CN113388561B - Rhizobium HH103 omega mutant and application thereof - Google Patents

Abstract

The invention provides a rhizobia HH103Ω mutant and application thereof, belonging to the technical field of agricultural microorganisms. The purpose of the present invention is to reduce the number of soybean nodules. The invention provides a mutant of Rhizobium HH103, which is based on Sinorhizobium fredii (Sinorhizobium fredii) HH103 as a starting bacterial strain, and the verification of several experiments and different groups shows that the mutant HH103 Ω NopZ of NopZ mutation can reduce soybean The number of root nodules provides the basis for subsequent research on the formation of soybean-rhizobia symbiotic system, and provides the possibility to improve the symbiotic efficiency of soybean and rhizobia.

Description

A kind of rhizobia HH103Ω mutant and its application

technical field

The invention belongs to the technical field of agricultural microorganisms, and in particular relates to a rhizobium HH103Ω mutant and application thereof.

Background technique

Nitrogen is one of the most important elements that limit the growth of crops, but the nitrogen in the soil that can be used by plants is very limited, and it is mainly provided by chemical fertilizers. However, with the continuous increase of nitrogen fertilizer application, it not only inhibits the symbiotic nitrogen fixation between rhizobia and leguminous plants, but also brings many adverse effects on the ecological environment. Therefore, in the absence of chemical fertilizer supply, symbiotic nitrogen fixation can provide a sufficient nitrogen source for the growth and development of legumes. After the soybean root system is infected by rhizobia, symbiotic root nodules will be formed, and the root nodules will convert nitrogen in the air into ammonia through biological nitrogen fixation to provide nitrogen sources for soybeans. Increasing the nitrogen fixation capacity between soybean and rhizobia can not only greatly reduce the use of nitrogen fertilizer, but also increase soybean yield. Therefore, improving the nitrogen fixation capacity of legumes is of great significance to the ecological environment and agricultural development.

During the symbiotic nodulation process of legumes and rhizobium (Sinorhizobium fredii), many signal molecules are involved in the transduction, among which the type III effector secreted by the type III secretion system of rhizobium is one of the most important signal molecules, which affects Establishment of a symbiotic relationship between rhizobia and host plants. However, the molecular mechanism of how type III effectors affect plant nodulation is still unclear, and the interaction genes between rhizobia and legumes have not been deeply studied.

The number of soybean nodules is an important factor affecting the symbiotic nitrogen fixation and growth of soybeans. At present, there is no way to control the number of soybean rhizobia through artificial control. It can only be maintained by constantly replacing rhizobia to find out the rhizobia suitable for inoculating soybeans. The number of nodules is stable, the operation is very troublesome and the amount of work is huge, and there are many unknown factors. There is an urgent need for a method that can control the number of soybean nodules.

Contents of the invention

The purpose of the invention is to reduce the number of root nodules on the premise of reducing labor costs, and solve the technical problem that it is difficult to control the number of soybean root nodules. The invention provides a mutant of Rhizobium (Sinorhizobium fredii) HH103, which is obtained by deleting or silencing the NopZ gene in the starting strain of Rhizobium (Sinorhizobium fredii) HH103.

In one embodiment, the NCBI GenBank of the NopZ gene: AY683479.1.

In one embodiment, the mutant is obtained by using the pJQ200SK vector expressing the NopZ gene in Rhizobium HH103 as a host.

The present invention also provides a method for constructing the above-mentioned mutant, the specific steps of which are as follows:

(1) Construction of recombinant vector: mutate into EcoRI restriction site at 24b-29bp downstream of the start codon of NopZ CDS, and then at 24bp downstream of the start codon of NopZ CDS shown in SEQ ID NO: 13 The resistant fragment Specc obtains the target fragment;

(2) connecting the target fragment obtained in step (1) with the pJQ200SK vector to obtain a recombinant vector;

(3) The recombinant vector obtained in step (2) is introduced into Rhizobium HH103 by a three-parent hybridization method to obtain a Rhizobium HH103 mutant.

The present invention also provides a reagent for reducing the number of soybean nodules, the active ingredient of which is the mutant containing the above rhizobium HH103.

In one embodiment, the number of mutants of the rhizobia HH103 is greater than 1×10 ⁵ /ml.

The present invention also provides a method for reducing soybean nodules, the specific steps of the method are as follows:

When the soybean seedlings grow to the stage of opposite true leaves, the above-mentioned mutant bacterial solution is applied to the soybean seedlings, and the inoculation amount is more than 2×10 ⁵ /plant, and the soybeans inoculated with the bacterial solution are cultivated for 30-40 days.

In one embodiment, the bacterial liquid is prepared as follows:

(1) The above-mentioned mutants are cultured and activated, and the _OD600 is controlled to be 0.65-0.86;

(2) Centrifuge the bacterial liquid obtained in step (1), collect the bacterial cells and wash, then resuspend the bacterial cells with magnesium sulfate solution, so that the _OD600 of the bacterial liquid reaches 0.2;

The present invention also provides an application of the above-mentioned reagent in reducing the number of soybean nodules, and the suitable soybean variety of the reagent is Suinong 14 or wild bean ZYD00006.

The present invention also provides the application of the above-mentioned mutants in soybean breeding.

The present invention also provides the application of the method for reducing soybean nodules in soybean breeding.

Beneficial effects: the present invention obtains the mutant HH103ΩNopZ by performing gene deletion mutation on Sinorhizobium type III effector NopZ, and identifying it by PCR and Southern blot. The nodulation test of 220 chromosome segment substitution lines (CSSL) was carried out on the HH103ΩNopZ mutant and the wild-type strain HH103, and the number and dry weight of nodules were counted. The results showed that the NopZ mutation could reduce the number and dry weight of nodules and after several times Experiments and verification of different groups showed that the NopZ mutant mutant HH103ΩNopZ can reduce the number of soybean nodules, which provides a basis for subsequent research on the formation of soybean-rhizobia symbiotic systems, and provides the possibility to improve the symbiotic efficiency of soybean and rhizobia.

Description of drawings

Figure 1 is the gel electrophoresis results of the amplified gene, where A is the amplification of the NopZ mutation fragment, M is the Trans 2KPlus DNA marker, 1 and 2 are the NopZ mutation fragment (1440bp); B is the Spec resistance gene insertion NopZ mutation Fragment, M is Trans 2K DNA marker; 1, 2 are Spec insertion NopZ mutation fragments (2681bp);

Figure 2 is the PCR identification of the mutant HH103ΩNopZ, where M is Trans 2K Plus DNA marker, A is the primers Nifh-F and Nifh-R for the first round of identification, B is the primer Spec-F and NopZ-R primers for the second round Round of verification, C is primer NopZ-F and NopZ-R primers for the third round of PCR verification, lanes 5 and 6 are NopZ mutants;

Figure 3 is the Southern identification of mutant HH103ΩNopZ, wherein, M is DL 15000 DNA Ladder, 1 is HH103ΩNopZ (HindⅢ), and 2 is HH103 (HindⅢ);

Figure 4 is the PCR identification of the complementing strain, wherein M is Trans 2K Plus DNA marker, 1 is HH103ΩNopZpFAJ1702-NopZ, 2 is HH103 wild type, and 3 is HH103ΩNopZ;

Figure 5 shows the nodulation phenotypes of different strains inoculated with Suinong 14, ZYD00006, wherein, A is the statistics of the number of nodules, the abscissa is the group, and the ordinate is the number of nodules; B is the statistics of the dry weight of the nodules, and the abscissa is the group, The vertical axis is root nodule dry weight; Note: * indicates significant difference at p<0.05 level.

specific embodiment

Chromosome Segments Substitution Lines (CSSSL) are recorded in the article_Chen Qingshan, "Construction and Application of Crop Backcross Substitution Lines".

HH103ΩTtsI (Mutant not expressing effector) is described in [1] Tian Boyu, Sun Zhijun, Liu Hanxi, et al. Construction of Rhizobium TtsI mutant and identification of nodulation phenotype[J]. Chinese Journal of Oil Crops, 2020, v.42; No .179(01):21-28.

The pEASY-T1 vector, Helper (Km) and pFAJ1702 (Tet) were all purchased commercially.

The pJQ200SK vector (Gm) vector is described in Quandt, J., & Hynes, M.F. (1993).Versatilesuicide vectors which allow direct selection for gene replacement in Gram-negative bacteria. Gene, 127 (1), 15-21. 0378-1119(93)90611-6 in the literature;

SN14, wild bean ZYD00006 Suinong 14, Charleston, Dongnong 594, He 00-23, Hongfeng 11, Sui 02-339, Zihua 2, Nattosan, Heinong 44, Heinong 35 and Beifeng 11 are common in Heilongjiang from the Key Laboratory of Soybean Biology, Ministry of Education, Northeast Agricultural University.

Fast-growing Sinorhizobium fischeri HH103 (derived from the laboratory of Francisco Javier López-Baena, University of Seville, Spain, recorded in Weidner S, Becker A, Bonilla I, et al. Genome Sequence of the Soybean Symbiont Sinorhizobium fredii HH103[J ].Journal of Bacteriology,2012,194(6):1617.)

2×TY liquid medium: tryptone (bacto-tryptone) 16g, yeast extract (bacto-yeastextract) 10g, NaCl 5g, water 1000mL, pH7.2, sterilized at 121°C for 30min

Example 1. Construction of recombinant vectors

1. According to the whole genome sequence of Sinorhizobium fredii (Sinorhizobium fredii) HH103 (NCBI ID number is txid1117943), find the coding sequence of type III effector NopZ (GenBank: AY683479.1). Design the NopZ mutant fragment sequence (about 650bp upstream and 750bp downstream of the start codon), and design primers NopZ mutant fragment-F (CCGTGCGATAGTTGTGGTT, SEQ ID NO: 1) and NopZ mutant fragment-R (TCACCTCCCAAATCCCAAA, SEQ ID NO: 2).

2. NopZ mutant fragment: the genome of Rhizobium HH103 was extracted using the Bacterial Whole Genome Extraction Kit (TIANGEN Company), and the NopZ mutant fragment of the extracted Rhizobium HH103 genome was carried out using primers NopZ mutant fragment-F and NopZ mutant fragment-R. PCR amplification. Reaction system: Template DNA, 2μg; 5×PS Bufferr, 20μL; dNTP, 8μL; NopZ-R, 2μL; NopZ-F, 2μg; PrimeSTAR, 1.2μL; ddH2O, up to 100μL;

Reaction conditions (28 cycles): 98°C, 3min; 95°C, 30s; 55°C, 30s; 72°C, 2min; 72°C, 10min; 4°C, pause.

pEASY-Blunt Cloning Kit vector ligation system (10 μL): NopZ mutant fragment, 4 μL; Solution, 5 μL; pEASY-Blunt Cloning Kit, 1 μL. The NopZ-LF-pEasy-Blunt plasmid was obtained.

Results: The target band of the NopZ gene was 537bp, and the target band of the NopZ mutant fragment was 1440bp, as shown in A in Figure 1.

3. Construction of homologous recombination fragments

Primer design: the 18bp downstream of the start codon of NopZ CDS becomes the restriction site of EcoRI. 15 bp above and below the mutation position was used as the upstream primer, and the downstream primer was its complementary strand. The resistance fragment Spec primer adds EcoRI restriction site sequence at the 5' end.

NopZ-D-F (GGAGACGGTCGGATGGAATTCGCGTTTGACCTCGTG, SEQ ID NO: 3), NopZ-D-R (CACGAGGTCAAACGCGAATTCCATCCGACCGTCTCC, SEQ ID NO: 4), Spec-D-F (ACTAGTAGTAAACTGGATGGCTTTCTTG, SEQ ID NO: 5), Spec-D-R (AC TAGTCTTTCAGCATCTTTTACTTTTCAC, SEQ ID NO: 6 ).

(1) Point mutation of NopZ mutation fragment

The reaction system (100 μL) is as follows: NopZ-F-pEasy-Blunt, 2 μg; 5×PS Buffer, 20 μL; dNTP, 8 μL; NopZ-DR, 2 μL; NopZ-DF, 2 μg; PrimeSTAR, 1.2 μL; ddH ₂ O, up to 100 μL;

PCR reaction conditions (14 cycles): 95°C, 10min; 95°C, 1min; 66.8°C, 1min; 68°C, 5min18s; 72°C, 10min; 4°C, Pause.

After the reaction was over, 1 μL DpnI was added, placed in a metal bath at 37° C., and digested for 1 hour. Transform into T1 Escherichia coli competent, perform PCR on the bacterial solution, and name it NopZ-EcoRI after sequencing. The sequence of the EcoRI restriction site is: GAATTC.

The Spec-resistant fragment was amplified, and the NopZ-EcoRI vector and the Spec fragment were digested with EcoRI as shown in SEQ ID NO:13:

Digestion system (150 μL): DNA, 6 μg; Cutsmart, 15 μL; EcoRI, 3 μL; ddH ₂ O, up to 150 μL; digestion product gel recovery, ligation system and reaction conditions (10 μL): vector, 0.5 μg; fragment, 2 μg ; Buffer, 1 μL; T4 ligase, 1 μL; ddH ₂ O, up to 10 μL; place in a metal bath at 16°C, connect overnight and transfer to E. coli competent. Spec.

Results: The Spec gene was inserted at 18 bp downstream of the start codon ATG of the NopZ mutant fragment, and the Spec gene was amplified with the primer Spec-F/R using the pEASY-T1 vector containing Spec resistance as a template. Design primers with EcoRI restriction site, NopZ mutant fragment and Spec gene for PCR amplification, connect the transformed bacterial liquid after enzyme digestion for PCR bacterial liquid identification, use NopZ-D-F and NopZ-D-R as primers for PCR amplification As shown in B in Figure 1.

4. Construction of recombinant suicide vector

Primer design: Analyze the restriction sites of the NopZ-D-Spec vector and the pJQ200SK vector, the restriction sites that the former does not have, and the restriction sites that exist in the latter are XBaI and XmaI, and design primers. Amplify NopZ-D-Spec with primer NopZ-dp-F/R, obtain gene sequence NopZ-dp sequence, NopZ-dp-F primer (TGCTCTAGACCGTGCGATAGTTGTGGTT, SEQ ID NO: 7); NopZ-dp-R primer (CCCCCCGGGTCACCTCCCAAATCCCAAA, SEQ ID NO: 8), the suicide vector and the gene sequence NopZ-dp sequence were purified by double enzyme digestion, then connected to pJQ200SK-NopZ, transformed into Escherichia coli competent, and after sequencing and comparison, a bacterial solution containing pJQ200SK-NopZ was obtained.

Embodiment 2. Construct the mutant of Rhizobium HH103

1. Triparental hybridization experiment method: Streak the Escherichia coli with pJQ200SK-NopZ on the LB solid medium containing Km and Gent resistance; streak the wild-type rhizobia HH103 on the TY solid medium containing Rif resistance Middle; Escherichia coli carrying the Helper plasmid was streaked on LB solid medium containing Km resistance. Cultivate overnight until a single clone grows; culture each of the three strains in 7mL of the corresponding medium until the OD ₆₀₀ value is about 0.65; each pipette 1mL into a new 1.5mL centrifuge tube, at room temperature Centrifuge at 12 000rpm for 30s, discard the supernatant, and resuspend repeatedly with 1 mL of TY without anti-antibody (adjust OD600 to 0.6); take 200 μL of the resuspended HH103 bacterial solution, pJQ200SK-NopZ Escherichia coli and Escherichia coli with Helper plasmid Add 100 μL of each to a new 1.5 mL centrifuge tube, centrifuge at 11995 rpm for 30 s, discard the supernatant, and resuspend with 20 μL of TY without anti-antibody; drop the mixed bacteria solution onto a solid medium plate without anti-TY for overnight culture; after overnight culture, Scrape the large spot and streak it to TY solid medium containing Rif/Spec (50mg/mL) resistance and culture until a single clone grows; continue to streak and screen the single clone, repeat 3 times; The clones were streaked on Rif/Spec (50 mg/mL) resistant TY solid medium containing 5% sucrose for screening, repeated 3 times; the screened mutant was named HH103ΩNopZ.

Mix the bacterial solution containing pJQ200SK-NopZ, HH103, and the bacterial solution containing the Helper plasmid in a ratio of 2:1:1 (volume ratio), and drop them on a solid medium plate without anti-TY for overnight cultivation. The sterilized pipette tip was scraped several times to scrape large spots, streaked to TY solid medium containing Rif/Spec (50mg/mL) resistance, and cultured until a single clone grew; the single clone continued to be streaked and screened, and repeated 3 times. times; the single clones screened for 3 times were streaked on the Rif/Spec (50mg/mL) resistant TY solid medium containing 5% sucrose for screening, repeated 3 times; the mutants screened were subjected to PCR, Southern blot After identification, it was named HH103ΩNopZ.

2. PCR identification of HH103ΩNopZ bacterial liquid: using three pairs of primers Nifh-F(R), Spec-F and NopZ-R, and NopZ mutant fragment-F(R) to amplify the mutant strain HH103ΩNopZ respectively, and by electrophoresis, it was observed that The target band was sequenced to verify the mutant.

Result: Amplified with primer Nifh-(F/R), NifH-F: CTA CTG CGG TGC TGC TAT (SEQ ID NO: 14); NifH-R: GTC CGT CTT GTC GTC CGC (SEQ ID NO: 15)

It was proved that the amplified bacteria liquid was Sinorhizobium, and the length was 960bp. The length amplified with primers Spec-F and NopZ-R should include the antibiotic fragment and the NopZ gene, and the length is 1778bp. The fragment amplified by the primer NopZ-LF (F/R) contains the NopZ gene and the suicide vector, and the length is 2681bp. Finally, the mutant HH103ΩNopZ was screened out, and the results are shown in FIG. 2 .

3. Southern blot identification:

(1) Restriction enzyme: HindⅢ (TAKARA company);

(2) Primers: design primers for labeled probes, including a part of the target gene and Spec gene, about 600bp in total, and design primers. S-NopZ-F: (TGATGGCACAGGCGAT, SEQ ID NO: 9), S-NopZ-R: (ACAGGCTTATCTTGGACA, SEQ ID NO: 10).

Results: As shown in Figure 3, the HH103ΩNopZ fragment of the mutant was about 1000bp more than the wild-type Rhizobium HH103 fragment after enzyme digestion, that is, the size of the Spec gene fragment, and the accuracy of the mutant HH103ΩNopZ was verified. The length of the amplification is consistent with the theory.

Example 3. Construction of anaplerotic strain pFAJ1702-NopZ and identification of nodulation ability

1. Design primers: start at about 500 bp before the NopZ start codon and end at NopZ as the amplified fragment. Use DNAMAN to analyze enzymes that cannot cut HindⅢ, BamHI, and design primers. pFAJ1702-NopZ-F (CCCAAGCTTCGTGCGATGCGCGAGATA, SEQ ID NO: 11), pFAJ1702-NopZ-R (CGCGGATCCTTACCGGAACTCGTTGCG, SEQ ID NO: 12).

The steps are: (1) Use pFAJ1702-NopZ(F/R) to amplify the whole genome of Sinorhizobium HH103, after purifying the product, carry out double enzyme digestion of the vector and NopZ target product for 3-5 hours, perform product purification after enzyme digestion, and ligate for 16 hours After that, it was transferred into Escherichia coli, and the bacterial solution was sequenced after PCR verification;

(2) An anaplerotic strain of NopZ was obtained by three-parent hybridization, and the anaplerotic strain was named HH103ΩNopZpFAJ1702-NopZ.

PCR identification of HH103ΩNopZpFAJ1702-NopZ strains: Use the primer NopZ mutant fragment-F(R) to amplify HH103ΩNopZpFAJ1702-NopZ, HH103 wild type and HH103ΩNopZ mutant strains respectively, and the latter two were used as controls, and the target band was observed by electrophoresis . Verify the complementing strain HH103ΩNopZpFAJ1702-NopZ.

RESULTS: Using the supplemented bacterial solution HH103ΩNopZpFAJ1702-NopZ, the wild-type strain HH103 and the mutant bacterial solution HH103ΩNopZ as templates, PCR identification was carried out with primers NopZ mutant fragment, (F/R). There are two target bands in the replenishment strain HH103ΩNopZpFAJ1702-NopZ, one is the same length as the amplified band of the wild-type strain HH103, and the other is the same length as the amplified band of the mutant strain HH103ΩNopZ, and the amplified length is consistent with the theory . As shown in Figure 4. After identification, it was named HH103ΩNopZpFAJ1702-NopZ.

Use the following experiments to verify the experimental results:

Identification of nodulation ability:

(1) Prepare soybean samples:

a) About 80 grains of the parents of chromosome segment substitution line (CSSL) SN14 and wild bean ZYD00006 were taken, and the surface of the seeds was sterilized with chlorine gas for 12 hours.

b) Take the seeds out of the ventilated storage, place them in a sterile and ventilated environment for about 20 minutes, and blow off the chlorine on the surface.

c) Assemble the double-layer bowl plant growth system. The growth system contains vermiculite and nitrogen-deficient nutrient solution. The double-layer bowl is sterilized at high temperature. The pot plant system was planted with 4 soybean seeds and covered with a double pot immediately after planting.

d) Wait for the seeds to germinate, and when they grow about 2.5cm, select the seedlings with roughly the same growth, sterilize the white stones at 120°C, and place them on the double-layer pot plant growth system after cooling. On the one hand, in order to reduce water Excessive loss, on the one hand, in order to prevent the infection of other bacteria. Every once in a while, pay attention to observe the consumption of nutrient solution in the system, and replenish it immediately.

(2) Prepare the inoculum solution:

a) Take out Sinorhizobium HH103, mutant HH103ΩNopZ, HH103ΩNopZpFAJ1702-NopZ and HH103ΩTtsI from the refrigerator, prepare corresponding resistant TY solid medium, streak each strain, and culture them in a 28°C incubator until long Single clones were selected and put into their resistant liquid medium to continue culturing and activating. The OD ₆₀₀ was about 0.6-0.8.

b) Take out 200 μL of each bacterial solution, and continue to put it into the corresponding resistant liquid medium for cultivation and activation, and the OD ₆₀₀ is about 0.65-0.85.

c) Prepare the sterilized magnesium sulfate solution (10mM) in advance, centrifuge the bacteria solution at 4000rpm for 10min, resuspend and wash the bacteria with 20mL magnesium sulfate solution and repeat 4 times.

d) Measure the OD value of the bacterial solution resuspended in magnesium sulfate solution (10mM), to ensure that the OD value of each bacterial solution is roughly the same, and prepare to inoculate soybeans (inoculate immediately after completion).

(3) Investigation of the inoculum liquid and its properties:

a) Wait for the soybean seedlings in the double-layer pot plant growth system to grow to the opposite true leaves. When they are fully expanded (about 1 week of growth), use a 2mL syringe to inoculate the soybean seedlings to ensure that the number of inoculated bacteria is consistent. After 30 days, inoculate the soybean seedlings The traits were investigated and counted.

b) Investigation method: The classification traits of individual soybean plants of Suinong 14 and wild bean ZYD00006 and inoculated with different bacterial solutions were investigated. Nodulation traits include (number, nodule size in 2 mm, dry weight, etc.).

(4) Nodulation phenotype analysis: 30 days after inoculation with Sinorhizobia HH103, mutants HH103ΩNopZ, HH103ΩNopZpFAJ1702-NopZ and HH103ΩTtsI (mutants that do not express effectors), the number of nodules and dry weight of nodules were analyzed and counted.

Results: The parents of the introduced line population constructed in our laboratory, Ben Suinong 14 and wild bean ZYD00006, were planted in a double-layer pot plant growth nutrient system as materials for identification of nodulation ability, and the soybean plants were inoculated with rhizobia to supplement the strains at the Vc stage. HH103ΩNopZpFAJ1702-NopZ, Sinorhizobium HH103, mutant HH103ΩNopZ and HH103ΩTtsI. Statistical analysis was performed on the nodulation traits one month after inoculation. As shown in Figure 5, Table 1 and Table 2. Compared with Sinorhizobium HH103 and HH103ΩTtsI, the NopZ mutation can cause significantly fewer nodule numbers, and can also cause a significant decrease in nodule dry weight. After inoculation with the replenishing strain HH103ΩNopZpFAJ1702-NopZ, the nodule number and nodule dry weight both increased, but not more than Sinorhizobium HH103 and HH103ΩTtsI.

Table 1 The number of root nodules after the parents of the introduced lines were inoculated with different strains

Table 2 Root nodule dry weight after inoculation of different strains by the parents of the introduced line

Note: * indicates significant difference at p<0.05 level

Example 2. Reagents for reducing the number of soybean nodules

Components of the reagent: mutant HH103ΩNopZ bacterial fluid.

Instructions:

(1) The mutant HH103ΩNopZ was cultured and activated, and the OD600 was controlled to be 0.65-0.86;

(2) Carry out 4000rpm, 10min centrifugation with the bacterium liquid obtained in step (1), carry out resuspension washing bacterium with 10mM magnesium sulfate solution and repeat 4 times; OD ₆₀₀ of the bacterium liquid after resuspending the magnesium sulfate solution=0.2;

(3) The soybean seedlings grow to the stage of opposite true leaves, inoculate the soybean seedlings, the number of inoculated bacteria is more than 2×10 ⁵ /plant, and cultivate the soybeans after inoculating the bacterial liquid for 30-40 days.

The reagent or the method can also be used in soybean breeding to reduce the number of nodules, reduce energy consumed by symbiotic nitrogen fixation, and ensure soybean yield.

SEQUENCE LISTING

<110> Northeast Agricultural University

<120> A Rhizobium HH103Ω Mutant and Its Application

<160> 15

<170> PatentIn version 3.5

<210> 1

<211> 19

<212> DNA

<213> Synthetic

<400> 1

ccgtgcgata gttgtggtt 19

<210> 2

<211> 19

<212> DNA

<213> Synthetic

<400> 2

tcacctccca aatcccaaa 19

<210> 3

<211> 36

<212> DNA

<213> Synthetic

<400> 3

ggagacggtc ggatggaatt cgcgtttgac ctcgtg 36

<210> 4

<211> 36

<212> DNA

<213> Synthetic

<400> 4

cacgaggtca aacgcgaatt ccatccgacc gtctcc 36

<210> 5

<211> 28

<212>DNA

<213> Synthetic

<400> 5

actagtagta aactggatgg ctttcttg 28

<210> 6

<211> 28

<212> DNA

<213> Synthetic

<400> 6

actagtcttc agcatctttt actttcac 28

<210> 7

<211> 28

<212> DNA

<213> Synthetic

<400> 7

tgctctagac cgtgcgatag ttgtggtt 28

<210> 8

<211> 28

<212> DNA

<213> Synthetic

<400> 8

ccccccgggt cacctcccaa atcccaaa 28

<210> 9

<211> 16

<212>DNA

<213> Synthetic

<400> 9

tgatggcaca ggcgat 16

<210> 10

<211> 18

<212> DNA

<213> Synthetic

<400> 10

acaggcttat cttggaca 18

<210> 11

<211> 27

<212> DNA

<213> Synthetic

<400> 11

cccaagcttc gtgcgatgcg cgagata 27

<210> 12

<211> 27

<212> DNA

<213> Synthetic

<400> 12

cgcggatcct taccggaact cgttgcg 27

<210> 13

<211> 1241

<212> DNA

<213> Synthetic

<400> 13

gcacgaaccc agtggacata agcctcgttc ggttcgtaag ctgtaatgca agtagcgtaa 60

ctgccgtcac gcaactggtc cagaaccttg accgaacgca gcggtggtaa cggcgcagtg 120

gcggttttca tggcttgtta tgactgtttt tttggggtac agtctatgcc tcgggcatcc 180

aagcagcaag cgcgttacgc cgtgggtcga tgtttgatgt tatggagcag caacgatgtt 240

acgcagcagg gcagtcgccc taaaacaaag ttaaacatca tgggggaagc ggtgatcgcc 300

gaagtatcga ctcaactatc agaggtagtt ggcgtcatcg agcgccatct cgaaccgacg 360

ttgctggccg tacatttgta cggctccgca gtggatggcg gcctgaagcc acagtgat 420

attgatttgc tggttacggt gaccgtaagg cttgatgaaa caacgcggcg agctttgatc 480

aacgaccttt tggaaacttc ggcttcccct ggagagagcg agattctccg cgctgtagaa 540

gtcaccattg ttgtgcacga cgacatcatt ccgtggcgtt atccagctaa gcgcgaactg 600

caatttggag aatggcagcg caatgacatt cttgcaggta tcttcgagcc agccacgatc 660

gacattgatc tggctatctt gctgacaaaa gcaagagaac atagcgttgc cttggtaggt 720

ccagcggcgg aggaactctt tgatccggtt cctgaacagg atctatttga ggcgctaaat 780

gaaaccttaa cgctatggaa ctcgccgccc gactgggctg gcgatgagcg aaatgtagtg 840

ccttacgttgt cccgcatttg gtacagcgca gtaaccggca aaatcgcgcc gaaggatgtc 900

gctgccgact gggcaatgga gcgcctgccg gccccagtatc agcccgtcat acttgaagct 960

agacaggctt atcttggaca agaagaagat cgcttggcct cgcgcgcaga tcagttggaa 1020

gaatttgtcc actacgtgaa aggcgagatc accaaggtag tcggcaaata atgtctagct 1080

agaaattcgt tcaagccgac gccgcttcgc ggcgcggctt aactcaagcg ttagatgcac 1140

taagcacata attgctcaca gccaaactat caggtcaagt ctgcttttat tatttttaag 1200

cgtgcataat aagccctaca caaattggga gatatatcat g 1241

<210> 14

<211> 18

<212>DNA

<213> Synthetic

<400> 14

ctactgcggt gctgctat 18

<210> 15

<211> 18

<212>DNA

<213> Synthetic

<400> 15

gtccgtcttg tcgtccgc 18

Claims (4)

1. A method for reducing soybean root nodule is characterized by that in the period of growing soybean seedling to true leaf, the Chinese rhizobium containing root nodule is applied to soybean seedlingSinorhizobium fredii ) Bacterial liquid of HH103 mutant with bacterial inoculation quantity of more than 2×10 ⁵ The strain/strain is used for culturing soybeans after inoculating bacterial liquid for 30-40 days, and the mutant is prepared by using sinorhizobium fischeriSinorhizobium fredii ) HH103 was the starting strain, and the starting strain was selected fromNopZObtained by gene deletion or silencing, theNopZThe nucleotide sequence of the gene is shown as Genbank accession number AY683479.17381bp to 7917bp of the sequence.

2. The method according to claim 1, wherein the bacterial liquid is prepared as follows:

(1) Activating mutant of sinorhizobium fisher HH103 in culture, and controlling OD ₆₀₀ 0.65-0.86; the mutant is prepared from Sinorhizobium fischeriSinorhizobium fredii ) HH103 was the starting strain, and the starting strain was selected fromNopZObtained by gene deletion or silencing, theNopZThe nucleotide sequence of the gene is 7381bp-7917bp of a sequence shown in Genbank accession number AY 683479.1;

(2) Centrifuging the bacterial liquid obtained in the step (1), collecting bacterial cells, washing, and re-suspending the bacterial cells with a magnesium sulfate solution to obtain bacterial liquid OD ₆₀₀ Reaching 0.2.

3. The use of a reagent containing a mutant of rhizobium HH103 for reducing the number of rhizobium in soybeans, wherein the soybean variety to which the reagent is applied is Sueinong 14 or wild soybean ZYD00006, and the mutant is prepared from Sinorhizobium fei @Sinorhizobium fredii ) HH103 was the starting strain, and the starting strain was selected fromNopZObtained by gene deletion or silencing, theNopZThe nucleotide sequence of the gene is 7381bp-7917bp of the sequence shown in Genbank accession number AY683479.1.

4. Use of a reagent comprising a mutant of rhizobium HH103 or a method according to claim 1 or 2 in soybean breeding, characterized in that the mutant is produced by the method of Sinorhizobium fisher @Sinorhizobium fredii ) HH103 was the starting strain, and the starting strain was selected fromNopZObtained by gene deletion or silencing, theNopZThe nucleotide sequence of the gene is 7381bp-7917bp of the sequence shown in Genbank accession number AY683479.1.

Images