CN115044522A - Rhizobium HH103 for expressing fluorescent gene and construction method and application thereof - Google Patents

Abstract

The invention discloses a rhizobium HH103 for expressing a fluorescent gene and a construction method and application thereof, belonging to the technical field of agricultural microorganisms. In order to find the infection line of the rhizobium more quickly and conveniently. The invention provides a rhizobium HH103 for expressing a fluorescent gene, wherein the rhizobium HH103 for expressing the fluorescent gene is obtained by expressing the fluorescent gene in an initial strain through a eukaryotic expression vector by taking the rhizobium HH103 as the initial strain, and the fluorescent gene is a GFP gene, a gus gene and an rfp gene. The rhizobium HH103 for expressing the fluorescent gene is applied to preparation of a kit for detecting the soybean infecting capacity of rhizobium.

Description

Rhizobium HH103 for expressing fluorescent gene and construction method and application thereof

Technical Field

The invention belongs to the technical field of agricultural microorganisms, and particularly relates to rhizobium HH103 for expressing a fluorescent gene, and a construction method and application thereof.

Background

The infection line of the rhizobium can be detected conventionally only by carefully observing the root hair in the early development stage of the root hair through a microscope under a lens through an optical microscope, a large magnification is needed, the infection line can be found only by carefully observing the root hair of one root through a microscope, and the infection line can be clear at a glance if a fluorescent line appears in a visual field after the root hair is marked by fluorescence.

Disclosure of Invention

The invention aims to find the infection line of rhizobium more quickly and conveniently.

The invention provides a rhizobium HH103 for expressing a fluorescent gene, wherein the rhizobium HH103 for expressing the fluorescent gene is obtained by expressing the fluorescent gene in an original strain through a eukaryotic expression vector by using the rhizobium HH103 as the original strain.

Further defined, the fluorescent gene is a GFP gene, a gus gene and an rfp gene.

Further limited, the sequence of the GFP gene is shown as SEQ ID NO. 3.

Further defined, the eukaryotic expression vector is a pSoy10 vector.

The invention provides a method for constructing rhizobium HH103 for expressing a fluorescent gene, which comprises the following steps: the fluorescent plasmid containing GFP is transferred into Rhizobium HH103 by rhizobium triparental hybridization.

Further limited, the method for constructing the fluorescent plasmid containing GFP gene is as follows: the GFP gene was amplified from the Fu28 vector using the ATGGTGAGCAAGGGCGAGGA and CTTGTACAGCTCGTCCATGCC sequences, and the nptII promoter, whose gene sequence is shown in SEQ ID NO.4, was cloned into pFAJ1702 along with the GFP gene by homologous recombination.

The invention provides a kit for detecting soybean infection capability of rhizobia, which contains the rhizobia HH103 for expressing a fluorescent gene.

The invention provides a method for detecting the formation of a rhizobium infection line, which comprises the following specific steps: and (3) selecting a soybean hairy root material to be detected, inoculating the rhizobium HH103 expressing the fluorescent gene, observing through a fluorescence confocal microscope, and counting the infection line.

The invention provides application of rhizobium HH103 for expressing a fluorescent gene in preparation of a kit for detecting soybean infection capability of rhizobium.

Has the advantages that: the infection line of the rhizobium can be detected conventionally only by carefully observing the root hair in the early development stage of the root hair through a microscope under a lens through an optical microscope, a large magnification is needed, the infection line can be found only by carefully observing the root hair of one root through a microscope, and the infection line can be clear at a glance if a fluorescent line appears in a visual field after the root hair is marked by fluorescence.

Drawings

FIG. 1 shows the construction of GmMPK6:3 × Myc overexpression vector; a: PCR detection of the bacterial solutions of Fu48 GmMPK6a:3 XMyc and Fu48 GmMPK6b:3 XMyc, lane 1 being GmMPK6a and lane 2 being GmMPK6 b; m: trans 2K Plus DNA marker. B: PCR detection of the bacterial solutions of pSoy10 Ubi: GmMPK6a:3 XMyc and pSoy10 Ubi: GmMPK6b:3 XMyc, lane 1 being GmMPK6a and lane 2 being GmMPK6 b; m: trans 2K Plus DNA marker.

FIG. 2 shows qRT-PCR detection and immunoblot analysis of GmMPK6s overexpressed hairy roots; a: relative expression of target genes MPK6a and MPK6b after empty vector, pSoy10 Ubi: GmMPK6a:3 XMyc and pSoy10 Ubi: GmMPK6b:3 XMyc hairy root transformation. Using GmUKN1(glyma.12g020500) as an internal reference gene, data are mean ± standard error of 3 biological replicates, Student's t test for significance analysis, representing P <0.01, representing P < 0.001. B: positive roots were analyzed by immunoblot and protein extraction efficiency was detected using Actin antibody. EV stands for pSoy10 empty, OE-MPK6a stands for pSoy10 Ubi: GmMPK6a:3 XMyc, OE-MPK6b stands for pSoy10 Ubi: GmMPK6b:3 XMyc.

Fig. 3 is GmMPK6a and GmMPK6b overexpressing hairy root nodose phenotype; a: pSoy10 Ubi: GmMPK6a:3 XMyc, pSoy10 Ubi: GmMPK6b:3 XMyc and empty vector were inoculated with hairy root phenotype plots of HH103 and rhcN mutants, respectively, EV for pSoy10 empty, OE-MPK6a for pSoy10 Ubi: GmMPK6a:3 XMyc, OE-MPK6b for pSoy10 Ubi: GmMPK6b:3 XMyc, at a scale bar of 1 cm. B: boxplot of root nodule phenotype of hairy root transformed and over-expressed GmMPK6, significance analysis was performed using Student's t test, where "×" represents P <0.001 and "×" represents P < 0.01. n is 20.

FIG. 4 is a schematic of the structure of the gene edits GmMPK6a and GmMPK6 b; the structural schematic diagram of the gene editing of GmMPK6a and GmMPK6b comprises a target sequence of sgRNA, PAM site information and positions of MPK6a-Cas-TF (R) and MPK6b-Cas-TF (R).

FIG. 5 shows the editing test of GmMPK6a and GmMPK6b genes; a: the editing condition of the soybean hairy root material edited by 5 strains of genes is detected by PCR identification. M: DL5000 DNAmarker; 0: dongnong50 wild type; 1-15 gene edited hairy roots. B: and (4) determining the conditions of the GmMPK6a and GmMPK6b gene editing sites after sequencing.

FIG. 6 is the nodulation phenotype of knockout GmMPK 6; a: pSoy10 GmMPK6-Cas9 and empty vector pSoy10 were inoculated with HH103 and rhcN mutant hairy root phenotype maps, EV: an empty vector, pSoy 10; KO: knockout is pSoy10 GmMPK6-Cas 9. The scale bar is 1 cm. B: boxplots of root nodule phenotype of hairy root transformed pSoy10 GmMPK6-Cas9 were subjected to significance analysis using Student's t test, where "×" represents P <0.001, "×" represents P <0.05 and "ns" represents P > 0.05. n is 15.

FIG. 7 shows the expression pattern of GmMPK6, A expressed in the root tip; b is the expression pattern of GmMPK6a and GmMPK6B in soybean roots;

FIG. 8 shows PCR detection of pFAJ1702 nptII GFP; PCR detection of pFAJ1702 nptII GFP in bacterial suspension M: trans 2K Plus II DNA marker. 1: pFAJ1702 nptII GFP.

FIG. 9 is a microscopic examination of triparental hybrid monoclonal colonies; the white arrows indicate GFP-positive monoclonal colonies.

FIG. 10 is a PCR assay of GFP-tagged Rhizobium; the genes detected from top to bottom are nptii, GFP, TtsI and upstream fragments thereof, and NifH, P: positive Control, FAJ1702 npt II GFP; n: negative Control, HH103 wild type; m: trans 2K Plus DNAmarker.

FIG. 11 is a graph showing nodulation ability identification of HH103 and HH 103-GFP; a is the statistics of the number of nodules of HH103 and HH103-GFP (28 dpi). B: dry weight boxed plots of HH103 and HH103-GFP (28 dpi). C: histogram of the haemoglobin content of Ozobium japonicum of HH103 and HH103-GFP (28 dpi). D: rhizobium azotase activity of HH103 and HH103-GFP (28 dpi). All A-D were analyzed for significance using the t-test, with ns "representing P > 0.05.

Fig. 12 is a statistics of invasion events of overexpressing GmMPK6, a: the shape of the constructed GFP-marked rhizobium bacterial liquid under a fluorescent body type microscope; b: cartoon schema diagrams of foci, IT, and rIT; c: schematic diagrams of three infection events observed by the fluorescent rhizobia, wherein the scale bar is 20 micrometers; d: statistical boxplot of the infection events of soybean hairy roots overexpressing GmMPK6a and GmMPK6b after inoculation of fluorescently labeled rhizobia (24 hpi). foci represents the infection site; IT represents an invasion line that does not enter the cortex; rIT represents the line of infection that has entered cortical cells; EV represents pSoy10 empty; OE-MPK6a represents pSoy10 Ubi: GmMPK6a:3 XMyc; OE-MPK6b represents pSoy10 Ubi: GmMPK6b:3 XMyc; 24hpi represents inoculation of fluorescence labeling rhizobium for 24 h; ". indicates that P < 0.001" ns "indicates that P > 0.05. n is 24.

Detailed Description

The effect of the Rhizobium japonicum HH103 rhcN mutation on nodulation ability [ J ] Chinese agriculture 2021,54(6):13.

HH103 Ω TtsI (effector non-expressing mutants) are described in tenboyu, grand shijun, liu funexi, et al, rhizobia TtsI mutant construction and nodulation phenotype identification [ J ] proceedings of oil crops in china 2020, v.42; no.179(01) 21-28.

The pEASY-T1 vector, helper (Km) vector, pFAJ1702(Tet) vector and pGWC vector were all purchased commercially.

pJQ SK vector (Gm) is described in Quandt, J., & Hynes, M.F. (1993) Versatile suicide vectors white allow direct selection for gene replacement in Gram-negative bacteria, Gene,127(1), 15-21. doi: 10.1016/0378-.

Genome-wide introgression Lines (CSSL) are described in article chenqing, and "construction and use of crop backcross introgression Lines".

A Recombinant Inbred line population (RIL) is described in [1] Wangzhong forest, the construction of a soybean Recombinant Inbred line population, the identification and the research of the major agronomic trait QTL positioning thereof [ D ]. Nanjing agriculture university, 2001.

Suinong14 (Suinong14, SN14), Dongnong50 (Dongnong50, DN50), wild bean ZYD00006 Suinong14, Charleston, Dongnong 594, Hehe 00-23, Hongfeng 11, Sul02-339, Philippine No.2, Nattosan, Heilong44, Heilong35 and Beifeng 11 are all common varieties in Heilongjiang, and come from the key laboratory of the department of Soybean biology education of northeast university of agriculture.

Rhizobium freundii HH103 (from Francisco Javier L Lopez-Baena laboratories, university of Spanish Sevilla, described in Weidner S, Becker A, Bonilla I, et al.

Escherichia coli (Escherichia coli) strain DH5 α; agrobacterium Tumefaciens (Agrobacterium Tumefaciens) strain EHA 105; agrobacterium rhizogenes strain K599; sinorhizobium fastigiatum (Sinorhizobium fredii) strain HH103 is a common strain.

2 × TY liquid medium: 16g of tryptone (bacto-tryptone), 10g of yeast extract (bacto-yeast extract), 5g of NaCl, 1000mL of water, pH7.2 and sterilization at 121 ℃ for 30min.

dpi, days post inoculation.

hpi, hour post inoculation, hours of hops inoculation.

The Fu series vectors including Fu48, Fu76, Fu76-Cas9, Fu79-GUS and Fu79-2 × sgRNA were all given as gifts by the FuYongfu researchers (institute of crop science, national academy of agricultural sciences); the plant expression vector pSoy10 was gifted by FuYongfu researchers (the institute of crop science, academy of agricultural sciences, China); the plant ubiquitin promoter Fu76-Ubi is transformed from Fu76 and is provided by laboratory preservation. Eukaryotic expression vector pGWB5 was provided by professor Tsuyoshi Nakagawa.

Carrier skeleton records website: TAIR-Home Page (arabidopsis.

Fu79-2 × sgRNA was ligated to Fu79 vector with sequence 1: aagccaccatcatgcccatcgg and SEQ ID NO: ccctccgtgaaatcaagctgctt are provided. Sequences 1 and 2 are sgrnas. Sequence 1: aagccaccatcatgcccatcgg is sgRNA of GmMPK6a, sequence 2: ccctccgtgaaatcaagctgctt is sgRNA of GmMPK6 b.

The Fu76-Ubi vector refers to the connection of the Ubi sequence on the Fu76 vector. The sequence of Ubi is shown in SEQ ID NO. 7.

UbiFu 48-fusion of 3 Myc tags means that 3 Myc sequences are ligated to the Fu48 vector. The sequence of 3 myc is shown in SEQ ID NO. 8.

Fu79-GUS refers to the connection of GUS sequence on the Fu79 vector. The GUS sequence is shown in SEQ ID NO. 9. Fu76-Cas9 refers to sgRNA sequences that link GmMPK6a and GmMPK6b on a Fu76 vector.

Example 1 construction of MPK6 Gene overexpression vector

The soybean material is grown under long-day condition of 25 deg.C (16hr light/8 hr dark) at constant temperature; nicotiana benthamiana was grown under long-day conditions at 23 deg.C (16hr light/8 hr dark).

1. Gene cloning and vector construction

Construction of GmMPK6 promoter vector: a2000 bp fragment (GmMPK6apro,2000bp, SEQ ID NO.1) upstream of a Transcription Start Site (TSS) of GmMPK6, a 2000bp fragment (GmMPK6bpro, 2000bp, SEQ ID NO.2) upstream of GmMPK6b TSS, a 2000bp fragment (GmMPK6bpro, 2000bp, SEQ ID NO.2) were ligated to an entry vector Fu76(Lu M, Cheng Z, Zhang X M, et al. spatial dictionary of PHR-PHT1 Modules Maintainains phosphor Homeostasis in Soybean nodueles [ J ]. Plant Physiology,2020.) by cleaving with EcoR I and EcoRV cloning sites, respectively, and then the target fragment was transferred with Fu79-GUS to a eukaryotic expression vector pSoPSYPSYP 10 by a GmLR reaction to obtain pSoPSYP 10: GmMPK6 apo and MPoGUS 10.

Construction of GmMPK6 overexpression vector: the Coding region of GmMPK6a (SEQ ID NO.10, Glyma.02g138800) and the Coding region of GmMPK6b (SEQ ID NO.11, Glyma.07g206200) (Coding sequence, CDS) were amplified with MPK6a-F (R) and MPK6b-F (R), respectively, the CDS of GmMPK6a and GmMPK6b were ligated to entry vector Fu48 fusion of 3 Myc tags by means of EcoR V and Kpn I cloning sites, and then the Coding region of GmMPK6a and the Coding region of GmMPK6b on entry vector Fu48 were transferred to eukaryotic expression vector pSoy10 with Fu76-Ubi by means of an EcoR reaction to obtain pSoy10 Ubi: GmMPK6a:3 × Myc and pSoY10 Ubi: 3 × 3 GmMPK 35: 3 × 6 b. The partial vector is used for hairy root transformation of soybean GmMPK6 overexpression.

In order to verify the influence of GmMPK6 on symbiotic nodulation, the research verifies that the overexpression GmMPK6 regulates the establishment of a symbiotic system of soybean and rhizobium. Cloning the target fragment by using GmMPK6aOE-F (R) and GmMPK6aOE-F (R), and after the electrophoresis bands are detected to be correct, carrying out enzyme digestion and connection on Fu48 and the amplified fragment by using EcoR V and Kpn I, converting the Escherichia coli, and successfully carrying out bacteria liquid PCR verification (shown in A in figure 1). The coding region of GmMPK6a on Fu48 GmMPK6a:3 XMyc and Fu48 GmMPK6B:3 XMyc, respectively, and the coding region of GmMPK6B and a fragment of Fu76-Ubi were then transferred to the binary vector pSoy10 by Gateway reaction, and verified successfully by bacterial fluid PCR (B in FIG. 1), and named pSoy10 Ubi: GmMPK6a:3 XMyc and pSoy10 Ubi: GmMPK6B:3 XMyc after the sequencing was successful.

2. Hairy root transformation:

selecting plump semen glycines seed, sterilizing by fumigation with chlorine for 8hr, taking out, placing in a superclean bench, blowing off chlorine, and soaking in sterilized ultrapure water for 16hr until radicle is elongated.

Selecting K599 Agrobacterium containing target vector, identifying single clone (transformation and PCR identification methods are same as 2.2.5.1), activating, and culturing in YEP culture medium (5 g. L) ^-1 A yeast extract; 10 g.L ^-1 Peptone; 5 g.L ^-1 NaCl; pH 7.0) was shake-cultured to the bacterial liquid OD ₆₀₀ The values were around 1.0, RCF 1700g centrifuged for 20min and resuspended in LCCM liquid medium (1/10 XGamborg B5 salt; 30 g.L) ^-1 Sucrose; 3.9 g.L ^-1 MES; pH 5.4; sterilizing, adding 40 mg/L ^-1 Acetosyringone);

cutting off the soaked soybean radicle part, reserving hypocotyl and cotyledon close to cotyledonary node, soaking the explant in the heavy suspension bacterial liquid for 20min to complete infection. After infection, explants were placed on filter paper and blotted dry, and transferred to coculture medium (1/10 × Gamborg B5 salt; 30 g.L) ^-1 Sucrose; 3.9 g.L ^-1 MES；4.25g·L ^-1 Agar; pH 5.4; adding 400 mg.L after sterilization ^-1 Cysteine；154.2mg·L ^-1 Dithiothrietol；40mg·L ^-1 Acetosyringone), dark culture for 48 hr.

The hypocotyls of co-cultured soybean explants were inserted perpendicularly into a medium containing hairy root induction (1 XGamborg B5 salt; 30 g.L) ^-1 Sucrose; 0.59 g.L ^-1 MES；7g·L ^-1 Agar; pH 5.7; sterilizing, adding 100 mg/L ^-1 Timentin；100mg·L ^-1 Cefotaxime), and culturing for 14 days under 16hr light and 8hr dark.

And when the hairy roots grow to 2cm, removing the hairy roots from the culture medium, screening positive roots by using a fluorescence body type microscope, and shearing off non-positive roots to obtain transgenic hairy roots for subsequent experiments.

A pSoy10 GmMPK6pro GUS series expression vector; pSoy10 Ubi: GmMPK6:3 XMyc series expression vector; and introducing the soybean hairy roots into an agrobacterium rhizogenes K599 strain to transform the soybean hairy roots to respectively obtain different transgenic hairy roots.

3. Immunoblot detection of overexpressing positive hairy roots: after microscopic extraction, the positive overexpressing GmMPK6 roots were ground in liquid nitrogen and dispensed into 1.5ml centrifuge tubes at a volume of 0.2g, 500. mu.L of a vegetable protein extraction buffer (0.4M sucrose, 10mM Tris-HCl pH 8.0, 0.05% Triton X-100, and 1 Xprotease inhibitor) was added, and the supernatant was centrifuged at 14000g for 20min at RCF after 30min in ice bath. mu.L of 6 XP loading buffer (10% w/V SDS, 1M Tris-HCl pH 8.0, 30% V/V glycerol, 0.5M dithiothreitol and 10mM bromophenol blue) was added to 100. mu.L of pipette tip and boiled at 100 ℃ for 7min, and after centrifugation, SDS-PAGE vertical gel electrophoresis was performed, 15% SDS-PAGE color gel preparation kit was used to prepare PAGE gels, and MOPs electrophoresis buffer was used at 120V for 30min. And carrying out Western Blot detection after electrophoresis is finished.

In order to further detect the positive roots, the positive roots are detected by qRT-PCR and Western blotting, and the results are shown in a figure (figure 2) that the corresponding genes are obviously expressed after GmMPK6a and GmMPK6b are respectively over-expressed. And to study the effect of a single gene on the nodulation phenotype, the expression of endogenous GmMPK6b was analyzed by analyzing the expression of homologous genes, i.e., when GmMPK6a was overexpressed, and the results are shown in the figure: homologous genes are not significantly differentially expressed. And the immunoblotting detection is carried out on positive roots subjected to microscopic examination, an Actin antibody is used as an internal reference antibody, the extraction efficiency of protein is detected, clear strips can be seen, and the result shows that both pSoy10 Ubi, GmMPK6a, 3 xMyc and pSoy10 Ubi, GmMPK6b, 3 xMyc have successfully transformed soybean hairy roots, the expression of homologous genes is not obviously influenced, the expression is single expression, and the subsequent identification of nodule phenotype can be carried out on single genes so as to research the influence of overexpression of the genes GmMPK6a and GmMPK6b on the nodule phenotype.

Example 2 construction of MPK6 Gene knockout vector

CRISPR-Cas9 vector construction of GmMPK6: with GmMPK6a and GmMPK6b as target genes, sgRNAs of the target genes are designed through a CRISPR-P tool (http:// CRISPR. hzau. edu. cn/cgi-bin/CRISPR2/CRISPR), 2 target genes with higher scores and closer distances are selected from each target gene, target sequences which are all in an exon region are editing sites of CRISPR-Cas9, and then two target sequence fragment sequences 1: aagccaccatcatgcccatcgg (SEQ ID NO.12), SEQ ID NO. 2: ccctccgtgaaatcaagctgctt (SEQ ID NO.13), (B in FIG. 5) and ligated to the Fu79-2 × sgRNA vector with Bsa I and BspQ I, respectively, to obtain an entry vector for CRISPR-Cas 9. Finally, the entry vector and the Fu76-Cas9 target fragment are replaced on the pSoy10 through an LR reaction to obtain the gene editing vector pSoy10 GmMPK6-Cas 9.

The result of over-expressing GmMPK6a and GmMPK6b shows that GmMPK6 negatively regulates symbiotic nodulation, and GmMPK6a and GmMPK6b have higher homology and similar functions, so as to further verify that GmMPK6 negatively regulates symbiotic nodulation. Double knockout of GmMPK6a and GmMPKb was performed using gene editing technology, sgRNA of the target gene (sequence 1: Aagccaccatcatgcccatcgg is sgRNA of GmMPK6a, sequence 2: ccctccgtgaaatcaagctgctt is sgRNA of GmMPK 6b) was linked to Fu 792 × sgRNA with Bsa I and BspQ I, respectively, by CRISPR online tool design 2, and was named Fu79-sgRNA-T1T2 after successful sequencing. Then, target fragments of Fu79-sgRNA-T1T2 and Fu76-Cas9 are replaced into pSoy10 through Gateway reaction, sequencing is successfully named as pSoy10 GmMPK6-Cas9, and the strain K599 is transferred to carry out hairy root transformation and carry out gene editing detection for evaluating editing efficiency, wherein the gene editing detection is schematically shown in figure 4.

Screening positive roots through RFP fluorescence, selecting 3 positive roots of each soybean hairy root material edited by 5 strains of genes and wild Dongnong50 to respectively extract DNA, respectively carrying out PCR amplification by utilizing MPK6cas1-F (R) (MPK6a), MPK6cas2-F (R) (MPK6b) primers, and carrying out detection on gene editing efficiency and editing mode. Fragment loss occurred in both MPK6a and MPK6b, with one third of MPK6a undergoing gene editing. To further confirm the short fragment as the expected gene editing fragment, sequencing identification was performed by ligation of the T-vector, and the results are shown in the figure (B in fig. 5), which is in line with experimental expectations. In conclusion, the obtained pSoy10 GmMPK6-Cas9 vector can generate expected gene editing, can provide a material basis for subsequent further MPK6 gene function research, has good editing efficiency, and can be used for verifying the nodulation phenotype after knockout of the GmMPK6 by using hairy root transformation.

2. Hairy root transformation:

selecting plump semen glycines seed, sterilizing by fumigation with chlorine gas for 8hr (hr), taking out, placing in a super clean bench, blowing off chlorine gas, and soaking in sterilized ultrapure water for 16hr until radicle is elongated.

Selecting K599 Agrobacterium containing target vector, identifying single clone (transformation and PCR identification methods are same as 2.2.5.1), activating, and culturing in YEP culture medium (5 g. L) ^-1 A yeast extract; 10 g.L ^-1 Peptone; 5 g.L ^-1 NaCl; pH 7.0) was shake-cultured to the bacterial liquid OD ₆₀₀ The values were around 1.0, RCF 1700g centrifuged for 20min and resuspended in LCCM liquid medium (1/10 XGamborg B5 salt; 30 g.L) ^-1 Sucrose; 3.9 g.L ^-1 MES; pH 5.4; sterilizing, adding 40 mg/L ^-1 Acetosyringone);

cutting off the soaked soybean radicle part, reserving hypocotyl and cotyledon close to cotyledonary node, soaking the explant in the heavy suspension bacterial liquid for 20min to complete infection. After infection, explants were placed on filter paper and blotted dry, and transferred to coculture medium (1/10 × Gamborg B5 salt; 30 g.L) ^-1 Sucrose; 3.9 g.L ^-1 MES；4.25g·L ^-1 Agar; pH 5.4; adding 400 mg.L after sterilization ^-1 Cysteine；154.2mg·L ^-1 Dithiothrietol；40mg·L ^-1 Acetosyringone), dark culture for 48 hr.

The hypocotyls of co-cultured soybean explants were inserted perpendicularly into a medium containing hairy root induction (1 XGamborg B5 salt; 30 g.L) ^-1 Sucrose; 0.59 g.L ^-1 MES；7g·L ^-1 Agar; pH 5.7; sterilizing, adding 100 mg/L ^{- 1} Timentin； 100mg·L ^-1 Cefotaxime), and culturing for 14 days under 16hr light and 8hr dark.

And when the hairy roots grow to 2cm, removing the hairy roots from the culture medium, screening positive roots by using a fluorescence body type microscope, and shearing off non-positive roots to obtain transgenic hairy roots for subsequent experiments.

The soybean CRISPR Cas9 series vectors of pSoy10 GmMPK6-Cas9 are respectively introduced into an agrobacterium rhizogenes K599 strain to carry out soybean hairy root transformation, and different transgenic hairy roots are respectively obtained.

3. And (3) detecting the gene editing efficiency: extracting the positive hairy roots edited by the GmMPK6 gene after microscopic examination, grinding by liquid nitrogen, subpackaging 0.2g of the ground positive hairy roots in a 1.5ml centrifuge tube, and extracting the soybean DNA. The DNA extraction method is as follows:

(1) adding small steel balls into a 1.5ml centrifuge tube for subpackaging samples, and grinding for 3min by oscillating a grinder at 60% rated power;

(2) adding 500 μ L CTAB extracting solution, and shaking with vortex oscillator to completely disperse tissue powder in CTAB extracting solution;

(3) placing a 1.5mL centrifuge tube in an oven, and treating for one hour at 65 ℃ while gently shaking for a plurality of times;

(4) centrifuging the reaction solution at room temperature for 20min under the condition that RCF is 12000 g;

(5) after the centrifugation is finished, taking the supernatant, adding 600 mu L of chloroform, centrifuging by a centrifuge, and centrifuging for 20min, wherein RCF is 12000 g;

(6) collecting supernatant, adding 200 μ L of pre-cooled isopropanol at-20 deg.C;

(7) centrifuging by a centrifuge at 12000g for 20min, discarding the supernatant, and respectively adding absolute ethyl alcohol and 75% ethyl alcohol to wash DNA precipitate twice;

(8) after the DNA is dried in the air, adding sterilized water, and storing at-20 ℃ after the DNA is completely dissolved.

After DNA extraction, primers MPK6a-Cas-TF (R) and MPK6b-Cas-TF (R) are used for PCR amplification, and after detection of an amplification product through agarose electrophoresis, a TA clone is recovered from the product and connected with pGWC, sequencing verification is carried out, and the obtained product is compared with a Wm 82 reference genome.

Example 3 construction of fluorescent complementation vector for Rhizobium

1. GFP was amplified from the Fu28 vector using GFP-F (R), the nptII promoter and GFP were cloned into pFAJ1702 by homologous recombination, and after successful sequencing, the resulting vector was renamed pFAJ1702 nptII: GFP. Or amplifying the gus gene from a Fu28 vector, cloning nptII promoter and gus to pFAJ1702 by a homologous recombination method, and obtaining the vector which is renamed to pFAJ1702 nptII: gus after the sequencing is successful. Or amplifying the rfp gene from a Fu28 vector, cloning the nptII promoter and the rfp to the pFAJ1702 by a homologous recombination method, and obtaining the vector renamed pFAJ1702 nptII: rfp after successful sequencing.

RNA extraction and qRT PCR

Extracting total RNA of soybean: total RNA extraction of soybean tissue using TRIzol was performed as follows:

(1) putting the mortar into liquid nitrogen precooled soybean tissue sampling material, putting the soybean tissue sampling material into the mortar, fully grinding the soybean tissue sampling material in liquid nitrogen, and subpackaging the soybean tissue sampling material in a 1.5mL RNase-free EP tube;

(2) adding 1mL of TRIzol liquid into the centrifuge tube in the step (1), standing on ice for 15min, uniformly mixing by vortex, and standing at room temperature for 10 min;

(3) centrifuging at 4 deg.C for 10min at RCF of 12,000g, and collecting supernatant in a new RNase-free centrifuge tube;

(4) repeating the step (3), sucking 200 mu L of chloroform and a centrifuge tube, uniformly mixing the chloroform and the centrifuge tube with a vortex mixer, and carrying out ice bath for 10 min;

(5) centrifuging at 4 deg.C for 10min at RCF of 12,000g, and removing supernatant;

(6) sequentially sucking 700 mu L of absolute ethyl alcohol and 300 mu L of DEPC water into a centrifuge tube, centrifuging for 10min at 4 ℃ under the RCF (residual centrifuge factor) of 12,000g, and discarding the supernatant and repeating twice;

(7) centrifuging at 4 deg.C for a short time, sucking out supernatant, standing at room temperature, and drying;

(8) adding 50 mu L DEPC water, and gently and uniformly mixing;

(9) dissolving in water bath at 60 deg.C for 2min, and measuring concentration;

qRT PCR detection of Gene expression: the extracted total soybean RNA was subjected to cDNA synthesis, and purchased from norgestrel using HiScript II Reverse Transcriptase, as follows:

(1) removal of genomic DNA: the following components were added to a 200. mu.L RNase-free PCR tube: 4 XgDNA wiper Mix, 2. mu.L; template RNA, 1. mu.L; RNase Free ddH ₂ O, up to 8. mu.L, reaction conditions: 42 ℃ for 2 min;

(2) RNA reverse transcription: the following ingredients were added to a 200 μ L centrifuge tube: 5 xqRT Supermix II, 2. mu.L; 8 mu L of reaction liquid in the step (1); reaction conditions are as follows: 50 ℃ for 15 min; 2min at 85 ℃;

(3) the resulting cDNA was stored at-20 ℃ for subsequent detection of gene expression.

GmUKN1(Glyma.12g020500) was used as a quantitative internal reference gene, specific quantitative primers for GmMPK6s and nodulation Marker gene were designed, and 2 was used as a quantitative result ^-ΔΔCT Algorithm for relative quantitative analysis of Gene expression levels, using 2 ^-ΔCT The algorithm performs a GmMPK6 tissue specific expression analysis.

The following ingredients (20. mu.L) were added to a 200. mu.L RNase-free PCR tube: ChamQ Universal SYBR qPCR Master Mix, 10 μ L; forward primer (10. mu.M), 0.4. mu.L; downstream primer (10. mu.M), 0.4. mu.L; cDNA, 100 ng; RNase Free H ₂ O, Up to 10. mu.L; the Real-time PCR reaction adopts a two-step method (2-3 steps set for 35 cycles) as follows: at 95 ℃ for 20 s; 93 ℃ for 10 s; 65 ℃ for 20 s.

Example 4 construction and identification of Fluororhizobium

GFP-tagged HH103 strain construction: the complementation fluorescent plasmid pFAJ1702 nptII GFP was transferred to Rhizobium HH103 by rhizobium triparental hybridization. The rhizobium triparental hybridization comprises the following specific steps:

rhizobium HH103 and HH 103. omega. RhcN were streaked and incubated with Rif (50mg/mL) in TY solid medium at 28 ℃ until single colonies grew;

selecting a single clone in a Rif (50mg/mL) TY liquid culture medium, activating rhizobia, streaking a anaplerotic vector strain (pFAJ1702 npt II: GFP, Tet +) and an autonomous transfer strain Helper (pRK2013, Km +) on a LB solid culture medium with corresponding resistance the next day, and culturing overnight until the single clone grows out;

selecting anaplerotic strain (pFAJ1702 nptII: GFP, Tet +) and autotransfer strain Helper (pRK2013, Km +) to be monoclone in liquid LB culture medium with corresponding resistance, and activating at 37 ℃;

respectively sucking 50 μ L of three bacterial liquids and 10mL of corresponding culture medium to culture OD600 value to 0.6-0.8 (when the Rhizobium OD600 value is 0.3, two kinds of Escherichia coli are cultured, and the OD600 values of the three kinds of Escherichia coli can almost reach 0.6 simultaneously;

culturing the three bacteria to the same OD600 value, putting 500 mu L of each of the three bacteria into a 1.5mL centrifuge tube, centrifuging at 12000rpm for 1min, discarding supernatant, and resuspending 1mL of nonreactive TY;

adjusting the ratio of rhizobium pFAJ1702 nptII to GFP to the bacterial liquid of the autonomous transfer strain to be 1:2:2, namely 100 mu L of the resuspended HH103 bacterial liquid, 200 mu L of each pFAJ1702 nptII to GFP bacterial strain and autonomous transfer strain Helper, adding the bacterial liquid into a 1.5ml centrifuge tube, centrifuging at 12000rpm for 1min, discarding the supernatant, and resuspending with 30 mu L of nonreactive TY;

dripping 20 μ L of mixed bacteria onto non-anti TY solid culture medium plate, culturing at 28 deg.C for 36hr-48 hr;

scraping lawn to TY solid culture medium containing Rif and Tet, and culturing at 28 deg.C until monoclone grows;

selecting single clone, culturing in antibiotic-containing TY solid culture medium at 28 deg.C, screening, and repeating for 2-3 times.

The selected candidate colonies were picked in TY liquid medium containing Rif and Tet and cultured at 28 ℃ for subsequent PCR identification.

PCR identification of GFP-tagged HH 103: the candidate bacterial solution was identified by PCR, and HH103 derived from GFP-tagged was designated as HH103-GFP after the identification. As primers for identification, GFP-F (R) and Rhizobium conserved gene primers NifH-F (R) and TtsI-F (R) were used.

PCR identification of gus-tagged HH 103: candidate bacterial solutions were identified by PCR, and HH103 derived from gus-tagged was named HH103-gus after no errors were identified. PCR identification of rfp-tagged HH 103: candidate bacterial liquids were identified by PCR, and the rfp-tagged HH103 was named HH103-rfp after the identification.

The primer sequences used are shown in Table 1.

1 primer information

GFP gene sequence (SEQ ID NO. 3).

1. Big (a)Bean nodulation test: culturing soybean in double-layer pot until the first three-leaf complex leaf is developed (transplanting soybean hairy root into double-layer pot and then seedling for 2-3 days), inoculating Rhizobium fast-growing (Sinorhizobium fredii) HH103 and HH103 omega RhcN, placing in greenhouse for normal culture, and allowing soybean material to grow under 25 deg.C long-day condition (16hr light/8 hr dark) at constant temperature; nicotiana benthamiana was grown under long-day conditions at 23 deg.C (16hr light/8 hr dark). The formula of TY culture medium for culturing rhizobium HH103 is as follows: 3 g.L ^-1 Yeast extract, 5 g.L ^-1 Peptone, 0.4 g.L ^-1 Calcium chloride pH 7.0. The formula of the plant low-nitrogen nutrient solution comprises the following components: 0.5. mu.M zinc sulfate, 0.25. mu.M magnesium sulfate, 2. mu.M boric acid, 1mM calcium chloride, 1. mu.M manganese sulfate, 0.25. mu.M potassium sulfate, 0.2. mu.M copper sulfate, 0.1. mu.M cobalt sulfate, 100. mu.M monopotassium phosphate, 10. mu.M ferric citrate, 0.1. mu.M sodium molybdate and 1. mu.M potassium nitrate, and the pH was adjusted to 5.8.

As a result: overexpression of GmMPK6 inhibited nodulation: agrobacterium rhizogenes K599 carrying pSoy10 Ubi: GmMPK6a:3 XMyc and pSoy10 Ubi: GmMPK6b:3 XMyc eukaryotic expression vectors was subjected to soybean hairy root transformation and pSoy10 empty load was used as a negative control. Due to the presence of DsRED selection marker in pSoy10 vector, non-positive roots were removed using fluorimetric microscopy.

Positive roots were screened and inoculated with rhizobium HH103 and rhcN mutants, respectively, and the root nodule phenotype was counted after inoculation for 28d, with the results shown in the figure (fig. 3), and the number of nodules and the dry weight of nodules significantly decreased after inoculation of HH103 and rhcN mutants with overexpression of GmMPK6a and GmMPK6 b. Meanwhile, the over-expressed GmMPK6a and GmMPK6b have no obvious difference in the number of nodules after rhizobium inoculation, while the dry weights of the nodules have large difference, which indicates that the GmMPK6a and the GmMPK6b have similar functions in the rhizobium infection period, and the GmMPK6b also acts on the nodule development process, and is conjectured by combining promoter element analysis and tissue expression qRT-PCR, and the GmMPK6b is probably capable of inhibiting the nodule development in the later stage of nodulation. In conclusion, both GmMPK6a and GmMPK6b negatively regulate symbiotic nodules and perform similar functions when nodule symbiosis is established.

When the rhcN mutant is inoculated, the number of nodules of the over-expressed GmMPK6a and GmMPK6b is obviously reduced compared with that of the EV, and the qRT-PCR result shows that the GmMPK6 can respond to host immunity during symbiotic establishment, and the effector can inhibit the expression of the GmMPK 6.

Knockout of GmMPK6 promotes symbiotic nodulation: hairy root transformation was performed using K599 strain carrying pSoy10 GmMPK6-Cas9 plasmid using pSoy10 empty load as negative control to further verify nodulation phenotype after MPK6 deletion. The fluorescent tag protein DsRED on the carrier was observed by a fluorescent body microscope with 554nm excitation light, and non-positive roots were removed. The HH103 and rhcN mutants were inoculated separately, and the number of nodules and the dry nodule phenotype of the nodules were counted 28d after inoculation, and the results are shown in the graph (FIG. 6). In contrast to the over-expressed phenotype, the HH103 nodule count and nodule dry weight increase upon knockdown of GmMPK6 following inoculation further demonstrates that GmMPK6 negatively regulates soybean nodulation. When the rhcN mutant is inoculated, the number of hairy root nodules of knockout and empty vectors and the dry weight of the nodules have no obvious difference, and the result of transcriptome and tissue expression shows that the GmMPK6 probably influences the signal transmission of mediated effector and the host immunity, thereby influencing the establishment of the symbiosis of soybean and rhizobia.

GUS staining: histochemical staining for GUS expression was carried out mainly by reference to Jefferson et al, with modifications. Transgenic hairy root plants inoculated with S.fredii HH103 and HH103 omega RhcN were grown for 48hr, the underground part was gently washed under running water (at least 10 independent individuals were secured), the whole roots obtained were used as the material, the fresh material was vacuum-fixed in 90% acetone pre-cooled at-20 ℃ for 10min, left on ice for 20min, washed with 50mM phosphate buffer to remove acetone residues, vacuum-infiltrated with pre-cooled GUS staining solution (50mM sodium phosphate buffer, 0.2% Triton X-100,5mM K4Fe (CN)6,5mM K3Fe (CN)6,2mM X-gluc) on ice for 10min, and incubated at 37 ℃ for 12 hr in the dark. The samples were then observed under a stereomicroscope by gradient dehydration with ethanol (15%, 30%, 60%, 80%).

As a result: in order to analyze the tissue expression pattern of GmMPK6 in symbiotic establishment of soybean and rhizobium, after a transformed hairy root plant containing pSoy10 GmMPK6apro: GUS and pSoy10 GmMPK6bpro: GUS was transplanted to 2d of vermiculite growth, HH103 and HH 103. omega. rhcN were inoculated respectively for 48h to take out roots thereof for GUS staining, and as a result, as shown in A in FIG. 7, GmMPK6 shows high expression in the root tip of soybean, while GmMPK6a shows a similar expression pattern to that of GmMPK6 HH 5, shows high expression in vascular tissues, and after inoculation of rhizobium 103. omega. rhcN 48h, the accumulation amount of the transformed GmMPK6apro and GmMPK6bpro is significantly larger than that of the group inoculated with rhizobium HH103 (B in FIG. 7), indicating that inoculation of the GmHH 103. omega. rhcN 483 can induce expression of GmMPK6 and GmMPK6B, and this part shows that the result of the previous PCR-induced immune response is similar to that the previous mutation reaction can be further analyzed and induced by PCR.

Example 5 application of fluorescent Rhizobium

Rhizobium infection line observation: k599 strains of pSoy10 Ubi, GmMPK6a, 3 XMyc and pSoy10 Ubi, GmMPK6b, 3 XMyc and an empty vector pSoy10 are used as controls, hairy root materials overexpressed by GmMPK6a and GmMPK6b are obtained through hairy root transformation, after the strains are cultured in transferred vermiculite for 2 days, GFP-labeled rhizobium HH103 is inoculated, 3 positive roots (24hpi) are selected from each strain, roots which are 1cm close to a hypocotyl incision are selected and cut off, and 8 groups are repeated. After the tissue transparentization treatment, the tissue transparentization method is slightly improved by referring to the Clear See method of Nadzieja and the like. The obtained tissue to be examined was fixed overnight in a 4% paraformaldehyde solution, and after the fixation, it was washed 3 times for 10min with a washing buffer (80mM HEPES, pH 7.5) to remove formaldehyde. Then, the tissue was treated with a clearing buffer (8M urea, 50% v/v glycerol, 0.5% Triton X-100, and 40mM HEPES pH 7.5) for clearing, after the tissue was completely cleared, fluorescence was observed using a Zeiss LSM700 fluorescence confocal microscope, and the invasion events including the point of invasion, the line of invasion, and the line of invasion deep into the cortex were counted.

Overexpression of GmMPK6 inhibited the formation of an invasion line: the soybean and rhizobium symbiosis are established without leaving rhizobium infection line, because the GmMPK6 has obvious expression difference in early stage of infection (12hpi) and can inhibit symbiotic signal conduction by mediating host immunity, the GmMPK6 is supposed to influence the formation of the infection line, and in order to further analyze the influence of the GmMPK6 on symbiosis establishment, the research is used for observing and counting the influence of the GmMPK6 on infection events by constructing HH103 marked by GFP.

Cloning a bacterial strong promoter nptII shown as SEQ ID NO.4 and GFP amplified from Fu28 to pFAJ1702 by homologous recombination, transforming escherichia coli, identifying single clones by bacterial liquid PCR (polymerase chain reaction), wherein the sizes of the bands are all in accordance with expectations (figure 8), and after the sequencing is successful, the obtained vector is named as pFAJ1702 nptII: GFP.

The pFAJ1702 nptII GFP plasmid was transferred to Rhizobium HH103 by triparental hybridization. Briefly, activated E.coli, Helper strain and wild-type Rhizobium carrying the FAJ1702 nptII: GFP plasmid were mixed at a ratio of 2:2:1, cultured on non-resistant TY solid medium at 28 ℃ for 48h, scraped lawn was resuspended in 500. mu.L of non-resistant TY medium, smeared onto solid TY medium containing Tet and Rif resistance, cultured at 28 ℃ until single colonies grew out, and screened for GFP-positive single colonies using a fluorescent microscope, as shown in FIG. 9. GFP is picked as positive monoclonal to carry out PCR verification of bacterial liquid. The GFP fragment is not contained in wild rhizobia, so that the fragment cannot be amplified by the wild rhizobia, and in addition, candidate colonies are respectively amplified by using a rhizobia conserved gene NifH and a TTSI gene sequence of an upstream fragment and a downstream fragment of a TtsI gene as SEQ ID NO.5, and an NIFH gene sequence as SEQ ID NO.6, so as to prove that the candidate positive colonies are rhizobia. The results are shown in FIG. 10: the sizes of PCR products of other colonies except the bacterial liquid No. 16 and the bacterial liquid No.17 are all expected, which indicates that the introduction of pFAJ1702 nptII GFP plasmid is completed, and the result of microscopic examination by a fluorescent body type microscope proves that the construction of the mutant is successful.

In order to confirm that the introduction of the fluorescent fragment did not affect the nodulation ability of HH103 labeled with GFP, the nodulation ability of HH103 and HH103-GFP was evaluated, and the results are shown in FIG. 11: after 28 days of inoculation, HH103 and HH103-GFP have no significant difference in the number of nodules, the dry weight of the nodules, the content of leghemoglobin and the activity of azotobacter, and the introduction of GFP fluorescence does not influence the nodulation capacity of HH103, so that the fluorescent protein can be used as an experimental material for subsequent observation of infection lines.

Hairy root material over-expressed in GmMPK6a and GmMPK6b was obtained by hairy root transformation using the K599 strain of pSoy10 Ubi: GmMPK6a:3 XMyc and pSoy10 Ubi: GmMPK6b:3 XMyc mentioned above, empty vector pSoy10 as a control, and after transferring into vermiculite and culturing for 2d, inoculated with GFP-labeled Rhizobium HH103(24hpi) and observed by fluorescence confocal microscopy and counted for invasion events. That is, each plant selects 3 positive roots, and selects 1cm of roots close to the hypocotyl incision to cut off, and 8 groups are repeated. After the tissue is subjected to tissue clearing treatment, all infection events of 1cm of roots are counted by a fluorescence confocal microscope. Infection events include Infection points (foci), Infection lines (ITs) that do not enter the cortex interior, and Infection lines (ITs) that grow into the cortex interior, Infection event pattern diagrams, and actual Infection events observed are shown in fig. 12B and C, where a in fig. 12 is evidence of success of rhizobia labeled with gfp, and may emit green fluorescence.

The statistics of the infestation events are shown in the figure (D in fig. 12): after the GmMPK6a and the GmMPK6b are over-expressed, the infection points and the infection lines which do not enter the cortex are obviously reduced, which shows that the over-expression of the GmMPK6 inhibits the formation of the infection lines. There was no significant difference between EV (Empty vector) and the overexpression GmMPK6 in the phenotype of the invasion line (rtits) growing into the cortex, probably because the observation time was only 24 hours after inoculation, there were fewer invasion lines growing into the cortex, resulting in no significant difference. In conclusion, it can be seen from the above results that GmMPK6 can respond to an immune signal from the rhizobium at the early stage of infection, and inhibit soybean nodulation by influencing the formation of infection lines. Fig. 12 statistics of the invasion events of GmMPK6 over-expressed.

SEQUENCE LISTING

<110> northeast university of agriculture

<120> rhizobium HH103 for expressing fluorescent gene and construction method and application thereof

<160> 13

<170> PatentIn version 3.5

<210> 1

<211> 2381

<212> DNA

<213> Artificial Synthesis

<400> 1

tgaatcgaca tgacataact cttactagtt ggtctgattg gacatcttaa tcgaatacct 60

attatgtata tatgtattgg ttgagtaaat tcgagtgaga aagtctttta ttagataaat 120

atgagtattt gattgttggg atatcttagt tgaataacct ataagatata tttgtgtttt 180

cattttatga ctctttttaa ttaaactttt cttttgtgtg taaaaagaat gcatgtttga 240

attatgggta caattcaact aaaaatacat tgaaataaag agatataaag gagtttctta 300

tacaaaagtt cattaagcaa tctccaacaa cacgggaata aaatatagaa aagagtttct 360

aattcaaaag tttgttaagt actctccaac gacaaaataa tggtaattca agtatagcta 420

taaatattta cctaaaatta caataggtgt tagtttaaca taattttaaa taattaatgg 480

aaatgaacat acatttaatg gattatcata tttttgttat tttttttgct agggtaatga 540

tattgatatg aaatatttat tataaaaaat aatgataatt tttattggag atcatgagtg 600

ctcataaaat aaatattacc cttccaatat gatttataat aatacacatg ttcaagttca 660

actaatttat ctaattttct tagtaaatgt ttttttattc aatttttaga ataatgtaca 720

ttaccatata aataaaaagt tgtcattgta taactaaaag agtaactata ttaattaaaa 780

taactatttt ttatgacagc ataagaaaag tccgaaatgt tgagtgaatt gcgaaaacag 840

ttaatgaaat ttttttaaat gatgtatcta ttttgccgct tttttccagt cttagaaaga 900

aagtaaaaac aaaaggaaat gtatacaatg gaaatggaaa tgcccaatct gcaaagtttt 960

taagttttgc tctaaaaagg taccgaaaag catttattaa ctgctgtaga attaattatg 1020

gaatttaaaa aagaacatta aaaaaaacag aatcatttta tatttttaat agaaatttaa 1080

tacaatttaa attgaaacaa aacaattaaa aatttaatga ctgtaaacag aataaaaaat 1140

taataattta aagttgaaaa acatttagta acaattttaa acttaaaaac atttaataat 1200

tgtaaactta aaaacattta ataattataa atttaaaaac atttaaaagt tttaatttaa 1260

aaacatttaa tattttaaaa ttttaaagta tttaatattt tgaatttaga aaacatttag 1320

catttctaaa ttttaaaagt atttaatata tttaatcaat aaaattatgt accaaaaaaa 1380

tattaccata tgcaaaaaaa aaaaacaaca tacaatttta ctaatgagtg ttttaaaaaa 1440

caataaataa agagcattaa tgcactttac taaatactcc taatcattag agaataaaca 1500

ttaattaatt attacatttt tagtaaattt tttatttctt aaataacacc tgccttaact 1560

catccaataa aaattaatca taaaaggaaa gtattggtga aagacaatgt ttaaccaaat 1620

aagcatgtag aatatttttt gatgattaag atgtaaggtg aagaacgttt aatctctgat 1680

aaagtagtgt aaattaagat tcaaaaagat ctttattaaa aagatgttta tatgtctcca 1740

taagatccat ctagtagcag tgagggattt tgcataattt acacaagatt tcctggttca 1800

aattttattg ctgcaattgc acaacaataa taataaacaa atattcatat tcaatggtta 1860

accgtagcta ccaacaagtc attcccgaac tcgatccttt tgagaaaaat ttcatagtga 1920

taaaaaaata tttaattgta acttaaataa gattactttg ttaattttta aaaaatgcct 1980

gtgtagaaaa aaatataaga aaaaggaaaa ggggaaaatt aagaagaaga agaagaaaaa 2040

aaaaacaaat gaataaaaca aaaaaaggtt gacagaagag agatacagtt tttacagaag 2100

ttaggagaga aaaagaagag agtacagatc tgtttgacca aaacctctta caaacacata 2160

caaatcaggt tcctattctg cttctctaat cctatttttt tcatatacaa caaacacgga 2220

ttcattgcat caccgtcacc accactttca tcatcataaa acatttttca tataaataaa 2280

atatattcat tcattcacac atcgtaataa tcattatcta tcattctctc tctttcaatt 2340

ttagacagaa gactaaaaga gtgaagagaa caaacagagc a 2381

<210> 2

<211> 2017

<212> DNA

<213> Artificial Synthesis

<400> 2

gaatgtggat ctagtgggat atggtgtcgt tgatttgggc tttgaagaac tggatgacat 60

tgtagattcg gtgatgatgt tgtggatcta ttgtgaggct ggtgtggcat gccctaaact 120

agtggattcc atagaagtgg tcattaagca ttggaaagat tgccaaagag aaggaaggag 180

attgtggcag ttgggggcaa tagatttgag gagggagaaa ggggaagaaa aagtagctag 240

agacttatgg gaacgataat ctcttgtaga agatgtaaat ttcatctatg gaataagatt 300

aatcttgtta tggtctatta tggacccttt gaaattagtc caccaaaaca atggccatgg 360

ctttcttttt aataaaactt tcttcttggc tttaaaaaaa atagtgcatg tttgaattat 420

gagtacaggt agctaaaaat acgttggaat aaacgataca aaggactttc ttattcaaaa 480

gtttgttaag tattatccaa aattaggtta gctgatattt taacataatt gtaaataatt 540

taatgccaat taacatacat ttaatggatt aatatatttt tgtgttattt ttcttttacc 600

ttaacattgg tagatatttt ttttaggaag taaccactca tatttattaa gaattgtaag 660

tacacatcct ttcaacatgg tttacaacaa tacacatgtt caactaagct tagtaaatat 720

ttttttattc aaatttcaga ataaatacat taccatatta attaaaagtt gtcatgctat 780

aactataaga gtaactatat taattaaaat aaatgctttt ttatggcagc atgagtgaat 840

tgggaaaaca gtcaatgaaa aaaaatgatg aatttatttt ctcgcttttt tccggtctaa 900

gaaagaaagt aaaaacaaaa ggaaatgcat ataatggaaa tggaaatacc caatctgcaa 960

tgttttaagt tttgctctaa aaaggtaccg aaaaacattt attaactgct gtaaaattaa 1020

ttatgaaatt aaaacaaaaa gaacattgaa taaaaacaaa atcattttat atttttaata 1080

gagatttaat acaatttaaa ttttaaaaaa acattaaaaa taataattgt aaacttaata 1140

aatttaataa tttaaatttg aaaaacattt agtaataatt ttaaacttaa aaaaaattta 1200

attttaacct taaaaatatt taataattgt aaacttaaaa aagatttaat aattataaat 1260

ttaaaaaaca tttaacattt ttaattttaa aaagtattaa atattttaaa atttaggaaa 1320

taatttaata tttctaattt taaaaattat ttaatatttt aatcaataga aattatgtac 1380

caaaaatata ttagcatata caaaaaaaat caacatatca ctttattaat gagtgtttaa 1440

aaaaacaata aataaagagc attaatgcat tttactaaat actcctaatc attataaaca 1500

caaacattaa ttattacatc tttagtaaat tttttatttc ttaaataaca cttgctactc 1560

atcaaataaa aataaagata aaaggaaagt attggtgaaa gataatgttt aaccaaataa 1620

gcatgtgcaa tattttttta tgataaggaa ctaaggatgt acaatagaat aaataaaaaa 1680

aaccaaaggt agcctgataa cctgatttag tgaagaatgt taacctctga taaagtagta 1740

cattaagatt caaatcttta ttattataaa atgatgttta tactttatat atcttactag 1800

gatccatcta agtagtaaga gatttacata gtttacagaa gatttttttg ttttgaattt 1860

tgttgctgtt attatacatt tatgcaataa taaaaaaaat attcacattt aatttaatgt 1920

ttaactatgt gcagaaaaaa tataagaaaa agaaaatgag aaatttgaga agaaaagtaa 1980

atggatagaa caaaaaaaag gttgacagag gaaagag 2017

<210> 3

<211> 1150

<212> DNA

<213> Artificial Synthesis

<400> 3

atgtctagag tgagcaaggg cgaggagctg ttcaccgggg tggtgcccat cctggtcgag 60

ctggacggcg acgtaaacgg ccacaagttc agcgtgtccg gcgagggcga gggcgatgcc 120

acctacggca agctgaccct gaagttcatc tgcaccaccg gcaagctgcc cgtgccctgg 180

cccaccctcg tgaccaccct gacctacggc gtgcagtgct tcagccgcta ccccgaccac 240

atgaagcagc acgacttctt caagtccgcc atgcccgaag gctacgtcca ggaggtagat 300

ttatgcatcc tcttgtcatg agaagtcgaa ttgttcccat tctgtgtgtt gcagctacag 360

atggagatac atagagatac tcgtggattt tgcttagtgt tgagttttgt tctggttgtg 420

aactaaaagt ttatacattt gcaggaaata aatagccttt tgtttaaatc aaaaggtctt 480

acctatgtta gtgtgaagca ttggatccca aagaactcca aaatgcgatg aggcatattt 540

aatcttgtct ggactagtaa caggttggga tgaccacctg tgaagctcca acaggattgc 600

ctcctcacgc aatgtttgag gtctgatgtt caatagcttg ttttgtttca ctttgctttg 660

gactttcttt tcgccaatga gctatgtttc tgatggtttt cactcttttg gtgtgtagag 720

aaccatcttc ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg 780

cgacaccctg gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat 840

cctggggcac aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa 900

gcagaagaac ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt 960

gcagctcgcc gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc 1020

cgacaaccac tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga 1080

tcacatggtc ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct 1140

gtacaagtaa 1150

<210> 4

<211> 795

<212> DNA

<213> Artificial Synthesis

<400> 4

atgattgaac aagatggatt gcacgcaggt tctccggccg cttgggtgga gaggctattc 60

ggctatgact gggcacaaca gacaatcggc tgctctgatg ccgccgtgtt ccggctgtca 120

gcgcaggggc gcccggttct ttttgtcaag accgacctgt ccggtgccct gaatgaactc 180

caagacgagg cagcgcggct atcgtggctg gccacgacgg gcgttccttg cgcagctgtg 240

ctcgacgttg tcactgaagc gggaagggac tggctgctat tgggcgaagt gccggggcag 300

gatctcctgt catctcacct tgctcctgcc gagaaagtat ccatcatggc tgatgcaatg 360

cggcggctgc atacgcttga tccggctacc tgcccattcg accaccaagc gaaacatcgc 420

atcgagcgag cacgtactcg gatggaagcc ggtcttgtcg atcaggatga tctggacgaa 480

gagcatcagg ggctcgcgcc agccgaactg ttcgccaggc tcaaggcgcg gatgcccgac 540

ggcgaggatc tcgtcgtgac ccacggcgat gcctgcttgc cgaatatcat ggtggaaaat 600

ggccgctttt ctggattcat cgactgtggc cggctgggtg tggcggaccg ctatcaggac 660

atagcgttgg ctacccgtga tattgctgaa gagcttggcg gcgaatgggc tgaccgcttc 720

ctcgtgcttt acggtatcgc cgctcccgat tcgcagcgca tcgccttcta tcgccttctt 780

gacgagttct tctga 795

<210> 5

<211> 681

<212> DNA

<213> Artificial Synthesis

<400> 5

atgcgaacgt tgctcgtgga tacggatctt acccgcgcgg tccgaggcgc gctcggtgac 60

ggcggctttg ccgttgatgt agttggcacg ctggaacagg cgtcgagcgc atttttttca 120

gcgagctatg aaattcttct gctggagttg gtactgccag atggcgatgg actggattgg 180

ctgaggcagc taaggagcga cgggtattca gttcctgccg tcattatgag caggctcgac 240

gatctcgaga aacgaatttc ggtattcaat agtggcgcgg acgattttct ccgtaaaccc 300

gtctctacgg atgagctcat cgccagaatg cgggcccttc tgcgccgatc gacacagatc 360

acttgcccca tcattgaatt tggcaacctc cacttcgatc cgatcggccg acaggtgtcg 420

gttgacggtc atccgttaat gatcgcacgt cgcgaactat gcattctaga gcatctgctt 480

aaccgcgcgg gtcgcatcgt gccgcgtgcg cggttggaag atcaactcta ttcgttcaac 540

gacgaagttt caggcaacgc gcttgaagcc ggaatctacc gcttacgcgg gtatctcagt 600

aggtcaggtg ccacgttgcg gatcaggacc gtgcgcggca ttggctacgt tcttgaattg 660

actgacgcgt catcagcata g 681

<210> 6

<211> 891

<212> DNA

<213> Artificial Synthesis

<400> 6

atggcaggtc tgcgtcaaat cgcgttttac ggcaagggcg gtatcggcaa gtccaccacc 60

tcgcagaaca cgctcgccgc ccttgtcgac ctcgggcaga agatcctcat cgtcggctgc 120

gatcccaagg ccgactccac ccggctcatc ctcaacgcga aggcgcagga cacggtcctg 180

catctggcgg ccaaggaggg atcggtggaa gatctcgagg tcgaggacgt gctcaaggtc 240

ggctacaagg gcatcaaatg cgtcgagtcc ggcggccccg aaccgggcgt cggctgcgcc 300

ggccgcggcg tcatcacctc gatcaacttc ctggaggaaa atggcgccta tgacgatgtc 360

gactacgtct cctacgacgt gctgggcgac gtggtgtgcg gcggcttcgc gatgccgatc 420

cgcgagaaca aggcgcagga aatctacatc gtcatgtccg gcgagatgat ggcgctctat 480

gccgccaaca acatcgccaa ggggatcctc aaatacgccc attcgggcgg cgtgcggctc 540

ggcgggctga tttgcaacga gcgccagacg gaccgcgagc tcgatctcgc cgaggcgctg 600

gcggccaagc tcaattccag gctcatccac ttcgtgccgc gcgacaacat cgtccagcac 660

gccgagctca ggaagatgac ggtgatccag tatgccccgg agtcgcaaca ggctgcggag 720

tatcgcgcgc tggccgacaa gatccatgcc aattccggcc agggcaccgt cccgaccccg 780

atcaccatgg aggagctgga ggacatgctg ctcgatttcg gcgtcatgaa gaccgacgag 840

cagatgcttg ccgaacttca ggccaaggaa gcggcggcag cggcccagtg a 891

<210> 7

<211> 2450

<212> DNA

<213> Artificial Synthesis

<400> 7

taaagaacga agaaatggat ggagatatat ataatgaaga tacaaatgat gaagatatag 60

atgacgagga aacaaatgaa gaattttatg aagccacata cacatatgtg atggcaattt 120

atgctttaat agatatatta aatcagtttt tgaatatgat gcgtggtgaa catattgaac 180

gtccattaac tcgacgacaa attactagtc ggggatatga ctatatacac aaagcattaa 240

acgatgatcc tgcaatcttt cgacaagtat ataggatgta tcctgatgta tttcgaaagt 300

tgtgcacgat tataagagaa aaaacacctt tggaggatac aagatttatt tgtgttgaag 360

aaatgcttgc atcattccta cagattgtcg gccagaacac tcgatattgt gtaatccgca 420

atacatttgg ccaatcacaa tttgctacaa gtgaaaattt tcacaagatt ttgaaagctc 480

tgaactcatt agcacctgat ttaatggtta gaccaggctc aactgtgcct gcaaaaataa 540

gggaaagcac aaggttttat ccttatttta aggtatgtga tcattatcta attataacaa 600

aattataatt ataattgtga tggcatgtgc agcacttcat aattttcttc gcaaagaatg 660

tcgttctgat gaatttccag tggaacctac tgacgagtct tcatcttcat cttcagtgtt 720

accaaattac gaagacaatg atcatgaacc cattgttcaa acacaagagc aggaacgaga 780

agatgctaat atatggagga ctaatatagg ttcagatatg tggagaaatg ctaataatta 840

ggcgaacatg aagtgagaat cactttgtta ttattttttt aggcaataat gactttgtta 900

ttaaaaggtt taaaatttct atcgttttta ttttctttat tcaaacatta taatttattt 960

atcatctttt tcattcactt ttgtaacttc cgttattttt ttgtttaaaa tgtattaatc 1020

tttcaaaatc ttaaaaatcc ataaagtact ttgaaatctt aaaaatctgt gttagaaatc 1080

cattaaaatc ttgggttaag aatcctgatt gtaaaaagtc ttttaaaaaa aatcttttaa 1140

aatcccacaa aatcaataca atcccacata atcttttaaa atcttcaaga ttgtttttgt 1200

caaaatattc tctcaaaatc ccaatccaat acacccccct taattaacaa aaatgaatac 1260

gggctaacat ggttatgggc ttaggctgcc tcattaccca ttacatgctc tgttcctaaa 1320

aaaaagaagt ttgggccttt attctccagt aagcttttta attgggctca agaactttag 1380

gtatttaggt gagattcaat gaaaatttat acattaggct tgattttttt ttttcaattt 1440

acgcaaaaat gaaagaaaaa gtcacactct ataaacttta tttttttcaa tattaataca 1500

ttgttattgt ggatatatca ttagcggaaa agtaattcta ataccagatt taattgactt 1560

tgactaattt ttttatgtga tcaaataatt tttttagcga aaaacttata tatatatata 1620

tatatatata tatatatata agttttgtta cttttccgcg tgatttttaa tcaaactttg 1680

gggataattt cccctccaat tcagccaaaa aaaaaaaaac tgacaccata tattattagt 1740

aggcaacttg ttcgtaaatg gtgtggctta tgcgaatgga aattggattc gttttcttta 1800

acatcattat tgtttttgtc aatgagctat cttttagtct tatgttattg gtgaatctgt 1860

ccttaagttg cagcatttaa cacatctcct cattagagaa aaaaattctt ccctaaacga 1920

tagtaaaaac atctaataag aaataagaaa gaaaaattag gaaaaagaaa agttcattaa 1980

aaaaatcttt tggattattt ttaaaaaaat atctaaatat tttttaaatg aataatttta 2040

tataaactgt aactaaaagt atacaagtaa tgtatgttaa caaaatactt gaaaaatcta 2100

ctgaaaatat atcttacaaa gtgaaattaa ataagaaaga atttagtgga ataattatga 2160

ttttatttaa aaaataatta ttaaagattt ttttgctcca taataagaaa acttttcaat 2220

tattcttttc tggtccataa taaaaaaaat ctagcatgac agcttttcca tagattttta 2280

ataatgtaaa agcagccgac ttcaggcaat ggatagtggg acccgtatca acttcggacg 2340

ctccacttgc aacggggtgg gcccaatata acaacgacgt cgtaacagat aaagcgaagc 2400

ttgaaggtgc atgtgactcc gtcaagatta cgaaaccgcc aactaccacg 2450

<210> 8

<211> 180

<212> DNA

<213> Artificial Synthesis

<400> 8

atgatgcttt tgcaagcctt ccttttcctt ttggctggtt ttgcagccaa aatatctgcg 60

atgatgcttt tgcaagcctt ccttttcctt ttggctggtt ttgcagccaa aatatctgcg 120

atgatgcttt tgcaagcctt ccttttcctt ttggctggtt ttgcagccaa aatatctgcg 180

<210> 9

<211> 1893

<212> DNA

<213> Artificial Synthesis

<400> 9

ttaatggtga tggtggtgat ggtggtggcc gccgctattc aggtcttcct cgctgatcag 60

cttctgctcg cctgaggctt gtttgcctcc ctgctgcggt ttttcaccga agttcatgcc 120

agtccagcgt ttttgcagca gaaaagccgc cgacttcggt ttgcggtcgc gagtgaagat 180

ccctttcttg ttaccgccaa cgcgcaatat gccttgcgag gtcgcaaaat cggcgaaatt 240

ccatacctgt tcaccgacga cggcgctgac gcgatcaaag acgcggtgat acatatccag 300

ccatgcacac tgatactctt cactccacat gtcggtgtac attgagtgca gcccggctaa 360

cgtatccacg ccgtattcgg tgatgataat cggctgatgc agtttctcct gccaggccag 420

aagttctttt tccagtacct tctctgccgt ttccaaatcg ccgctttgga cataccatcc 480

gtaataacgg ttcaggcaca gcacatcaaa gagatcgctg atggtatcgg tgtgagcgtc 540

gcagaacatt acattgacgc aggtgatcgg acgcgtcggg tcgagtttac gcgttgcttc 600

cgccagtggc gcgaaatatt cccgtgcacc ttgcggacgg gtatccggtt cgttggcaat 660

actccacatc accacgcttg ggtggttttt gtcacgcgct atcagctctt taatcgcctg 720

taagtgcgct tgctgagttt ccccgttgac tgcctcttcg ctgtacagtt ctttcggctt 780

gttgcccgct tcgaaaccaa tgcctaaaga gaggttaaag ccgacagcag cagtttcatc 840

aatcaccacg atgccatgtt catctgccca gtcgagcatc tcttcagcgt aagggtaatg 900

cgaggtacgg taggagttgg ccccaatcca gtccattaat gcgtggtcgt gcaccatcag 960

cacgttatcg aatcctttgc cacgcaagtc cgcatcttca tgacgaccaa agccagtaaa 1020

gtagaacggt ttgtggttaa tcaggaactg ttcgcccttc actgccactg accggatgcc 1080

gacgcgaagc gggtagatat cacactctgt ctggcttttg gctgtgacgc acagttcata 1140

gagataacct tcacccggtt gccagaggtg cggattcacc acttgcaaag tcccgctagt 1200

gccttgtcca gttgcaacca cctgttgatc cgcatcacgc agttcaacgc tgacatcacc 1260

attggccacc acctgccagt caacagacgc gtggttacag tcttgcgcga catgcgtcac 1320

cacggtgata tcgtccaccc aggtgttcgg cgtggtgtag agcattacgc tgcgatggat 1380

tccggcatag ttaaagaaat catggaagta agactgcttt ttcttgccgt tttcgtcggt 1440

aatcaccatt cccggcggga tagtctgcca gttcagttcg ttgttcacac aaacggtgat 1500

acgtacactt ttcccggcaa taacatacgg cgtgacatcg gcttcaaatg gcgtatagcc 1560

gccctgatgc tccatcactt cctgattatt gacccacact ttgccgtaat gagtgaccgc 1620

atcgaaacgc agcacgatac gctggcctgc ccaacctttc ggtataaaga cttcgcgctg 1680

ataccagacg ttgcccgcat aattacgaat atctgcatcg gcgaactgat cgttaaaact 1740

gcctggcaca gcaattgccc ggctttcttg taacgcgctt tcccaccaac gctgatcaat 1800

tccacagttt tcgcgatcca gactgaatgc ccacaggccg tcgagttttt tgatttcacg 1860

ggttggggtt tctacaggac ggacgctagc cat 1893

<210> 10

<211> 1302

<212> DNA

<213> Artificial Synthesis

<400> 10

atgacagttt ttacagaagt taggagagag agagagagag agagtacaga tctgtttgac 60

caaaacccct cacaacacat aaatcagaca gacaaaagaa agaaagaaga gaacaacaga 120

gcaatggaag gaggaggagc tgctccgccg gccgacaccg tgatgtccga cgcggcgcca 180

ccgccgcagc agcctccggt ggcgatgggg atcgagaata ttccggcgac gctgagccac 240

ggtggcaggt tcatccaata caacatattc ggcaacatat tcgaagtcac cgccaaatac 300

aagccaccca tcatgcccat cggaaaaggc gcatacggca tcgtttgctc ggctttgaac 360

tcggagacga atgagcacgt tgccatcaag aagattgcga atgcatttga caacaagatt 420

gatgcaaaga ggaccctccg tgaaatcaag ctgcttcgtc acatggatca tgaaaacgtt 480

gttgcaatca gggatatagt gccaccacct caaagggaga tattcaatga tgtttacatt 540

gcatatgagt tgatggacac tgaccttcac caaatcattc gttcaaatca agcattatca 600

gaggagcact gtcagtattt tctgtatcaa atcctccgtg ggttgaagta catacattct 660

gctaatgttc tgcataggga cttaaaaccg agcaaccttc tcctaaatgc caactgcgac 720

ttaaaaattt gtgattttgg actggctcgt gtcacctctg aaactgattt tatgactgaa 780

tatgttgtta cgagatggta ccgtgcaccg gagcttctgt tgaactcttc tgactacact 840

gcagcaattg atgtatggtc tgttggttgt attttcatgg aactgatgga tcgaaagcct 900

ttgtttcctg gcagagatca cgtgcatcag ttgcgtctac ttatggagct gattggcacc 960

ccatcagagg ctgatttggg gtttctgaat gaaaatgcta agagatacat taggcaactg 1020

cccctttacc gccgtcaatc tttccaggaa aagtttccac atgtccatcc tgaagctata 1080

gatcttgtag aaaaaatgtt aacttttgat cctagaaaaa ggattactgt tgaagatgca 1140

ctggcgcacc catacttgac atctctgcat gacatcagtg atgaacctgt gtgcttgact 1200

cccttcagct ttgactttga acaacatgct ttgactgagg aacagatgaa agaactgata 1260

taccgagagg ctctagcatt taacctcgag tatcagcagt ag 1302

<210> 11

<211> 1302

<212> DNA

<213> Artificial Synthesis

<400> 11

atgacagttt ttacagaagt taggagagag agagagagag agagtacaga tctgtttgac 60

caaaacccct cacaacacat aaatcagaca gacaaaagaa agaaagaaga gaacaacaga 120

gcaatggaag gaggaggagc tgctccgccg gccgacaccg tgatgtccga cgcggcgcca 180

ccgccgcagc agcctccggt ggcgatgggg atcgagaata ttccggcgac gctgagccac 240

ggtggcaggt tcatccaata caacatattc ggcaacatat tcgaagtcac cgccaaatac 300

aagccaccca tcatgcccat cggaaaaggc gcatacggca tcgtttgctc ggctttgaac 360

tcggagacga atgagcacgt tgccatcaag aagattgcga atgcatttga caacaagatt 420

gatgcaaaga ggaccctccg tgaaatcaag ctgcttcgtc acatggatca tgaaaacgtt 480

gttgcaatca gggatatagt gccaccacct caaagggaga tattcaatga tgtttacatt 540

gcatatgagt tgatggacac tgaccttcac caaatcattc gttcaaatca agcattatca 600

gaggagcact gtcagtattt tctgtatcaa atcctccgtg ggttgaagta catacattct 660

gctaatgttc tgcataggga cttaaaaccg agcaaccttc tcctaaatgc caactgcgac 720

ttaaaaattt gtgattttgg actggctcgt gtcacctctg aaactgattt tatgactgaa 780

tatgttgtta cgagatggta ccgtgcaccg gagcttctgt tgaactcttc tgactacact 840

gcagcaattg atgtatggtc tgttggttgt attttcatgg aactgatgga tcgaaagcct 900

ttgtttcctg gcagagatca cgtgcatcag ttgcgtctac ttatggagct gattggcacc 960

ccatcagagg ctgatttggg gtttctgaat gaaaatgcta agagatacat taggcaactg 1020

cccctttacc gccgtcaatc tttccaggaa aagtttccac atgtccatcc tgaagctata 1080

gatcttgtag aaaaaatgtt aacttttgat cctagaaaaa ggattactgt tgaagatgca 1140

ctggcgcacc catacttgac atctctgcat gacatcagtg atgaacctgt gtgcttgact 1200

cccttcagct ttgactttga acaacatgct ttgactgagg aacagatgaa agaactgata 1260

taccgagagg ctctagcatt taacctcgag tatcagcagt ag 1302

<210> 12

<211> 22

<212> DNA

<213> Artificial Synthesis

<400> 12

aagccaccat catgcccatc gg 22

<210> 13

<211> 23

<212> DNA

<213> Artificial Synthesis

<400> 13

ccctccgtga aatcaagctg ctt 23

Claims (9)

1. A rhizobium HH103 for expressing a fluorescent gene, wherein the rhizobium HH103 for expressing the fluorescent gene is obtained by expressing the fluorescent gene in an original strain through a eukaryotic expression vector by taking the rhizobium HH103 as the original strain.

2. A rhizobium HH103 expressing a fluorescent gene according to claim 1 wherein the fluorescent gene is a GFP gene, a gus gene and an rfp gene.

3. A rhizobium HH103 expressing a fluorescent gene according to claim 2 wherein the sequence of the GFP gene is shown in SEQ ID No. 3.

4. A rhizobium HH103 expressing a fluorescent gene according to claim 1 wherein the eukaryotic expression vector is a pSoy10 vector.

5. A method of construction of Rhizobium HH103 expressing a fluorescent gene according to any one of claims 1 to 4, characterized in that the steps of the construction method are as follows: the fluorescent plasmid containing the GFP gene is transferred into Rhizobium HH103 by rhizobium triparental hybridization.

6. The method of claim 5, wherein the fluorescent plasmid containing GFP is constructed by: the GFP gene was amplified from the Fu28 vector using the ATGGTGAGCAAGGGCGAGGA and CTTGTACAGCTCGTCCATGCC sequences, and the nptII promoter, whose gene sequence is shown in SEQ ID NO.4, was cloned into pFAJ1702 along with the GFP gene by homologous recombination.

7. A kit for testing the ability of rhizobia to infect soybean, comprising rhizobia HH103 expressing a fluorescent gene of any one of claims 1 to 4.

8. A method for detecting the formation of a rhizobium infection line is characterized by comprising the following specific steps: selecting soybean hairy root material to be detected, inoculating rhizobium HH103 expressing a fluorescent gene according to any one of claims 1 to 4, observing by a fluorescence confocal microscope, and counting an infection line.

9. Use of a rhizobium HH103 expressing a fluorescent gene as claimed in any one of claims 1 to 4 in the preparation of a kit for detecting the ability of rhizobium to infect soybean.

Images