved; cooling to 50deg.C, adding 1ul nucleic acid dye, mixing, and pouring into gel tank (preventing bubbles from floating on the surface of colloid during pouring); sucking the PCR product of 3-5 ul with a pipette, and performing 180V electrophoresis for about 30min until the strips are uniformly dispersed; the gel was slightly moved in an ultraviolet projection imager and a suitable aperture focus scan was selected for taking a picture.

7. Extraction and reverse transcription of RNA

The extraction of RNA in the study is carried out according to the specification steps of the kit R701, so that the condition that the used articles are not polluted by RNase in the experimental process is ensured, and the extraction method refers to the accompanying specification of the product: cutting and split charging rice leaves into a pre-sterilized mortar, rapidly grinding into powder by using liquid nitrogen or a freezing crusher, adding 500 mu LRNA-easy lysate, and carrying out severe shaking to enable a sample to be fully cracked; 200. Mu.L ddH was added to the lysate ₂ Mixing and standing O (RNase-free); 15 Centrifuging at high speed for min to enable the powdery leaves to sink to the bottom; taking 650 mu L of isopropanol, slightly blowing and mixing; centrifuging at high speed for 5min after the milk yellow floccule is suspended, and discarding the supernatant; rinsing twice with 75% ethanol of 300-600 ul until the rinsing liquid is transparent; after 9000r centrifugation for 3 min, white sediment is attached to the bottom of the centrifugal tube; pouring the waste liquid carefully, placing the mouth of the centrifuge tube at an open bevel for 5min at room temperature, and adding appropriate ddH according to the precipitation amount ₂ O (RNA-Free) was blown to pellet dissolution (low temperature or ice handling) using a pipette and the resulting RNA solution was stored at-80 ℃.

The cDNA required in this study was obtained by RNA reverse transcription, which was performed using the procedure described in kit KR116, and the cDNA solution obtained from the reaction was stored at-20℃until use. RNA reverse transcription procedure: 42. incubating for 18min at the temperature; 95. the cDNA solution obtained by reverse transcription is preserved at-20 ℃ for standby at-3 min. RNA reverse transcription reaction system: the amount (20. Mu.L system) of R Buffer 2. Mu.L; total RNA 1. Mu.L; ddH ₂ O (RNA-Free) 12 μL；KRTBuffer2 μL；FRTE Mix1 μL；FQPMix1 μL；FQP Mix2 μL。

Claims (8)

1. The application of the rice Xa48 (t) protein is characterized in that the amino acid sequence of the rice Xa48 (t) protein is shown as SEQ ID NO.1, and the application is any one of the following:

(1) Enhancing the resistance of rice to bacterial leaf blight;

(2) Enhancing the resistance of rice to rice blast;

(3) Breeding rice disease resistance;

the application of the rice disease-resistant breeding is any one of the following applications:

s1: MAS breeding of bacterial leaf blight resistance genes;

s2: transgenic breeding of bacterial leaf blight resistance genes;

s3: and (3) carrying out gene editing breeding on the bacterial leaf blight resistance genes.

2. A gene encoding the Xa48 (t) protein of claim 1, wherein the nucleotide sequence of the gene is shown in SEQ ID NO. 2.

3. A primer set for amplifying a gene of the rice Xa48 (t) protein of claim 2.

4. Use of a gene according to claim 2 or a primer pair according to claim 3 in any of the following:

(1) Screening or breeding single plants or lines or varieties of rice with bacterial leaf blight resistance;

(2) And (3) preparing a product for screening or breeding single plants or lines or varieties of rice with bacterial leaf blight resistance.

5. A method for regulating resistance of rice to bacterial leaf blight is characterized by improving expression level of Xa48 (t) protein coding genes of rice, wherein the nucleotide sequence of the Xa48 (t) protein coding genes is shown as SEQ ID NO. 2.

6. The method for regulating resistance to bacterial leaf blight of rice as defined in claim 5, wherein the method for increasing expression level of Xa48 (t) protein-encoding gene of rice comprises: constructing Xa48 (t) protein coding genes on a transgenic vector, and transferring the transgenic vector into other rice by a genetic transformation method to obtain an over-expressed bacterial leaf blight-resistant rice strain.

7. The method for regulating resistance to bacterial leaf blight of rice as defined in claim 5, wherein the method for increasing expression level of Xa48 (t) protein-encoding gene of rice comprises: spraying exogenous hormones JA, SA or GA for regulating and controlling.

8. The method for controlling bacterial leaf blight resistance of rice according to claim 5, wherein rice over-expressing Xa48 (t) protein encoding gene is crossed with other rice lines to cultivate bacterial leaf blight-resistant rice lines;

the method for cultivating the bacterial leaf blight resistant rice strain comprises the following steps:

s1: taking rice HNY expressing Xa48 (t) protein coding gene as a male parent; hybridization is carried out by taking Minghui 63, IRBB1 and yellow jade as female parent respectively;

s2: hybrid harvesting F ₁ The seeds of the generation continue to be sown and grown until the booting stage is inoculated for investigation and screening; culturing the plants with the resistance phenotype of more than medium resistance to seed collection to obtain F ₂ Seed generation, inoculating rice white leaf blight again and screening phenotype;

s3: sowing rice with good resistance, growing to booting stage, inoculating bacterial leaf blight bacteria, selecting hybrid offspring with genetic stability, and harvesting F ₃ Seed generation.