CN114672466A - Recombinant Coxsackie B3 virus with fluorescent protein label and construction method - Google Patents

Abstract

The invention provides a recombinant Coxsackie B3 virus with a fluorescent protein label, which is an infectious recombinant virus rCV-CS and a recombinant virus rCV-GFP expressing GFP, and has a sequence shown as SEQ ID NO: 1, the construction method is that on the basis of CVB3 full-length infectious cDNA clone plasmid pCV, the CVB3 full-length infectious clone plasmid pCV-CS containing multiple cloning sites MCS is constructed, and 2Apro enzyme digestion recognition sequences are added in front of the MCS; amplifying a GFP fragment by taking pEGFP as a template to obtain a GFP coding gene; introducing a GFP coding gene into a multiple cloning site of pCV-CS to construct a CVB3 whole-gene infectious cloning plasmid pCV-GFP expressing GFP; the pCV-GFP is transfected and amplified by liposome to obtain recombinant coxsackie B3 virus rCV-GFP with a fluorescent protein label. The technical scheme of the invention is used for preparing the tracer virus in the living animal cells and has obvious effect.

Description

Recombinant Coxsackie B3 virus with fluorescent protein label and construction method

Technical Field

The invention relates to the technical field of biological medicines, in particular to a recombinant coxsackie B3 virus with a fluorescent protein label and a construction method and application thereof.

Background

The Coxsackie virus B3 belongs to a single-stranded positive-strand small RNA virus, is spherical, icosahedral, three-dimensionally symmetrical, non-enveloped and non-protuberant, and a naked protein nucleocapsid wraps nucleic acid to form a virus particle with the diameter of 20-30 nm. The Coxsackie virus mainly infects human or animals through the fecal oral infection route, invades a host by taking the alimentary canal as an entrance, and spreads to other tissues and organs. The poliovirus infection pathway is studied more, the poliovirus may invade the central nerve by infecting the peripheral nerve, spread the virus to the whole body by blood stream transport, or be further transmitted by infection of vascular endothelial cells, and the infection pathway of the coxsackievirus may be similar to the poliovirus infection pathway, and further experiments and clinical studies are needed. At present, the pathogenic mechanism and virus tissue tropism of the coxsackie virus are researched, the virus antigen in fixed cells or tissues is detected by an immunological method or virus particles in the fixed cells or tissues are detected by an electron microscope, obviously, the research modes can not fully and deeply analyze the dynamic process in the life cycle of the virus, and the mode of directly observing and researching the virus in living cells or living bodies is a more convenient and visual mode.

In 1962, Seikagana Victoria jellyfish, Nomuraea Victoria, et al, first discovered a Green Fluorescent Protein (GFP) consisting of 238 amino acids at approximately 26.9kDa under blue light excitation. After being modified by Martin Chalfie, Qianyong and the like, the green fluorescent protein serving as a biological probe is widely applied to cell biology and molecular biology research. After the GFP-encoding gene is linked to the target protein gene, the expression and localization of intracellular proteins can be observed at any time by a fluorescence microscope. The GFP is fused with the target protein without influencing the luminescence, and the GFP does not influence the biological function of living cells in the process of luminescence, and the self-luminescence does not need other substrates or auxiliary molecules. At present, GFP is mainly applied to the following aspects: (1) as a molecular marker, the protein label is used for organelles such as cytoskeleton, plasma membrane, cell nucleus and the like, and the GFP is integrated into the escherichia coli to be used as the marker, so that the screening efficiency of a polypeptide library, the research and development of vaccines and the research on a signal transduction process are greatly improved. (2) With the development of optical analysis methods, GFP fluorescent probes are applied to in vivo intracellular drug screening. (3) GFP luminescence depends on Ca2+ and the surrounding chemical environment, and is therefore suitable for use as a living cell bio-optical sensor. (4) Application in signal transduction. In recent years it has been found that certain mutated GFP's are capable of Fluorescence Resonance Energy Transfer (FRET).

With the development of imaging technology, optical imaging in living animals is more and more widely applied to life sciences, medical research and drug development. With GFP as a fluorescent reporter group, the tissue and the cellular localization of luminescent cells or virus particles in living organisms can be directly monitored by using an optical detection instrument. Compared with the traditional animal experiment method which needs to kill the experimental objects at different time points to obtain data, the GFP-labeled virus can be adopted to obtain a plurality of time points and continuous experimental data. In addition, the method does not involve radioactive substances and is simple to operate and free from safety risks.

The experimental study aims to insert Green Fluorescent Protein (GFP) into CVB3 whole gene infectious clone on the basis of successfully established CVB3 whole gene infectious clone (pCV), so as to construct recombinant CVB3 virus for expressing GFP. After CVB3 enters a cell, the ribosome entry site of a 5' non-coding region begins to collect cell ribosome to be bound to a virus positive strand RNA, and the synthesis of polyprotein is started from downstream AUG, wherein 2A protease (2A protease, 2Apro) and 3C protease (3C protease, 3Cpro) have a self-cleavage function, and a single polyprotein is cut into 4 virus structural proteins (VP1-4) and 7 functional proteins (2A-C, 3A-D). Considering that GFP has 238 amino acids, in order to avoid the influence of GFP on the packaging of the virus, the experiment utilized the self-splicing property of CVB3 virus replication synthesis, and a virus 2Apro restriction recognition sequence was added to the 5' end of the coding region of the GFP gene.

Disclosure of Invention

Aiming at the technical problems, the invention successfully constructs the CVB3 full-length infectious clone pCV-CS containing a multiple cloning site and a 2Apro enzyme digestion recognition sequence before the multiple cloning site on the basis of the established CVB3 full-length infectious cDNA clone pCV. The clone has stable property and is easy to operate.

pCV-GFP was successfully constructed. In order to achieve the aim of virus tracing and test the feasibility of pCV-CS as an expression vector, a GFP coding gene is introduced into a multiple cloning site of pCV-CS, and CVB3 whole gene infectious clone pCV-GFP expressing GFP is successfully constructed;

infectious recombinant virus rCV-CS and recombinant virus rCV-GFP expressing GFP were successfully obtained. The biological characteristics of the recombinant virus rCV-GFP are consistent with those of CVB3-WT, and GFP can be stably expressed. The specific technical scheme is as follows:

a recombinant Coxsackie B3 virus with a fluorescent protein tag is an infectious recombinant virus rCV-CS and a recombinant virus rCV-GFP expressing GFP, and has a sequence shown as SEQ ID NO: 1.

the construction method of the recombinant coxsackie B3 virus with the fluorescent protein label comprises the following steps:

(1) on the basis of the CVB3 full-length infectious cDNA clone plasmid pCV, a CVB3 full-length infectious clone plasmid pCV-CS containing a multiple cloning site MCS is constructed, and a 2Apro enzyme digestion recognition sequence is added in front of the MCS;

amplifying a GFP fragment by taking pEGFP as a template to obtain a GFP coding gene;

(2) introducing a GFP coding gene into a multiple cloning site of pCV-CS to construct a CVB3 whole-gene infectious cloning plasmid pCV-GFP expressing GFP;

(3) the pCV-GFP is transfected and amplified by liposome to obtain recombinant coxsackie B3 virus rCV-GFP with a fluorescent protein label.

Introducing a multiple cloning site MCS into a region between a P1 region and a P2 region of a full-length infectious cDNA genome of CVB3 in the step (1); the DNA sequence of CVB3 is SEQ ID NO: 2; the sequence of the multicloning site MCS is SEQ ID NO: 3;

2Apro enzyme digestion recognition sequence is SEQ ID NO: 4.

the primer pair when the multi-cloning site MCS is inserted is SEQ ID NO: 5; the nucleotide sequence of SEQ ID NO: 5 in the upstream sequence of the primer pairXhoⅠAnd (4) enzyme cutting sites. The primer pair inserted with the 2Apro enzyme cutting recognition sequence is SEQ ID NO: 6; the amino acid sequence of SEQ ID NO: 6 in the downstream sequence of the primer pairSpeⅠAnd (4) enzyme cutting sites.

The primer pair for introducing the GFP coding gene into the multiple cloning site of pCV-CS in the step (2) is SEQ ID NO: 7.

the invention relates to application of the constructed recombinant coxsackie B3 virus with the fluorescent protein label in preparation of a medicament for tracing animal living viruses. The virus-traced living animal cells comprise Vero cells, pancreatic cells and myocardial cells.

The technical scheme of the invention proves that pCV-CS can be completely used as a virus vector for effectively and stably expressing the exogenous gene fragment. rCV-GFP stably expresses GFP as a fluorescent probe, and rCV-GFP has various biological characteristics consistent with CVB3-WT, and this experiment proves that rCV-GFP can trace virus-infected cells and tissues through cell culture and mouse in vivo experiments. Therefore, rCV-GFP can be used as a visual CVB3 virus, the positioning of CVB3 in living cells and living tissues can be directly observed, and a research platform is provided for research on cell tropism and tissue tropism of CVB 3. The research provides a stable and reliable research and application platform for deeply researching the genome structure and function of CVB3 and the pathogenic mechanism of molecules.

Drawings

FIG. 1 is an electrophoretogram of segmented PCR amplification incorporating MCS. Lane 1 shows the XS1 fragment (1320 bp); lane 2 shows the XS2 fragment (579 bp); lane 3 shows the XS fragment (1894 bp); lane 5 shows a GFP fragment (720 bp); lanes 4 and 6 show DL2000 DNA Marker, with the brightest band size of 750 bp.

FIG. 2 is an electrophoresis diagram of clone pCV-CS identified by colony PCR. The target band size is 1320bp, 2/4/6/7/8/9 is colony PCR positive, 3/5/7 lane is negative, and 1Kb DNA Ladder is lane 1.

FIG. 3 is a MCS scheme and sequencing peak diagram. (a) MCS schematic. (b) Thick black solid line 2A^proAnd (4) enzyme cutting of the recognition sequence. The boxes are shown as MCS sequences in turn ATCGAT (ClaⅠ)AGGCCT(StuⅠ)。

FIG. 4 shows the electrophoresis chart of clone pCV-GFP identified by colony PCR. The size of the target band is 720bp, lanes 1, 2 and 9 are colony PCR positive, lanes 3-8 are negative, and lane 10 is DL2000 DNA Marker.

FIG. 5 is a schematic diagram of enzyme digestion identification and an electrophoresis diagram of enzyme digestion cloning plasmid. A. pCV-GFP plasmid schematic, displayEcoR1 the position of the restriction and the size of the fragment. B. By usingEcoRI after digestion of the plasmid, pCV-GFP in lane 2, after digestionThe fragment sizes are 5443, 3280 and 2181 bp respectively; lane 3 shows the sizes of the cleaved fragments of pCV-CS, which are 5443, 3280 and 1467 bp, respectively; lane 4 shows the sizes of the fragments after pCV digestion, which are 5443, 3280 and 1425 bp, respectively; lane 1 is TaKaRa 1Kb DNA Ladder.

FIG. 6 is a diagram showing the sequencing results of pCV-GFP. The 2Apro cleavage recognition sequence is shown in the thick black solid line of the pCV-GFP sequencing peak map. Shown in boxes are the GFP coding start sequences.

FIG. 7 shows that rCV-GFP causes changes in cell CPE. COS-7 cells transfected with pCV-GFP were harvested 48h after transfection, and the cell supernatants were inoculated with Vero cells and observed for cytopathic effects (100X). (a) 48h uninfected negative control, (b) CVB3-WT positive control. (c-f) indicates rCV-GFP inoculation at 6, 12, 24 and 48 hours.

FIG. 8 shows the detection of GFP in rCV-GFP infected Vero cells and the detection of VP proteins by immunofluorescence. rCV-GFP 24h after Vero cell inoculation, fixation, immunofluorescence microscopy GFP expression and VP1 expression. pEGFP is a control for GFP expression, rCV is a positive control for VP 1.

FIG. 9 shows the expression of GFP at different time points after Vero infection with rCV-GFP. (a-d) Vero cells were seeded in 6-well plates, and after Vero cells were infected with 0.1MOI rCV-GFP, GFP expression was observed under a fluorescent microscope at 2, 6, 12, and 24h after infection, respectively (X100).

FIG. 10 shows the formation of plaques by virus infection of Vero cells. The plaque morphology of CVB3-WT, recombinant virus rCV and rCV-GFP on Vero cells was compared at the same virus titer.

FIG. 11 is a viral growth curve. After the Vero cells are infected by the virus, the virus titer in the culture supernatant at different time points is detected to draw a growth curve.

FIG. 12 shows rCV-GFP stably expressing GFP in Vero cells. The expression of GFP and VP1 was detected by immunoblotting after 5 th and 10 th passages of rCV-GFP infected Vero cells. Beta-actin is the internal reference.

FIG. 13 shows the immunofluorescence of mouse tissue after rCV-GFP infection. rCV-GFP infected mice, on day 4, the hearts and pancreas of the mice were harvested and tested for co-localization of the viral capsid protein VP1 with GFP to cardiomyocytes and pancreatic cells by immunofluorescence. Green fluorescence indicates GFP and red fluorescence shows the viral capsid protein VP1(400 ×).

FIG. 14 is a diagram of PCR amplification incorporating MCS fragment. PCR primers and start positions and bridges are indicated.

Detailed Description

Example 1

To facilitate the introduction of foreign genes into the CVB3 genome, the experiment introduces Multiple Cloning Sites (MCS) into the interval between P1 region and P2 of CVB3 genome on the basis of constructed full-length infectious clone (pCV) of CVB3, and adds enzyme digestion recognition sequence (TTMTNTG/AFGQQSGA) of 2Apro before the Multiple Cloning sites. Based on the pCV sequencing sequence, 2 pairs of primers were designed using DNASTAR Lasergene 9.0 software for cloning the inserted MCS and a 42bp long 2Apro restriction recognition sequence (Table 1-1). In order to conveniently connect the full-length gene into the plasmid, an Xho I restriction site is introduced into the upstream sequence of the first pair of primers, and a Spe I restriction site is designed in the downstream primer sequence of the 2 nd pair of primers. All the primers are synthesized by Shenzhen Huada Gene company.

TABLE 2-1 construction of multiple cloning site PCR primers

The restriction recognition sequences introduced are underlined in italics.

PCR amplification of fragments of interest

XS1(1320 bp) and XS2(579 bp) were amplified simultaneously using pCV plasmid as template by using ultra-High Fidelity DNA polymerase (Phusion High-Fidelity DNA polymers), and then connected by PCR bridging to form a long fragment of 1899bp (FIG. 14). The GFP fragment was amplified using pEGFP as a template.

The PCR reaction system is as follows:

PCR reaction parameters: fragment XS 1: pre-denaturation at 98 ℃ for 30s, and 30 cycle parameters: 10s at 98 ℃, 10s at 55 ℃ and 30s at 72 ℃; 5min at 72 ℃. Fragment XS 2: pre-denaturation at 98 ℃ for 30 s; the 30 cycle parameters were: 10s at 98 ℃, 10s at 60 ℃ and 10s at 72 ℃; 5min at 72 ℃. Fragment GFP: pre-denaturation at 98 ℃ for 30 s; the 30 cycle parameters were: 10s at 98 ℃, 10s at 53 ℃ and 20s at 72 ℃; 5min at 72 ℃. Electrophoresis and gel recovery of amplification products, the operation is as follows: preparing 1% agarose electrophoresis Gel, loading, performing 100V electrophoresis for 40 min, photographing, and recovering by using E.Z.N.A. Gel Extraction Kit Gel: cutting a target band, adding a sol solution with one time volume, acting at 50 ℃ for 15 min, balancing to room temperature after the sol is completely melted, adding a centrifugal adsorption column, centrifuging at 12000rpm for 1min, then adding 750 mu l of a washing solution, centrifuging at 12000rpm for 1min, continuously adding 500 mu l of the washing solution, centrifuging at 12000rpm for 1min, discarding the washing solution, centrifuging at 12000rpm for 2min, standing at room temperature for 2min, adding 30 mu l of nuclease-free 12000rpm, eluting for 2min, and recovering a product, and freezing and storing at-20 ℃ for later use.

The concentration of the 2-fragment recovered product was measured by UV spectrophotometry. After equimolar mixing of 2 fragments, adding the mixture into a PCR tube, mixing the amount of each component with dNTP, Phusion DNA Polymerase and 5 xPhusion HF Buffer as same as that of the common PCR, and carrying out PCR bridging according to the following procedures: 10 PCR cycles at 98 ℃ for 10s, 60 ℃ for 10s and 72 ℃ for 1 min; the PCR tubes were removed and primers XS1S and XS2A were added and 20 more cycles of PCR were performed as per the above procedure. PCR products were electrophoresed and gel recovered as described above. And recovering the product, and freezing and storing the product at the temperature of 20 ℃ below zero for later use. FIG. 1 segmented PCR amplification incorporates MCS electrophoretograms. Lane 1 shows the XS1 fragment (1320 bp); lane 2 shows the XS2 fragment (579 bp); lane 3 shows the XS fragment (1894 bp); lane 5 shows a GFP fragment (720 bp); lanes 4 and 6 show DL2000 DNA Marker, with the brightest band size of 750 bp.

After PCR amplification products XS and GFP were recovered, they were sent to Huada Gene Co for sequencing analysis.

Construction of CVB3 full-Length cDNA cloning plasmid (pCV-CS) containing MCS

The correctly sequenced PCR-recovered product XS from the previous step, as well as the full-length infectious clone plasmid (pCV) of CVB3, were digested with Xho I and Spe I: PCR product 5. mu.g, Xho I and Spe I1.5. mu.l each, 10 XNEB buffer with BSA 5. mu.l, and 50. mu.l of water. Water bath at 37 ℃ for 2 h. In the same manner, the pCV plasmid was digested in two enzymes. Electrophoresis and gel recovery of the enzyme digestion product are carried out as follows: 1% agarose gel was prepared for recovery of PCR fragments, and 0.7% agarose gel was prepared for recovery of pCV plasmid fragments. After loading, electrophoresis was performed at 100V for 40 min, and after photographing, recovered with e.z.n.a. Gel Extraction Kit Gel: cutting a target strip, adding a sol solution with one time volume, acting at 50 ℃ for 15 min, balancing to room temperature after the sol is completely melted, adding a centrifugal adsorption column, centrifuging at 12000rpm for 1min, then adding 750 mu l of a washing solution, centrifuging at 12000rpm for 1min, continuously adding 500 mu l of the washing solution, centrifuging at 12000rpm for 1min, discarding the washing solution, centrifuging at 12000rpm for 2min, standing at room temperature for 2min, then adding 30 mu l of nuclease-free solution, eluting at 12000rpm for 2min, and recovering a product, and freezing and storing at-20 ℃ for later use.

T4 DNA ligase was ligated to the two digested fragments recovered (XS and vector pCV) as follows: about 10ng of vector, 100ng of PCR-digested fragment, 1. mu. l T4 DNA ligase, 1. mu.l of 10 XT 4 DNA ligation buffer, and 10. mu.l of water. 16 ℃ for 8h or overnight.

The ligation product was transformed into escherichia coli TOP10 competent bacteria: mu.l of the ligation product was added to 50. mu.l of TOP10 competent bacteria and left on ice for 30 min; water bath at 42 deg.C for 45s, and ice-cooling for 2 min; adding 600 mul LB culture medium, shaking and culturing for 60 minutes at 37 ℃; coating the bacterial liquid on an LB agar plate culture medium containing X-gal, IPTG and Amp +, and performing inverted culture at 37 ℃ until a single bacterial colony is formed; white colonies were picked, and the length of the insert in the vector was confirmed by PCR.

Cloning and identification

Selecting white colonies, confirming the length of the inserted fragment in the vector by using a PCR method, carrying out PCR by using XS1S/XS1A as primers, and carrying out electrophoresis identification on products. The PCR-positive colonies were grown in 5ml Amp + LB liquid medium and cultured overnight with shaking at 37 ℃. Plasmid extraction with e.z.n.a. Plasmid Mini Kit: a. taking 1.0-5.0 ml of bacterial liquid, centrifuging at room temperature for 1min at 10,000g, and collecting bacteria; b. the medium was discarded. Adding 250 μ l Solution I/RNaseA mixture, and performing vortex oscillation to completely suspend the cells; c. adding 250 μ l of Solution II into the resuspended mixture, and mixing by gentle inversion 4-6 times (this operation avoids mixing the lysate vigorously and does not require more than 5min for the lysis reaction); d. adding 350 μ l Solution III, gently inverting several times to form white floccule precipitate; e. centrifuging at room temperature for 10min at a speed of not less than 10,000 g; f. transferring the supernatant to a HiBind DNA binding column sleeved with a 2ml collecting pipe, centrifuging for 1min at 10,000g at room temperature, and pouring off the filtrate in the collecting pipe; g. the column was replaced with the collection tube, 500. mu.l HB Buffer was added, centrifugation was carried out under the above conditions, and the filtrate was discarded; h. the column is re-installed into the collection tube, 700 mul of DNA Wash Buffer is added, the centrifugation is carried out according to the conditions, and the filtrate is discarded; i. discarding the filtrate, and repeating the step 9 once; j. discarding the filtrate, reloading the column into the collection tube, centrifuging the empty column at 10,000g for 2min to spin-dry the column matrix; k. the column was mounted in a clean 1.5ml centrifuge tube, 30-50. mu.l of Elution Buffer (10mM Tris-HCl, pH 8.5) or sterile water was added to the column matrix, and the column was allowed to stand for 1-2min, and centrifuged at 10,000g for 1min to elute plasmid DNA.

Identification of plasmids by restriction: mu.l plasmid, 0.5. mu.l EcoRI, 2. mu.l 10 XNEB buffer, 0.2. mu.l 100 XBSA, water to 20. mu.l, water bath at 37 ℃ for 2 h; the cleaved fragments were detected by 1% agarose gel electrophoresis. The plasmid is transformed into TOP-10 competent cells, spread on an X-gal agar plate and cultured for 24h, and then white colonies are picked for colony PCR rapid identification, wherein PCR primers are XS1S/XS1A, and the length of the product is 1320bp (figure 2). Colony PCR results showed that some white colonies were false positive ( Line 3, 5 and 7).

And (3) sequencing the plasmid with correct enzyme digestion identification by Huada Gene company, and analyzing the sequencing result. And (3) analyzing a sequencing result: the sequencing peak image is clear, no miscellaneous peak appears, and the colony is proved to be a single clone. The results show that: the experiment successfully introduces the MCS sequence ATCGAT (in the sequence of ATCGAT) into the CVB3 infectious clone plasmid pCVClaⅠ)AGGCCT(StuI) and 2A is introduced before and after the reaction^proThe cleavage recognition sequence (TMTNTG/AFGQQSQA) (FIG. 3).

Construction of GFP-containing CVB3 infectious clone plasmid (pCV-GFP)

The correctly sequenced PCR-recovered product (GFP) from the previous step was subjected to double digestion with Cla I and StuI: GFP 5. mu.g, NarI and StuI 1.5. mu.l each, 10 XNEB buffer with BSA 5. mu.l, and water to 50. mu.l. Water bath at 37 ℃ for 2 h. The pCV-CS plasmid was digested in the same manner with ClaI and StuI. Electrophoresis and gel recovery of the enzyme digestion product are carried out as follows: 1.2% agarose electrophoresis gel was prepared for recovery of PCR fragments. 0.7% agarose electrophoresis gel is prepared, and pCV-CS plasmid restriction enzyme fragments are recovered. After loading, electrophoresis was performed at 100V for 40 min, and after photographing, recovered with e.z.n.a. Gel Extraction Kit Gel: cutting a target band, adding a sol solution with one time volume, acting at 50 ℃ for 15 min, balancing to room temperature after the sol is completely melted, adding a centrifugal adsorption column, centrifuging at 12000rpm for 1min, then adding 750 mu l of a washing solution, centrifuging at 12000rpm for 1min, continuously adding 500 mu l of the washing solution, centrifuging at 12000rpm for 1min, discarding the washing solution, centrifuging at 12000rpm for 2min, standing at room temperature for 2min, adding 30 mu l of nuclease-free 12000rpm, eluting for 2min, and recovering a product, and freezing and storing at-20 ℃ for later use.

T4 DNA ligase was ligated to the two enzyme recovery fragments as follows: about 10ng of vector, 100ng of PCR-digested fragment, 1. mu. l T4 DNA ligase, 1. mu.l of 10 XT 4 DNA ligation buffer, and 10. mu.l of water. 16 ℃ for 8 h.

The ligation product was transformed into E.coli TOP10 competent bacteria: add 10. mu.l ligation into 50. mu.l TOP10 competent bacteria and leave them on ice for 30 min; water bath at 42 deg.C for 45s, and ice-cooling for 2 min; adding 600 mul LB culture medium, shaking and culturing for 60 minutes at 37 ℃; coating the bacterial liquid on an LB agar plate culture medium containing X-gal, IPTG and Amp, and performing inverted culture at 37 ℃ until a single bacterial colony is formed; white colonies were picked, and the length of the insert in the vector was confirmed by PCR.

Cloning and identification

Selecting white colony, confirming the length of the inserted fragment in the vector by using a PCR method, carrying out electrophoresis identification on the product by using a primer GFPS/GFPA for PCR. The PCR-positive colonies were grown in 5ml Amp + LB liquid medium and cultured overnight with shaking at 37 ℃. Plasmid extraction with e.z.n.a. Plasmid Mini Kit: a. taking 1.0-5.0 ml of bacterial liquid, centrifuging at room temperature for 1min at 10000g, and collecting bacteria; b. pouring out the culture medium, adding 250 mu l of Solution I/RNaseA mixed Solution, and performing vortex oscillation to completely suspend the cells; c. add 250. mu.l of Solution II to the resuspension mix and mix gently upside down 4-6 times (this operation avoids mixing the lysate vigorously and does not exceed 5min for lysis); d. adding 350 μ l of Solution III, and gently inverting for several times until white flocculent precipitate is formed; e. centrifuging at room temperature for 10min at a speed of not less than 10,000 g; f. transferring the supernatant to a HiBind DNA binding column sleeved with a 2ml collecting pipe, centrifuging for 1min at 10,000g at room temperature, and pouring off the filtrate in the collecting pipe; g. the column was replaced with the collection tube, 500. mu.l HB Buffer was added, centrifugation was carried out under the above conditions, and the filtrate was discarded; h. the column is re-installed into the collection tube, 700 mul of DNA Wash Buffer is added, the centrifugation is carried out according to the conditions, and the filtrate is discarded; i. discarding the filtrate, and repeating the step 9 once; j. discarding the filtrate, reloading the column into the collection tube, centrifuging the empty column at 10,000g for 2min to spin-dry the column matrix; k. the column was mounted in a clean 1.5ml centrifuge tube, 30-50. mu.l of Elution Buffer (10mM Tris-HCl, pH 8.5) or sterile water was added to the column matrix, left to stand for 1-2min, and centrifuged at 10,000g for 1min to elute plasmid DNA.

Identification of plasmids by restriction: mu.l plasmid, 0.5. mu.l EcoRI, 2. mu.l 10 XNEB buffer, 0.2. mu.l 100 XBSA, water to 20. mu.l, water bath at 37 ℃ for 2 h; the cleaved fragments were detected by electrophoresis on a 1% agarose gel.

Plasmid transformationTOP10Competent cells were plated on X-gal agar plates for 24h, and white colonies were picked for colony PCR rapid identification with PCR primers GFPS/GFPA and product length 720bp (FIG. 4). The colony PCR results showed that some white colonies were false positive (Line 3-8).

In order to further verify whether the plasmid in the positive colony is inserted into the CVB3 full-length gene or not, the colony PCR positive colony is subjected to amplification culture in an Amp + LB liquid culture medium for 24 hours, and the plasmid is extracted and utilizedEcoRI, enzyme digestion identification. The results show that: the sizes of the fragments after pCV-GFP enzyme digestion are 5443 bp, 3280 bp and 2181 bp respectively; the sizes of the fragments after pCV-CS enzyme digestion are 5443, 3280 and 1467 bp respectively; the sizes of the fragments after pCV enzyme digestion are 5443 bp, 3280 bp and 1425 bp respectively; the size of the cleaved fragment of the recombinant plasmid was consistent with the expected results (FIG. 5). The results prove that two modified CVB3 whole gene clones (pCV-CS and pCV-GFP) are successfully obtained on the basis of the existing CVB3 whole gene clone pCV. And (3) sequencing the plasmid with correct enzyme digestion identification by Huada gene company, and analyzing the sequencing result. Analyzing a sequencing result: the sequencing report sequence and the peak map are accurate in correspondence, the result shows that the 2Apro enzyme digestion recognition sequence is connected with GFP at the Cla I enzyme digestion site, the connection sequence is correct, and the base mutation is not found in the sequence comparison result (figure 6).

Transfection of eukaryotic cells to obtain recombinant viruses

Liposome transfection was used in this study. The lipofection steps are as follows: COS-7 cells were first seeded in 6-well plates and cultured to 90% confluent plates in DMEM complete medium containing 10% fetal bovine serum, 100U/ml penicillin, and 100 ng/ml streptomycin. Mixing 6. mu.l Lipofectamine 2000 and 125. mu.l Opti-MEM, standing at room temperature for 5min, and mixing 20. mu.l plasmid (pCV-CS or pCV-GFP) and 125. mu.l Opti-MEM; mixing the two tubes of mixed solution, standing at room temperature for 20 min; removing the cell culture solution by suction, washing the cells for 2 times by using 1 ml of DMEM, and adding a DMEM liquid culture medium without serum and antibiotics; adding a mixed solution of plasmids and liposomes to the monolayer cells, shaking up, placing at 37 ℃, culturing for 6h in a 5% CO2 incubator, then removing the supernatant, adding 2ml of DMEM medium containing 2% fetal calf serum and 100 ng/ml streptomycin, culturing for 48h, observing cytopathic effect during the culture, and collecting cell suspension when 90% of cells have cytopathic effect; after centrifugation at 12000rpm at 4 ℃ for 30min, the virus-containing supernatants were collected and the recombinant viruses obtained after transfection of pCV-CS and pCV-GFP were designated rCV-CS and rCV-GFP, respectively. Cell supernatants were collected 48 hours after transfection and the isolated recombinant virus was named rCV-GFP. Recombinant virus rCV-GFP was inoculated into Vero cells and the cell morphology was observed under light microscopy (FIG. 7). The results show that: rCV-typical cytopathic effects of rounding, wall detachment, increased refractivity, etc. appeared in Vero cells 12h after GFP infection, with CPE in about 90% of cells at 48h (FIG. 7 f), which was the same as CPE at 48h after CVB3-WT infection (FIG. 7 b).

Amplification of recombinant viruses rCV-CS and rCV-GFP

The amplification method of the collected virus supernatant was as follows: taking 10 mu l of virus liquid supernatant, inoculating the virus liquid supernatant into a 25 cm2 cell culture bottle of 90% confluent monolayer Vero cells, adsorbing the virus liquid supernatant for 1h at 37 ℃, washing the virus liquid supernatant for 3 times by using DMEM, adding DMEM 5ml culture medium containing 2% fetal calf serum and 100 ng/ml streptomycin, culturing the virus liquid supernatant for 48h, observing cytopathic effect during the culture, freezing and thawing the virus liquid supernatant for 3 times when 90% cells have cytopathic effect, and collecting cell suspension; centrifuging at 12000rpm at 4 deg.C for 30min, collecting supernatant containing virus, detecting virus titer by TCID50 method, packaging, and freezing at-80 deg.C.

Viral RNA preparation

Viral genomic RNA was extracted with NucleoSpin RNA Virus kit: (1) splitting virus, adding 150 μ l virus solution into 600 μ l RAV1, and keeping at 70 deg.C for 5 min; (2) adding 600 mul of absolute ethyl alcohol; (3) column adsorption, adding the mixture into adsorption column, centrifuging at 8000g for 1 min; (4) rinsing sequentially for 3 times 500 RAW, 600 μ l RAW3 centrifuging 8000g for 1min, 200 μ l RAW3 centrifuging 11000g for 5 min; (5) eluting, 50 μ l RNase-free water at 70 deg.C, standing at room temperature for 5min, centrifuging 11000g, 1 min. The RNA obtained was stored at-80 ℃ until use.

Reverse transcription of synthetic viral cDNA

Mu.l of 10mM dNTP Mix, 1. mu.l of random primer and 10. mu.l of viral RNA were added to a centrifugal tube without RNase, mixed well at 65 ℃ for 5min, and rapidly ice-washed for 2 min. Then, 4. mu.l of 5 Xfirst strand cDNA synthesis buffer, 2. mu.l of 0.1M DTT, 1. mu.l of RNase inhibitor were added, and after 2min at 37 ℃, 1. mu.l of SuperScript III reverse transcriptase was added. The above system is placed at 25 deg.C for 5min, then at 50 deg.C for 30min, and finally at 70 deg.C for 15 min to inactivate enzyme. The resulting first strand cDNA product was stored at-80 ℃ until use.

Recombinant viral nucleic acid identification

Collecting the Virus suspension, centrifuging at 12000rpm and 4 ℃ for 10min, taking the supernatant, and extracting Virus genome RNA by using a NucleoSpin RNA Virus kit: (1) splitting virus, adding 150 μ l virus solution into 600 μ l RAV1, and keeping at 70 deg.C for 5 min; (2) adding 600 mul of absolute ethyl alcohol; (3) column adsorption, passing the upper mixture through adsorption column, centrifuging for 8000g for 1min, (4) rinsing for 3 times 500 RAW, 600 μ l RAW3 centrifuging for 8000g for 1min, 200 μ l RAW3 centrifuging for 11000g for 5 min; (5) eluting, standing 50 μ l RNase-free water at 70 deg.C for 5min, centrifuging 11000g, and 1min to obtain RNA. RNA is used as a template, and random primers are used for reverse transcription of first strand cDNA. Using this cDNA as a template, PCR was carried out using primers XS1S/XS1A, or GFPS/GFPA. The system is as follows:

Premix Taq	5 μl
		GFPS (10 μM)	0.2 μl
GFPA (10 μM)	0.2 μl
		cDNA
	1 μl
		H2O	Add to10 μl

and (3) PCR reaction conditions: 30 cycles at 94 ℃ for 30 s; 56 ℃ for 30 s; 72 ℃ for 2 min.

The PCR product was subjected to agarose gel electrophoresis, 1.2% agar gel was prepared with 1 XTAE, and SYBR Safe fluorescent dye was added. Setting parameters of a BIO-RAD electrophoresis apparatus: 100V/20 min. Pictures were taken in an AIpha Innotech gel imaging system and the images were analyzed for size comparison to DL2000 Marker.

Recombinant CVB3 Virus propagation assays

Recombinant CVB3 virus rCV-CS, rCV-GFP and wild-type virus were diluted to the same titer, added to a 6-well plate grown with 80% confluent Vero cells at a multiplicity of infection (MOI) of about 0.01, adsorbed in a 5% C02 incubator at 37 ℃ for 1h, washed 3 times with PBS, added with 2ml of DMEM maintenance medium containing 2% FBS, cell supernatants were collected at 6 th, 12 th, 24 th, 48 th and 72 th after inoculation, centrifuged at 12000rpm for 30min at 4 ℃ and virus-containing supernatants were collected and frozen at-80 ℃. Virus titer was measured by TCID50 method and virus growth curves were plotted against titer values. The specific method comprises the following steps:

TCID50 refers to half the cell lethal dose of virus, specifically to a volume of virus dilution at TCID50 dilution to infect cells, after a sufficient incubation time, there is half the possibility that the cells will be totally lethal (CPE). In theory, if cells in any well are infected with one virus particle, CPE is completely appeared in the culture time which is long enough, and finally, the virus in the wells is only contained in a small amount or no virus by a method of limiting dilution, and the virus amount in the virus stock solution can be calculated by using the end point dilution. The specific method comprises the following steps:

preparation of Vero cells: reviving Vero cells at 37 deg.C and 5% CO₂Culturing cells in an incubator until 90% of the cells are fully paved; discarding the original culture solution, digesting the cells with 0.25% pancreatin, and suspending in a DMEM culture solution containing 2% FBS; cells were counted and cell suspension 100. mu.l/well was seeded into 96-well plates, 10,000 cells/well. Culturing in a 5% CO2 incubator at 37 deg.C for 24 h.

Virus dilution: opening a biological safety cabinet, and preparing a virus diluent DMEM +2% FBS +1% double antibody in the biological safety cabinet; taking the virus liquid to be detected, and carrying out the following steps: 10, performing continuous dilution; the diluted virus solution was added to a 96-well plate at 100. mu.l/well. Repeat 7 wells for each dilution; a group of negative control holes are arranged, DMEM +2% FBS +1% double antibody is added, and 100 mu l/hole is formed; gently shaking, mixing, placing in a 5% CO2 incubator at 37 deg.C, and culturing for 3 days.

And (3) judging a positive result: observing under an inverted optical microscope, wherein the CPE pore count is positive (net drawing, cell rounding, wall separation and refractivity enhancement); the number of positive wells was counted.

GFP-tagged CVB3 was constructed and the vital activity of CVB3 and interactions with host cells were studied in living cells. With the aid of fluorescence microscopy, we attempted to observe GFP expression in live cells in real time, reflecting the proliferation, spreading of the virus in Vero cells. GFP expression was not observed at 2h after rCV-GFP infection of Vero; and 6h after infection, part of Vero cells generate fluorescence signals which are scattered in infected cells. Cells expressing fluorescent signals are increased 12h after infection, and the fluorescent signals are enhanced, and after infection for 24h, about 90 percent of cells generate stronger green fluorescent signals. As the infection time increased, the virus proliferated and the signal for expressing GFP also increased, and the progeny virus released infected the surrounding cells, causing changes in CPE and the surrounding infected cells expressing GFP (FIG. 9). The 24h cells showed a significant change in CPE caused by the virus (see fig. 9).

Calculating the TCID50 value (Reed-Muench method): calculating the number of positive wells (P) and the number of negative wells (N) for each virus dilution; calculating the cumulative number of positive and negative wells; positive well accumulation was accumulated from bottom to top (SP). The cumulative number of negative wells is accumulated from top to bottom (SN); calculate the percentage of positive wells: ratio (RP) = (SP)/[ SP + SN ]; calculating a distance proportion: distance ratio = (percentage of positive greater than 50% -50%)/(percentage of positive greater than 50% -percentage of positive less than 50%); lg TCID50 = (highest dilution log of positive percentage greater than 50% + distance ratio) × log of dilution factor. The titer was found to be TCID 50/0.2.

rCV-GFP and prototype CVB3 proliferation Activity differences, after inoculation of Vero cells with the same virus at 0.001 multiplicity of infection, culture supernatants (6, 12, 24, 48 and 72h) were removed at different time points using TCID₅₀The virus titer in the culture supernatant was measured at each time point and plotted as a virus propagation curve (fig. 11). The results show that: rCV and rCV-GFP have similar proliferative activity to prototype CVB3 and similar growth curves; the virus rapidly proliferates within 12h after the CVB3 infects Vero cells, and reaches the highest virus titer of about 10 within 48h⁷ TCID₅₀Per ml; rCV-GFP has a similar proliferation activity to prototype CVB3 and a similar growth curve, but the virus titer is lower than prototype CVB 3.

Infectivity and plaque assay of recombinant CVB3 Virus

Recombinant CVB3 virus and wild virus were inoculated at 0.001 MOI into a 6-well plate of Vero cell 80% confluent plate, adsorbed at 37 ℃ for 1 hour in a 5% C02 incubator, washed 3 times with PBS, cultured in 2ml of a 2% FBS-containing DMEM-containing medium at 37 ℃ in a 5% C02 incubator, observed for cytopathic Condition (CPE), and continuously passed through 20 passages to confirm the ability of the virus to produce CPE, while comparing with the wild type.

Virus was diluted 10-fold in gradient: 10-3, 10-4, 10-5, 10-6, 10-7 and 10-8 which are respectively inoculated on a single layer of Vero cells; adsorbing for 1h at 37 ℃ in a 5% C02 incubator, and washing with PBS 3 times; 2ml of DMEM maintenance medium containing 0.9% low melting agarose was added; adding 4% formaldehyde solution diluted by PBS after 3 days, and fixing for 1h at room temperature; removing agar with running water, adding crystal violet staining solution, and standing at room temperature for 30 min; washing away residual dye liquor by running water, and observing the shape and diameter of the plaque.

rCV-GFP infectivity experiment results show that after rCV-GFP is infected for 24h, cells contract and fall off, and CPE with enhanced refractivity changes. The invention evaluates the biological characteristics of the virus and the virulence of the virus through plaques formed by the virus. The plaque forming time and the shape and size of the plaque can reflect the growth characteristics of the virus. In our experiments rCV-GFP was compared with the prototype CVB3 plaque morphology and time to spotting. The results show that: rCV-GFP, rCV and prototype CVB3 virus all showed plaques 72h after infecting Vero cells; the plaques formed by rCV, rCV-GFP were smaller in diameter than the plaques formed by the prototype CVB3 virus at the same infectious dose and time (FIG. 10). And (4) prompting by a result: infectivity of recombinant CVB3 virus was significantly reduced compared to prototype CVB3 virus.

Immunoblotting method for detecting recombinant CVB3 virus protein expression

Recombinant CVB3 virus and wild virus were inoculated into a 6-well plate of Vero cell 80% confluent plate at 0.001 MOI, adsorbed for 1h at 37 ℃ in a 5% CO2 incubator, washed 3 times with PBS, added with 2ml of DMEM maintenance solution containing 2% FBS, and incubated for 24h at 37 ℃ in a 5% CO2 incubator. Removing culture supernatant, adding 50 μ l of 2 xSDS-PAGE protein loading buffer solution to lyse cells; collecting lysate at 100 deg.C for 10 min; loading 8 μ l of SDS-PAGE gel, wherein the concentration of the upper layer gel is 5%, and the lower layer gel is 12%; protein electrophoresis parameters: 80V, about 60 min; and after the sample enters the separation gel, adjusting the voltage to 110V, and stopping electrophoresis when the minimum belt in the protein Marker runs to the lowest part of the gel or the bromocyanine is about to run out of the gel. Thus, rCV-GFP virus was serially passaged on Vero cells for 10 passages, and expression of VP1 and GFP protein was examined after rCV-GFP infected Vero cells by immunoblotting. The results show that: the recombinant virus rCV-GFP still can express the virus shell protein VP1 and the foreign protein GFP after the 5 th generation (p5) and the 10 th generation (p10) of the Vero cells are continuously passaged (FIG. 12).

Recombinant CVB3 virus rCV-GFP infected mice

To confirm whether rCV-GFP could be used as a biopsy, the tissue tropism of CVB3 was investigated. The invention adopts rCV-GFP 10⁵ TCID50 intraperitoneal injection, infecting 4-week-old male Balb/c mice. On day 4 post-infection, mice were sacrificed and heart and pancreas were paraffin sections examined for GFP expression and immunofluorescence. To investigate whether recombinant GFP tracer viruses (rCV-GFP) could be used for live virus tracing in animals. Furthermore, the invention researches the tissue distribution condition of the virus after rCV-GFP infects Balb/c mice. Because, numerous studies have shown that after CVB3 infection in mice, the virus proliferates mainly in the pancreas and infects cardiomyocytes. Therefore, pancreatic and cardiac tissue sections were selected for tissue immunofluorescence to determine whether GFP expression co-localized to the same tissue cells as viral capsid protein VP 1.

Preparing a paraffin section: cutting mouse tissue into pieces smaller than 1cm3, and immersing in 4% paraformaldehyde for fixation overnight; and (3) dehydrating: gradient dehydration of ethanol (30%, 50%, 70%, 80%, 90%, 95%, 100% x 2) with one change at 30min intervals; and (3) transparency: 2/3 ethanol +1/3 xylene → 1/2 ethanol +1/2 xylene → 1/3 ethanol +2/3 xylene → xylene (twice), wherein the residence time of each stage is 0.5-2 hours; wax dipping: melting paraffin at 62 ℃, and immersing the tissue in the paraffin for about 24 hours; embedding: the waxed tissue is wrapped in wax to form blocks; slicing 5 μm, spreading in 40 deg.C warm water, sticking on glass slide, baking at 40 deg.C, and standing overnight; dewaxing xylene twice for 10min, dewaxing with ethanol gradient to water (100% x 2, 95%, 90%, 80%, 70%) for 5min each stage, and distilling water for 5 min.

Tissue section immunofluorescence: washing the slices with 0.1M PBS for 5min for 3 times; soaking in 0.3% hydrogen peroxide solution at room temperature for 20 min; washing with 0.1M PBS for 5min 3 times; sealing serum for 1 h; primary antibody (1:50 anti-VP 1 mouse monoclonal antibody) overnight at 4 ℃, negative control was replaced with PBS; washing with 0.1M PBS for 5min 3 times; adding a secondary antibody (1:500 Cy3 labeled rabbit anti-mouse IgG) at room temperature, and keeping away from light for 1 h; washing with 0.1M PBS for 5min for 3 times; sealing by using a neutral sealing agent; and (4) observing by a fluorescence microscope. The results showed that the viral capsid protein VP1 co-localized with GFP tissue in both cardiomyocytes and pancreatic cells (fig. 13). Therefore, the tissue cell localization of the virus can be observed under a fluorescence microscope only after tissue sectioning, and the complicated fluorescence detection step of the immune tissue is omitted. Thus, it was suggested that GFP could track viruses in living animal tissue cells.

Sequence listing

<110> first-person hospital in Yichang city

<120> recombinant coxsackie B3 virus with fluorescent protein label and construction method

<160> Total number 7

<210>1

<211>7415

<212>DNA

<213> Artificial sequence

<223>rCV-GFP

<400>SEQ ID NO：1

TTAAAACAGCCTGTGGGTTGATCCCACCCACAGGGCCCATTGGGCGCTAGCACTCTGGTATCACGGTACCTTTGTGCGCCTGTTTTATACCCCCTCCCCCAACTGTAACTTAGAAGTAACACACACTGATCAACAGTCAGCGTGGCACACCAGCCACGTTTTGATCAAGCACTTCTGTTACCCCGGACTGAGTATCAATAGACTGCTCACGCGGTTGAAGGAGAAAGCGTTCGTTATCCGGCCAACTACTTCGAAAAACCTAGTAACACCGTGGAAGTTGCAGAGTGTTTCGCTCAGCACTACCCCAGTGTAGATCAGGTCGATGAGTCACCGCATTCCCCACGGGCGACCGTGGCGGTGGCTGCGTTGGCGGCCTGCCCATGGGGAAACCCATGGGACGCTCTAATACAGACATGGTGCGAAGAGTCTATTGAGCTAGTTGGTAGTCCTCCGGCCCCTGAATGCGGCTAATCCTAACTGCGGAGCACACACCCTCAAGCCAGAGGGCAGTGTGTCGTAACGGGCAACTCTGCAGCGGAACCGACTACTTTGGGTGTCCGTGTTTCATTTTATTCCTATACTGGCTGCTTATGGTGACAATTGAGAGATTGTTACCATATAGCTATTGGATTGGCCATCCGGTGACCAATAGAGCTATTATATATCTCTTTGTTGGGTTTATACCACTTAGCTTGAAAGAGGTTAAAACATTACAATTCATTGTTAAGTTGAATACAGCAAAATGGGAGCTCAAGTATCAACGCAAAAGACTGGGGCACATGAGACCGGGCTGAATGCTAGCGGCAATTCCATCATTCACTACACAAATATTAATTATTACAAGGATGCCGCATCCAACTCAGCCAATCGGCAGGATTTCACTCAAGACCCGGGCAAGTTCACAGAACCAGTAAAAGATATCATGATTAAATCACTACCAGCTCTCAACTCCCCCACAGTAGAGGAGTGCGGATACAGTGACAGGGCGAGATCAATCACATTAGGTAACTCCACCATAACGACTCAGGAATGCGCCAACGTGGTGGTGGGCTATGGAGTATGGCCAGATTATCTAAAGGATAGTGAGGCAACAGCAGAGGACCAACCGACCCAACCAGACGTTGCCACATGTAGGTTCTATACCCTTGACTCTGTGCAATGGCAGAAAACCTCACCAGGATGGTGGTGGAAGCTGCCCGATGCTTTGTCGAACTTAGGACTGTTTGGGCAGAACATGCAGTACCACTACTTAGGCCGAACTGGGTATACCGTACATGTGCAGTGCAATGCATCTAAGTTCCACCAAGGATGCTTGCTAGTAGTGTGTGTACCGGAAGCTGAGATGGGTTGCGCAACGCTAGACAACACCCCATCCAGTGCAGAATTGCTGGGGGGCGATAGCGCAAAAGAGTTTGCGGACAAACCGGTCGCATCCGGGTCCAACGAGTTGGTACAGAGGGTGGTGTATAATGCAGGCATGGGGGTGGGTGTTGGAAACCTCACCATTTTCCCCCACCAATGGATCAACCTACGCACCAATAATAGTGCTACAATTGTGATGCCATACACCAACAGTGTACCTATGGATAACATGTTTAGGCATAACAACGTCACCCTAATGGTTATCCCATTTGTACCGCTAGATTACTGCCCTGGGTCCACCACGTACGTCCCAATTACGGTCACGATAGCCCCAATGTGTGCCGAGTACAATGGGTTACGTTTAGCAGGGCACCAGGGCTTACCAACCATGAATACTCCGGGGAGCTGTCAATTTCTGACATCAGACGACTTCCAATCACCATCCGCCATGCCGCAATATGACGTCACACCAGAGATGAGGATACCTGGTGAGGTGAAAAACTTGATGGAAATAGCTGAGGTTGACTCAGTTGTCCCAGTCCAAAATGTTGGAGAGAAGGTCAACTCTATGGAAGCATACCAGATACCTGTGAGATCCAATGAAGGATCTGGAACGCAAGTATTCGGCTTTCCACTGCAACCAGGGTACTCGAGTGTTTTTTGTCGGACGCTCCTAGGAGAGATCTTGAACTATTATACACATTGGTCAGGCAGCATAAAGCTTACGTTTATGTTCTGTGGTTCGGCCATGGCTACTGGAAAATTCCTTTTGGCATACTCACCACCAGGTGCTGGAGCTCCTACAAAAAGGGTTGATGCCATGCTTGGTACTCATGTAGTTTGGGACGTGGGGCTACAATCAAGTTGCGTGCTGTGTATACCCTGGATAAGCCAAACACACTACCGGTATGTTACTTCAGATGAGTATACCGCAGGGGGTTTTATTACGTGCTGGTATCAAACAAACATAGTGGTCCCAGCGGATGCCCAAAGCTCCTGTTACATCATGTGTTTCGTGTCAGCATGCAATGACTTCTCTGTCAGGCTATTGAAGGACACTCCTTTCATTTCGCAGCAAAACTTTTACCAGGGCCCAGTGGAAGATGCGATAACAGCCGCTATAGGGAGAGTTGCGGATACCGTGGGTACAGGGCCAACCAACTCAGAAGCTATACCAGCACTCACTGCTGCTGAGACAGGTCACACGTCACAAGTAGTGCCGGGTGACACCATGCAGACACGCCACGTTAAGAACTACCATTCAAGGTCCGAGTCAACCATAGAGAACTTCCTATGTAGGTCAGCATGCGTGTACTTTACGGCGTATAGAAACTCAGGTGCCAAGCGGTATGCTGAATGGGTATTAACACCACGACAAGCAGCACAACTTAGGAGAAAGCTAGAATTCTTTACCTACGTCCGGTTCGACCTGGAGCTGACGTTTGTCATAACAAGTACTCAACAGCCCTCAACCACACAGAACCAAGACGCACAGATCCTAACACACCAAATTATGTATGTACCACCAGGTGGACCTGTACCAGATAAAGTTGATTCATACGTGTGGCAAACATCTACGAATCCCAGTGTGTTTTGGACCGAGGGAAACGCCCCGCCGCGCATGTCCATACCGTTTTTGAGCATTGGCAACGCCTATTCAAATTTCTATGACGGATGGTCTGAATTTTCCAGGAACGGAGTTTACGGCATCAACACGCTAAACAACATGGGCACGCTATATGCAAGACATGTCAACGCTGGAAGCACGGGTCCAATAAAAAGCACCATTAGAATCTACTTCAAACCGAAGCATGTCAAAGCGTGGATACCTAGACCACCTAGACTCTGCCAATACGAGAAGGCAAAGAACGTGAACTTCCAACCCAGCGGAGTTACCACTACTAGGCAAAGCATCACTACAATGACAAATACGGGCGCATTTGGACAACAATCAGGGGCAGTGTATGTGGGGAACTACAGGGTAGTAAATAGACATCTAGCTACCAGTGCTGACTGGCAAAACTGTGTGTGGGAAAGTTACAACAGAGACCTCTTAGTGAGCACGACCACAGCACATGGATGTGATATTATAGCCAGATGTCAGTGCACAACGGGAGTGTACTTTTGTGCGTCCAAAAACAAGCACTACCCAATTTCGTTTGAAGGACCAGGTCTAGTAGAGGTCCAAGAGAGTGAATACTACCCCAGGAGATACCAATCCCATGTGCTTTTAGCAGCTGGATTTTCCGAACCAGGTGACTGTGGCGGTATCCTAAGGTGTGAGCATGGTGTCATTGGCATTGTGACCATGGGGGGTGAAGGCGTGGTCGGCTTTGCAGACATCCGTGATCTCCTGTGGCTGGAAGATGATGCAATGGAACAGGGAGTGAAGGACTATGTGGAACAGCTTGGAAATGCATTCGGCTCCGGCTTTACTAACCAAATATGTGAGCAAGTCAACCTCCTGAAAGAATCACTAGTGGGTCAAGACTCCATCTTAGAGAAATCTCTAAAAGCCTTAGTTAAGATAATATCAGCCTTAGTAATTGTGGTGAGGAACCACGATGACCTGATCACTGTGACTGCCACACTAGCCCTTATCGGTTGTACCTCGTCCCCGTGGCGGTGGCTCAAACAGAAGGTATCACAATATTACGGAATCCCTATGGCTGAACGCCAAAACAATAGCTGGCTTAAGAAATTTACTGAAATGACGAATGCTTGCAAGGGTATGGAATGGATAGCTGTCAAAATTCAGAAATTCATTGAATGGCTCAAAGTAAAAATTTTGCCAGAGGTCAGGGAAAAACACGAATTCCTGAACAGACTTAAACAACTCCCCTTATTAGAAAGTCAGATCGCCACAATCGAGCAGAGCGCGCCATCCCAAAGTGACCAGGAACAATTATTTTCCAATGTCCAATACTTTGCCCACTATTGCAGAAAGTACGCTCCCCTCTACGCAGCTGAAGCAAAGAGGGTGTTCTCCCTTGAGAAGAAGATGAGCAATTACATACAGTTCAAGTCCAAATGCCGTATTGAACCTGTATGTTTGCTCCTGCACGGGAGCCCTGGTGCCGGCAAGTCGGTGGCAACAAACTTAATTGGAAGGTCGCTTGCTGAGAAACTCAACAGCTCAGTGTACTCACTACCGCCAGACCCAGATCACTTCGACGGATACAAACAGCAGGCCGTGGTGATTATGGACGATCTATGCCAGAATCCTGATGGGAAAGACGTCTCCTTGTTCTGCCAAATGGTTTCCAGTGTAGATTTTGTACCACCCATGGCTGCCCTAGAAGAGAAAGGCATTCTGTTCACCTCACCGTTTGTCTTGGCATCGACCAATGCAGGATCTATTAATGCTCCAACCGTGTCAGATAGCAGAGCCTTGGCAAGGAGATTTCACTTTGACATGAACATCGAGGTTATTTCCATGTACAGTCAGAATGGCAAGATAAACATGCCCATGTCAGTCAAGACTTGTGACGATGAGTGTTGCCCGGTCAATTTTAAAAAGTGCTGCCCTCTTGTGTGTGGGAAGGCTATACAATTCATTGATAGAAGAACACAGGTCAGATACTCTCTAGACATGCTAGTCACCGAGATGTTTAGGGAGTACAATCATAGACACAGCGTGGGGACCACGCTTGAGGCACTGTTCCAGGGACCACCAGTATACAGAGAGATCAAAATTAGCGTTGCACCAGAGACACCACCACCGCCCGCCATTGCGGACCTGCTCAAATCGGTAGACAGTGAGGCTGTGAGGGAGTACTGCAAAGAAAAAGGATGGTTGGTTCCTGAGATCAACTCCACCCTCCAAATTGAGAAACATGTCAGTCGGGCTTTCATTTGCTTACAGGCATTGACCACATTTGTGTCAGTGGCTGGAATCATATATATAATATATAAGCTCTTTGCGGGTTTTCAAGGTGCTTATACAGGAGTGCCCAACCAGAAGCCCAGAGTGCCTACCCTGAGGCAAGCAAAAGTGCAAGGCCCTGCCTTTGAGTTCGCCGTCGCAATGATGAAAAGGAACTCAAGCATGGTGAAAACTGAATATGGCGAGTTTACCATGCTGGGCATCTATGACAGGTGGGCCGTTTTGCCACGCCACGCCAAACCTGGGCCAACCATCTTGATGAATGATCAAGAGGTTGGTGTGCTAGATGCCAAGGAGCTAGTAGACAAGGACGGCACCAACTTAGAACTGACACTACTCAAATTGAACCGGAATGAGAAGTTCAGAGACATCAGAGGCTTCTTAGCCAAGGAGGAAGTGGAGGTTAATGAGGCAGTGCTAGCAATTAACACCAGCAAGTTTCCCAACATGTACATTCCAGTAGGACAGGTCACAGAATACGGCTTCCTAAACCTAGGTGGCACACCCACCAAGAGAATGCTTATGTACAACTTCCCCACAAGAGCAGGCCAGTGTGGTGGAGTGCTCATGTCCACCGGCAAGGTACTGGGTATCCATGTTGGTGGAAATGGCCATCAGGGCTTCTCAGCAGCACTCCTCAAACACTACTTCAATGATGAGCAAGGTGAAATAGAATTTATTGAGAGCTCAAAGGACGCCGGGTTTCCAGTCATCAACACACCAAGTAAAACAAAGTTGGAGCCTAGTGTTTTCCACCAGGTCTTTGAGGGGAACAAAGAACCAGCAGTACTCAGGAGTGGGGATCCACGTCTCAAGGCCAATTTTGAAGAGGCTATATTTTCCAAGTATATAGGAAATGTCAACACACACGTGGATGAGTACATGCTGGAAGCAGTGGACCACTACGCAGGCCAACTAGCCACCCTAGATATCAGCACTGAACCAATGAAACTGGAGGACGCAGTGTACGGTACCGAGGGTCTTGAGGCGCTTGATCTAACAACGAGTGCCGGTTACCCATATGTTGCACTGGGTATCAAGAAGAGGGACATCCTCTCTAAGAAGACTAAGGACCTAACAAAGTTAAAGGAATGTATGGACAAGTATGGCCTGAACCTACCAATGGTGACTTATGTAAAAGATGAGCTCAGGTCCATAGAGAAGGTAGCGAAAGGAAAGTCTAGGCTGATTGAGGCGTCCAGTTTGAATGATTCAGTGGCGATGAGACAGACATTTGGTAATCTGTACAAAACTTTCCACCTAAACCCAGGGGTTGTGACTGGTAGTGCTGTTGGGTGTGACCCAGACCTCTTTTGGAGCAAGATACCAGTGATGTTAGATGGACATCTCATAGCATTTGATTACTCTGGGTACGATGCTAGCTTAAGCCCTGTCTGGTTTGCTTGCCTAAAAATGTTACTTGAGAAGCTTGGATACACGCACAAAGAGACAAACTACATTGACTACTTGTGCAACTCCCATCACCTGTACAGGGATAAACATTACTTTGTGAGGGGTGGCATGCCCTCGGGATGTTCTGGTACCAGTATTTTCAACTCAATGATTAACAATATCATAATTAGGACACTAATGCTAAAAGTGTACAAAGGGATTGACTTGGACCAATTCAGGATGATCGCATATGGTGATGATGTGATCGCATCGTACCCATGGCCTATAGATGCATCTTTACTCGCTGAAGCTGGTAAGGGTTACGGGCTGATCATGACACCAGCAGATAAGGGAGAGTGCTTTAACGAAGTTACCTGGACCAACGTCACTTTCCTAAAGAGGTATTTTAGAGCAGATGAACAGTACCCCTTCCTGGTGCATCCTGTTATGCCCATGAAAGACATACACGAATCAATTAGATGGACCAAGGATCCAAAGAACACCCAAGATCACGTGCGCTCACTGTGTCTATTAGCTTGGCATAACGGGGAGCACGAATATGAGGAGTTCATCCGTAAAATTAGAAGCGTCCCAGTCGGACGTTGTTTGACCCTCCCCGCGTTTTCAACTCTGCGCAGGAAGTGGTTGGACTCCTTTTAGATTAGAGACAATTTGAAATAATTTAGATTGGCTTAACCCTACTGTGCTAACCGAACCAGATAACGGTACAGTAGGGGTAAATTCTCCGCATTCGGTGCGGAAAAAAAAAAAAAAA

<210>2

<211>10186

<212>DNA

<213> Artificial sequence

<223>pCV-CS

<400>SEQ ID NO：2

tctagaggatccccgggtaccgagctcgaattcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggccctttcgtctcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccggagacggtcacagcttgtctgtaagcggatgccgggagcagacaagcccgtcagggcgcgtcagcgggtgttggcgggtgtcggggctggcttaactatgcggcatcagagcagattgtactgagagtgcaccatatgcggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgccaagcttgcatgcctgcaggtcgactaatacgactcactatagggttaaaacagcctgtgggttgatcccacccacagggcccattgggcgctagcactctggtatcacggtacctttgtgcgcctgttttataccccctcccccaactgtaacttagaagtaacacacactgatcaacagtcagcgtggcacaccagccacgttttgatcaagcacttctgttaccccggactgagtatcaatagactgctcacgcggttgaaggagaaagcgttcgttatccggccaactacttcgaaaaacctagtaacaccgtggaagttgcagagtgtttcgctcagcactaccccagtgtagatcaggtcgatgagtcaccgcattccccacgggcgaccgtggcggtggctgcgttggcggcctgcccatggggaaacccatgggacgctctaatacagacatggtgcgaagagtctattgagctagttggtagtcctccggcccctgaatgcggctaatcctaactgcggagcacacaccctcaagccagagggcagtgtgtcgtaacgggcaactctgcagcggaaccgactactttgggtgtccgtgtttcattttattcctatactggctgcttatggtgacaattgagagattgttaccatatagctattggattggccatccggtgaccaatagagctattatatatctctttgttgggtttataccacttagcttgaaagaggttaaaacattacaattcattgttaagttgaatacagcaaaatgggagctcaagtatcaacgcaaaagactggggcacatgagaccgggctgaatgctagcggcaattccatcattcactacacaaatattaattattacaaggatgccgcatccaactcagccaatcggcaggatttcactcaagacccgggcaagttcacagaaccagtaaaagatatcatgattaaatcactaccagctctcaactcccccacagtagaggagtgcggatacagtgacagggcgagatcaatcacattaggtaactccaccataacgactcaggaatgcgccaacgtggtggtgggctatggagtatggccagattatctaaaggatagtgaggcaacagcagaggaccaaccgacccaaccagacgttgccacatgtaggttctatacccttgactctgtgcaatggcagaaaacctcaccaggatggtggtggaagctgcccgatgctttgtcgaacttaggactgtttgggcagaacatgcagtaccactacttaggccgaactgggtataccgtacatgtgcagtgcaatgcatctaagttccaccaaggatgcttgctagtagtgtgtgtaccggaagctgagatgggttgcgcaacgctagacaacaccccatccagtgcagaattgctggggggcgatagcgcaaaagagtttgcggacaaaccggtcgcatccgggtccaacgagttggtacagagggtggtgtataatgcaggcatgggggtgggtgttggaaacctcaccattttcccccaccaatggatcaacctacgcaccaataatagtgctacaattgtgatgccatacaccaacagtgtacctatggataacatgtttaggcataacaacgtcaccctaatggttatcccatttgtaccgctagattactgccctgggtccaccacgtacgtcccaattacggtcacgatagccccaatgtgtgccgagtacaatgggttacgtttagcagggcaccagggcttaccaaccatgaatactccggggagctgtcaatttctgacatcagacgacttccaatcaccatccgccatgccgcaatatgacgtcacaccagagatgaggatacctggtgaggtgaaaaacttgatggaaatagctgaggttgactcagttgtcccagtccaaaatgttggagagaaggtcaactctatggaagcataccagatacctgtgagatccaatgaaggatctggaacgcaagtattcggctttccactgcaaccagggtactcgagtgtttttagtcggacgctcctaggagagatcttgaactattatacacattggtcaggcagcataaagcttacgtttatgttctgtggttcggccatggctactggaaaattccttttggcatactcaccaccaggtgctggagctcctacaaaaagggttgatgccatgcttggtactcatgtagtttgggacgtggggctacaatcaagttgcgtgctgtgtataccctggataagccaaacacactaccggtatgttacttcagatgagtataccgcagggggttttattacgtgctggtatcaaacaaacatagtggtcccagcggatgcccaaagctcctgttacatcatgtgtttcgtgtcagcatgcaatgacttctctgtcaggctattgaaggacactcctttcgtttcgcagcaaaacttttaccagggcccagtggaagatgcgataacagccgctatagggagagttgcggataccgtgggtacagggccaaccaactcagaagctataccagcactcactgctgctgagacaggtcacacgtcacaagtagtgccgggtgacaccatgcagacacgccacgttaagaactaccattcaaggtccgagtcaaccatagagaacttcctatgtaggtcagcatgcgtgtactttacggcgtatagaaactcaggtgccaagcggtatgctgaatgggtattaacaccacgacaagcagcacaacttaggagaaagctagaattctttacctacgtccggttcgacctggagctgacgtttgtcataacaagtactcaacagccctcaaccacacagaaccaagacgcacagatcctaacacaccaaattatgtatgtaccaccaggtggacctgtaccagataaagttgattcatacgtgtggcaaacatctacgaatcccagtgtgttttggaccgagggaaacgccccgccgcgcatgtccataccgtttttgagcattggcaacgcctattcaaatttctatgacggatggtctgaattttccaggaacggagtttacggcatcaacacgctaaacaacatgggcacgctatatgcaagacatgtcaacgctggaagcacgggtccaataaaaagcaccattagaatctacttcaaaccgaagcatgtcaaagcgtggatacctagaccacctagactctgccaatacgagaaggcaaagaacgtgaacttccaacccagcggagttaccactactaggcaaagcatcactacaatgacaaatacgggcgcatttggacaacaatcaggggcaatcgatcgcaggcctacaatgacaaatacgggcgcatttggacaacaatcaggggcagtgtatgtggggaactacagggtagtaaatagacatctagctaccagtgctgactggcaaaactgtgtgtgggaaagttacaacagagacctcttagtgagcacgaccacagcacatggatgtgatattatagccagatgtcagtgcacaacgggagtgtacttttgtgcgtccaaaaacaagcactacccaatttcgtttgaaggaccaggtctagtagaggtccaagagagtgaatactaccccaggagataccaatcccatgtgcttttagcagctggattttccgaaccaggtgactgtggcggtatcctaaggtgtgagcatggtgtcattggcattgtgaccatggggggtgaaggcgtggtcggctttgcagacatccgtgatctcctgtggctggaagatgatgcaatggaacagggagtgaaggactatgtggaacagcttggaaatgcattcggctccggctttactaaccaaatatgtgagcaagtcaacctcctgaaagaatcactagtgggtcaagactccatcttagagaaatctctaaaagccttagttaagataatatcagccttagtaattgtggtgaggaaccacgatgacctgatcactgtgactgccacactagcccttatcggttgtacctcgtccccgtggcggtggctcaaacagaaggtatcacaatattacggaatccctatggctgaacgccaaaacaatagctggcttaagaaatttactgaaatgacgaatgcttgcaagggtatggaatggatagctgtcaaaattcagaaattcattgaatggctcaaagtaaaaattttgccagaggtcagggaaaaacacgaattcctgaacagacttaaacaactccccttattagaaagtcagatcgccacaatcgagcagagcgcgccatcccaaagtgaccaggaacaattattttccaatgtccaatactttgcccactattgcagaaagtacgctcccctctacgcagctgaagcaaagagggtgttctcccttgagaagaagatgagcaattacatacagttcaagtccaaatgccgtattgaacctgtatgtttgctcctgcacgggagccctggtgccggcaagtcggtggcaacaaacttaattggaaggtcgcttgctgagaaactcaacagctcagtgtactcactaccgccagacccagatcacttcgacggatacaaacagcaggccgtggtgattatggacgatctatgccagaatcctgatgggaaagacgtctccttgttctgccaaatggtttccagtgtagattttgtaccacccatggctgccctagaagagaaaggcattctgttcacctcaccgtttgtcttggcatcgaccaatgcaggatctattaatgctccaaccgtgtcagatagcagagccttggcaaggagatttcactttgacatgaacatcgaggttatttccatgtacagtcagaatggcaagataaacatgcccatgtcagtcaagacttgtgacgatgagtgttgcccggtcaattttaaaaagtgctgccctcttgtgtgtgggaaggctatacaattcattgatagaagaacacaggtcagatactctctagacatgctagtcaccgagatgtttagggagtacaatcatagacacagcgtggggaccacgcttgaggcactgttccagggaccaccagtatacagagagatcaaaattagcgttgcaccagagacaccaccaccgcccgccattgcggacctgctcaaatcggtagacagtgaggctgtgagggagtactgcaaagaaaaaggatggttggttcctgagatcaactccaccctccaaattgagaaacatgtcagtcgggctttcatttgcttacaggcattgaccacatttgtgtcagtggctggaatcatatatataatatataagctctttgcgggttttcaaggtgcttatacaggagtgcccaaccagaagcccagagtgcctaccctgaggcaagcaaaagtgcaaggccctgcctttgagttcgccgtcgcaatgatgaaaaggaactcaagcatggtgaaaactgaatatggcgagtttaccatgctgggcatctatgacaggtgggccgttttgccacgccacgccaaacctgggccaaccatcttgatgaatgatcaagaggttggtgtgctagatgccaaggagctagtagacaaggacggcaccaacttagaactgacactactcaaattgaaccggaatgagaagttcagagacatcagaggcttcttagccaaggaggaagtggaggttaatgaggcagtgctagcaattaacaccagcaagtttcccaacatgtacattccagtaggacaggtcacagaatacggcttcctaaacctaggtggcacacccaccaagagaatgcttatgtacaacttccccacaagagcaggccagtgtggtggagtgctcatgtccaccggcaaggtactgggtatccatgttggtggaaatggccatcagggcttctcagcagcactcctcaaacactacttcaatgatgagcaaggtgaaatagaatttattgagagctcaaaggacgccgggtttccagtcatcaacacaccaagtaaaacaaagttggagcctagtgttttccaccaggtctttgaggggaacaaagaaccagcagtactcaggagtggggatccacgtctcaaggccaattttgaagaggctatattttccaagtatataggaaatgtcaacacacacgtggatgagtacatgctggaagcagtggaccactacgcaggccaactagccaccctagatatcagcactgaaccaatgaaactggaggacgcagtgtacggtaccgagggtcttgaggcgcttgatctaacaacgagtgccggttacccatatgttgcactgggtatcaagaagagggacatcctctctaagaagactaaggacctaacaaagttaaaggaatgtatggacaagtatggcctgaacctaccaatggtgacttatgtaaaagatgagctcaggtccatagagaaggtagcgaaaggaaagtctaggctgattgaggcgtccagtttgaatgattcagtggcgatgagacagacatttggtaatctgtacaaaactttccacctaaacccaggggttgtgactggtagtgctgttgggtgtgacccagacctcttttggagcaagataccagtgatgttagatggacatctcatagcatttgattactctgggtacgatgctagcttaagccctgtctggtttgcttgcctaaaaatgttacttgagaagcttggatacacgcacaaagagacaaactacattgactacttgtgcaactcccatcacctgtacagggataaacattactttgtgaggggtggcatgccctcgggatgttctggtaccagtattttcaactcaatgattaacaatatcataattaggacactaatgctaaaagtgtacaaagggattgacttggaccaattcaggatgatcgcatatggtgatgatgtgatcgcatcgtacccatggcctatagatgcatctttactcgctgaagctggtaagggttacgggctgatcatgacaccagcagataagggagagtgctttaacgaagttacctggaccaacgtcactttcctaaagaggtattttagagcagatgaacagtaccccttcctggtgcatcctgttatgcccatgaaagacatacacgaatcaattagatggaccaaggatccaaagaacacccaagatcacgtgcgctcactgtgtctattagcttggcataacggggagcacgaatatgaggagttcatccgtaaaattagaagcgtcccagtcggacgttgtttgaccctccccgcgttttcaactctgcgcaggaagtggttggactccttttagattagagacaatttgaaataatttagattggcttaaccctactgtgctaaccgaaccagataacggtacagtaggggtaaattctccgcattcggtgcggaaaaaaaaaaaaaaagcggccgc

<210>3

<211>15

<212>DNA

<213> Artificial sequence

<223> sequence of multicloning site MCS

<400>SEQ ID NO：3

ATCGATCGCAGGCCT

<210>4

<211>42

<212>DNA

<213> Artificial sequence

<223>2Apro enzyme digestion recognition sequence

<400>SEQ ID NO：4

ACAATGACAAATACGGGCGCATTTGGACAACAATCAGGGGCA （TMTNTG/AFGQQSQA）

<210>5

<211>53

<212>DNA

<213> Artificial sequence

<223> primer set for MCS on multiple cloning site

<400>SEQ ID NO：5

GTACTCGAGTGTTTTTAGTCGGACG；CGATCGATTGCCCCTGATTGTTGTCCA

<210>6

<211>54

<212>DNA

<213> Artificial sequence

<223>2Apro primers for cleavage of recognition sequence

<400>SEQ ID NO：6

CAATCGATCGCAGGCCTACAATGACAAATA；CCACTAGTGATTCTTTCAGGAGG

<210>7

<211>45

<212>DNA

<213> Artificial sequence

<223> primer set for introducing GFP-encoding gene into multiple cloning site of pCV-CS

<400>SEQ ID NO：7

TCATCGATATGGTGAGCAAGGG；TAAGGCCTCTTGTACAGCTCGT

Sequence listing

<110> first-person hospital in Yichang city

<120> recombinant coxsackie B3 virus with fluorescent protein label and construction method

<160> Total number 7

<210>1

<211>7415

<212>DNA

<213> Artificial sequence

<223>rCV-GFP

<400>SEQ ID NO：1

TTAAAACAGCCTGTGGGTTGATCCCACCCACAGGGCCCATTGGGCGCTAGCACTCTGGTATCACGGTACCTTTGTGCGCC

TGTTTTATACCCCCTCCCCCAACTGTAACTTAGAAGTAACACACACTGATCAACAGTCAGCGTGGCACACCAGCCACGTT

TTGATCAAGCACTTCTGTTACCCCGGACTGAGTATCAATAGACTGCTCACGCGGTTGAAGGAGAAAGCGTTCGTTATCCG

GCCAACTACTTCGAAAAACCTAGTAACACCGTGGAAGTTGCAGAGTGTTTCGCTCAGCACTACCCCAGTGTAGATCAGGT

CGATGAGTCACCGCATTCCCCACGGGCGACCGTGGCGGTGGCTGCGTTGGCGGCCTGCCCATGGGGAAACCCATGGGACG

CTCTAATACAGACATGGTGCGAAGAGTCTATTGAGCTAGTTGGTAGTCCTCCGGCCCCTGAATGCGGCTAATCCTAACTG

CGGAGCACACACCCTCAAGCCAGAGGGCAGTGTGTCGTAACGGGCAACTCTGCAGCGGAACCGACTACTTTGGGTGTCCG

TGTTTCATTTTATTCCTATACTGGCTGCTTATGGTGACAATTGAGAGATTGTTACCATATAGCTATTGGATTGGCCATCC

GGTGACCAATAGAGCTATTATATATCTCTTTGTTGGGTTTATACCACTTAGCTTGAAAGAGGTTAAAACATTACAATTCA

TTGTTAAGTTGAATACAGCAAAATGGGAGCTCAAGTATCAACGCAAAAGACTGGGGCACATGAGACCGGGCTGAATGCTA

GCGGCAATTCCATCATTCACTACACAAATATTAATTATTACAAGGATGCCGCATCCAACTCAGCCAATCGGCAGGATTTC

ACTCAAGACCCGGGCAAGTTCACAGAACCAGTAAAAGATATCATGATTAAATCACTACCAGCTCTCAACTCCCCCACAGT

AGAGGAGTGCGGATACAGTGACAGGGCGAGATCAATCACATTAGGTAACTCCACCATAACGACTCAGGAATGCGCCAACG

TGGTGGTGGGCTATGGAGTATGGCCAGATTATCTAAAGGATAGTGAGGCAACAGCAGAGGACCAACCGACCCAACCAGAC

GTTGCCACATGTAGGTTCTATACCCTTGACTCTGTGCAATGGCAGAAAACCTCACCAGGATGGTGGTGGAAGCTGCCCGA

TGCTTTGTCGAACTTAGGACTGTTTGGGCAGAACATGCAGTACCACTACTTAGGCCGAACTGGGTATACCGTACATGTGC

AGTGCAATGCATCTAAGTTCCACCAAGGATGCTTGCTAGTAGTGTGTGTACCGGAAGCTGAGATGGGTTGCGCAACGCTA

GACAACACCCCATCCAGTGCAGAATTGCTGGGGGGCGATAGCGCAAAAGAGTTTGCGGACAAACCGGTCGCATCCGGGTC

CAACGAGTTGGTACAGAGGGTGGTGTATAATGCAGGCATGGGGGTGGGTGTTGGAAACCTCACCATTTTCCCCCACCAAT

GGATCAACCTACGCACCAATAATAGTGCTACAATTGTGATGCCATACACCAACAGTGTACCTATGGATAACATGTTTAGG

CATAACAACGTCACCCTAATGGTTATCCCATTTGTACCGCTAGATTACTGCCCTGGGTCCACCACGTACGTCCCAATTAC

GGTCACGATAGCCCCAATGTGTGCCGAGTACAATGGGTTACGTTTAGCAGGGCACCAGGGCTTACCAACCATGAATACTC

CGGGGAGCTGTCAATTTCTGACATCAGACGACTTCCAATCACCATCCGCCATGCCGCAATATGACGTCACACCAGAGATG

AGGATACCTGGTGAGGTGAAAAACTTGATGGAAATAGCTGAGGTTGACTCAGTTGTCCCAGTCCAAAATGTTGGAGAGAA

GGTCAACTCTATGGAAGCATACCAGATACCTGTGAGATCCAATGAAGGATCTGGAACGCAAGTATTCGGCTTTCCACTGC

AACCAGGGTACTCGAGTGTTTTTTGTCGGACGCTCCTAGGAGAGATCTTGAACTATTATACACATTGGTCAGGCAGCATA

AAGCTTACGTTTATGTTCTGTGGTTCGGCCATGGCTACTGGAAAATTCCTTTTGGCATACTCACCACCAGGTGCTGGAGC

TCCTACAAAAAGGGTTGATGCCATGCTTGGTACTCATGTAGTTTGGGACGTGGGGCTACAATCAAGTTGCGTGCTGTGTA

TACCCTGGATAAGCCAAACACACTACCGGTATGTTACTTCAGATGAGTATACCGCAGGGGGTTTTATTACGTGCTGGTAT

CAAACAAACATAGTGGTCCCAGCGGATGCCCAAAGCTCCTGTTACATCATGTGTTTCGTGTCAGCATGCAATGACTTCTC

TGTCAGGCTATTGAAGGACACTCCTTTCATTTCGCAGCAAAACTTTTACCAGGGCCCAGTGGAAGATGCGATAACAGCCG

CTATAGGGAGAGTTGCGGATACCGTGGGTACAGGGCCAACCAACTCAGAAGCTATACCAGCACTCACTGCTGCTGAGACA

GGTCACACGTCACAAGTAGTGCCGGGTGACACCATGCAGACACGCCACGTTAAGAACTACCATTCAAGGTCCGAGTCAAC

CATAGAGAACTTCCTATGTAGGTCAGCATGCGTGTACTTTACGGCGTATAGAAACTCAGGTGCCAAGCGGTATGCTGAAT

GGGTATTAACACCACGACAAGCAGCACAACTTAGGAGAAAGCTAGAATTCTTTACCTACGTCCGGTTCGACCTGGAGCTG

ACGTTTGTCATAACAAGTACTCAACAGCCCTCAACCACACAGAACCAAGACGCACAGATCCTAACACACCAAATTATGTA

TGTACCACCAGGTGGACCTGTACCAGATAAAGTTGATTCATACGTGTGGCAAACATCTACGAATCCCAGTGTGTTTTGGA

CCGAGGGAAACGCCCCGCCGCGCATGTCCATACCGTTTTTGAGCATTGGCAACGCCTATTCAAATTTCTATGACGGATGG

TCTGAATTTTCCAGGAACGGAGTTTACGGCATCAACACGCTAAACAACATGGGCACGCTATATGCAAGACATGTCAACGC

TGGAAGCACGGGTCCAATAAAAAGCACCATTAGAATCTACTTCAAACCGAAGCATGTCAAAGCGTGGATACCTAGACCAC

CTAGACTCTGCCAATACGAGAAGGCAAAGAACGTGAACTTCCAACCCAGCGGAGTTACCACTACTAGGCAAAGCATCACT

ACAATGACAAATACGGGCGCATTTGGACAACAATCAGGGGCAGTGTATGTGGGGAACTACAGGGTAGTAAATAGACATCT

AGCTACCAGTGCTGACTGGCAAAACTGTGTGTGGGAAAGTTACAACAGAGACCTCTTAGTGAGCACGACCACAGCACATG

GATGTGATATTATAGCCAGATGTCAGTGCACAACGGGAGTGTACTTTTGTGCGTCCAAAAACAAGCACTACCCAATTTCG

TTTGAAGGACCAGGTCTAGTAGAGGTCCAAGAGAGTGAATACTACCCCAGGAGATACCAATCCCATGTGCTTTTAGCAGC

TGGATTTTCCGAACCAGGTGACTGTGGCGGTATCCTAAGGTGTGAGCATGGTGTCATTGGCATTGTGACCATGGGGGGTG

AAGGCGTGGTCGGCTTTGCAGACATCCGTGATCTCCTGTGGCTGGAAGATGATGCAATGGAACAGGGAGTGAAGGACTAT

GTGGAACAGCTTGGAAATGCATTCGGCTCCGGCTTTACTAACCAAATATGTGAGCAAGTCAACCTCCTGAAAGAATCACT

AGTGGGTCAAGACTCCATCTTAGAGAAATCTCTAAAAGCCTTAGTTAAGATAATATCAGCCTTAGTAATTGTGGTGAGGA

ACCACGATGACCTGATCACTGTGACTGCCACACTAGCCCTTATCGGTTGTACCTCGTCCCCGTGGCGGTGGCTCAAACAG

AAGGTATCACAATATTACGGAATCCCTATGGCTGAACGCCAAAACAATAGCTGGCTTAAGAAATTTACTGAAATGACGAA

TGCTTGCAAGGGTATGGAATGGATAGCTGTCAAAATTCAGAAATTCATTGAATGGCTCAAAGTAAAAATTTTGCCAGAGG

TCAGGGAAAAACACGAATTCCTGAACAGACTTAAACAACTCCCCTTATTAGAAAGTCAGATCGCCACAATCGAGCAGAGC

GCGCCATCCCAAAGTGACCAGGAACAATTATTTTCCAATGTCCAATACTTTGCCCACTATTGCAGAAAGTACGCTCCCCT

CTACGCAGCTGAAGCAAAGAGGGTGTTCTCCCTTGAGAAGAAGATGAGCAATTACATACAGTTCAAGTCCAAATGCCGTA

TTGAACCTGTATGTTTGCTCCTGCACGGGAGCCCTGGTGCCGGCAAGTCGGTGGCAACAAACTTAATTGGAAGGTCGCTT

GCTGAGAAACTCAACAGCTCAGTGTACTCACTACCGCCAGACCCAGATCACTTCGACGGATACAAACAGCAGGCCGTGGT

GATTATGGACGATCTATGCCAGAATCCTGATGGGAAAGACGTCTCCTTGTTCTGCCAAATGGTTTCCAGTGTAGATTTTG

TACCACCCATGGCTGCCCTAGAAGAGAAAGGCATTCTGTTCACCTCACCGTTTGTCTTGGCATCGACCAATGCAGGATCT

ATTAATGCTCCAACCGTGTCAGATAGCAGAGCCTTGGCAAGGAGATTTCACTTTGACATGAACATCGAGGTTATTTCCAT

GTACAGTCAGAATGGCAAGATAAACATGCCCATGTCAGTCAAGACTTGTGACGATGAGTGTTGCCCGGTCAATTTTAAAA

AGTGCTGCCCTCTTGTGTGTGGGAAGGCTATACAATTCATTGATAGAAGAACACAGGTCAGATACTCTCTAGACATGCTA

GTCACCGAGATGTTTAGGGAGTACAATCATAGACACAGCGTGGGGACCACGCTTGAGGCACTGTTCCAGGGACCACCAGT

ATACAGAGAGATCAAAATTAGCGTTGCACCAGAGACACCACCACCGCCCGCCATTGCGGACCTGCTCAAATCGGTAGACA

GTGAGGCTGTGAGGGAGTACTGCAAAGAAAAAGGATGGTTGGTTCCTGAGATCAACTCCACCCTCCAAATTGAGAAACAT

GTCAGTCGGGCTTTCATTTGCTTACAGGCATTGACCACATTTGTGTCAGTGGCTGGAATCATATATATAATATATAAGCT

CTTTGCGGGTTTTCAAGGTGCTTATACAGGAGTGCCCAACCAGAAGCCCAGAGTGCCTACCCTGAGGCAAGCAAAAGTGC

AAGGCCCTGCCTTTGAGTTCGCCGTCGCAATGATGAAAAGGAACTCAAGCATGGTGAAAACTGAATATGGCGAGTTTACC

ATGCTGGGCATCTATGACAGGTGGGCCGTTTTGCCACGCCACGCCAAACCTGGGCCAACCATCTTGATGAATGATCAAGA

GGTTGGTGTGCTAGATGCCAAGGAGCTAGTAGACAAGGACGGCACCAACTTAGAACTGACACTACTCAAATTGAACCGGA

ATGAGAAGTTCAGAGACATCAGAGGCTTCTTAGCCAAGGAGGAAGTGGAGGTTAATGAGGCAGTGCTAGCAATTAACACC

AGCAAGTTTCCCAACATGTACATTCCAGTAGGACAGGTCACAGAATACGGCTTCCTAAACCTAGGTGGCACACCCACCAA

GAGAATGCTTATGTACAACTTCCCCACAAGAGCAGGCCAGTGTGGTGGAGTGCTCATGTCCACCGGCAAGGTACTGGGTA

TCCATGTTGGTGGAAATGGCCATCAGGGCTTCTCAGCAGCACTCCTCAAACACTACTTCAATGATGAGCAAGGTGAAATA

GAATTTATTGAGAGCTCAAAGGACGCCGGGTTTCCAGTCATCAACACACCAAGTAAAACAAAGTTGGAGCCTAGTGTTTT

CCACCAGGTCTTTGAGGGGAACAAAGAACCAGCAGTACTCAGGAGTGGGGATCCACGTCTCAAGGCCAATTTTGAAGAGG

CTATATTTTCCAAGTATATAGGAAATGTCAACACACACGTGGATGAGTACATGCTGGAAGCAGTGGACCACTACGCAGGC

CAACTAGCCACCCTAGATATCAGCACTGAACCAATGAAACTGGAGGACGCAGTGTACGGTACCGAGGGTCTTGAGGCGCT

TGATCTAACAACGAGTGCCGGTTACCCATATGTTGCACTGGGTATCAAGAAGAGGGACATCCTCTCTAAGAAGACTAAGG

ACCTAACAAAGTTAAAGGAATGTATGGACAAGTATGGCCTGAACCTACCAATGGTGACTTATGTAAAAGATGAGCTCAGG

TCCATAGAGAAGGTAGCGAAAGGAAAGTCTAGGCTGATTGAGGCGTCCAGTTTGAATGATTCAGTGGCGATGAGACAGAC

ATTTGGTAATCTGTACAAAACTTTCCACCTAAACCCAGGGGTTGTGACTGGTAGTGCTGTTGGGTGTGACCCAGACCTCT

TTTGGAGCAAGATACCAGTGATGTTAGATGGACATCTCATAGCATTTGATTACTCTGGGTACGATGCTAGCTTAAGCCCT

GTCTGGTTTGCTTGCCTAAAAATGTTACTTGAGAAGCTTGGATACACGCACAAAGAGACAAACTACATTGACTACTTGTG

CAACTCCCATCACCTGTACAGGGATAAACATTACTTTGTGAGGGGTGGCATGCCCTCGGGATGTTCTGGTACCAGTATTT

TCAACTCAATGATTAACAATATCATAATTAGGACACTAATGCTAAAAGTGTACAAAGGGATTGACTTGGACCAATTCAGG

ATGATCGCATATGGTGATGATGTGATCGCATCGTACCCATGGCCTATAGATGCATCTTTACTCGCTGAAGCTGGTAAGGG

TTACGGGCTGATCATGACACCAGCAGATAAGGGAGAGTGCTTTAACGAAGTTACCTGGACCAACGTCACTTTCCTAAAGA

GGTATTTTAGAGCAGATGAACAGTACCCCTTCCTGGTGCATCCTGTTATGCCCATGAAAGACATACACGAATCAATTAGA

TGGACCAAGGATCCAAAGAACACCCAAGATCACGTGCGCTCACTGTGTCTATTAGCTTGGCATAACGGGGAGCACGAATA

TGAGGAGTTCATCCGTAAAATTAGAAGCGTCCCAGTCGGACGTTGTTTGACCCTCCCCGCGTTTTCAACTCTGCGCAGGA

AGTGGTTGGACTCCTTTTAGATTAGAGACAATTTGAAATAATTTAGATTGGCTTAACCCTACTGTGCTAACCGAACCAGA

TAACGGTACAGTAGGGGTAAATTCTCCGCATTCGGTGCGGAAAAAAAAAAAAAAA

<210>2

<211>10186

<212>DNA

<213> Artificial sequence

<223>pCV-CS

<400>SEQ ID NO：2

tctagaggatccccgggtaccgagctcgaattcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctca

caattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaatt

gcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggag

aggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcgg

tatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggc

cagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaa

aaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcg

tgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcat

agctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcc

cgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagcca

ctggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacact

agaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaa

acaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatc

ctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaa

aggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctga

cagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccg

tcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccg

gctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccat

ccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgcta

caggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatga

tcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatc

actcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtact

caaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgcca

catagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgag

atccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaa

aaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaa

tattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaatagg

ggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaata

ggcgtatcacgaggccctttcgtctcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccggagacg

gtcacagcttgtctgtaagcggatgccgggagcagacaagcccgtcagggcgcgtcagcgggtgttggcgggtgtcgggg

ctggcttaactatgcggcatcagagcagattgtactgagagtgcaccatatgcggtgtgaaataccgcacagatgcgtaa

ggagaaaataccgcatcaggcgccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcg

ctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacg

ttgtaaaacgacggccagtgccaagcttgcatgcctgcaggtcgactaatacgactcactatagggttaaaacagcctgt

gggttgatcccacccacagggcccattgggcgctagcactctggtatcacggtacctttgtgcgcctgttttataccccc

tcccccaactgtaacttagaagtaacacacactgatcaacagtcagcgtggcacaccagccacgttttgatcaagcactt

ctgttaccccggactgagtatcaatagactgctcacgcggttgaaggagaaagcgttcgttatccggccaactacttcga

aaaacctagtaacaccgtggaagttgcagagtgtttcgctcagcactaccccagtgtagatcaggtcgatgagtcaccgc

attccccacgggcgaccgtggcggtggctgcgttggcggcctgcccatggggaaacccatgggacgctctaatacagaca

tggtgcgaagagtctattgagctagttggtagtcctccggcccctgaatgcggctaatcctaactgcggagcacacaccc

tcaagccagagggcagtgtgtcgtaacgggcaactctgcagcggaaccgactactttgggtgtccgtgtttcattttatt

cctatactggctgcttatggtgacaattgagagattgttaccatatagctattggattggccatccggtgaccaatagag

ctattatatatctctttgttgggtttataccacttagcttgaaagaggttaaaacattacaattcattgttaagttgaat

acagcaaaatgggagctcaagtatcaacgcaaaagactggggcacatgagaccgggctgaatgctagcggcaattccatc

attcactacacaaatattaattattacaaggatgccgcatccaactcagccaatcggcaggatttcactcaagacccggg

caagttcacagaaccagtaaaagatatcatgattaaatcactaccagctctcaactcccccacagtagaggagtgcggat

acagtgacagggcgagatcaatcacattaggtaactccaccataacgactcaggaatgcgccaacgtggtggtgggctat

ggagtatggccagattatctaaaggatagtgaggcaacagcagaggaccaaccgacccaaccagacgttgccacatgtag

gttctatacccttgactctgtgcaatggcagaaaacctcaccaggatggtggtggaagctgcccgatgctttgtcgaact

taggactgtttgggcagaacatgcagtaccactacttaggccgaactgggtataccgtacatgtgcagtgcaatgcatct

aagttccaccaaggatgcttgctagtagtgtgtgtaccggaagctgagatgggttgcgcaacgctagacaacaccccatc

cagtgcagaattgctggggggcgatagcgcaaaagagtttgcggacaaaccggtcgcatccgggtccaacgagttggtac

agagggtggtgtataatgcaggcatgggggtgggtgttggaaacctcaccattttcccccaccaatggatcaacctacgc

accaataatagtgctacaattgtgatgccatacaccaacagtgtacctatggataacatgtttaggcataacaacgtcac

cctaatggttatcccatttgtaccgctagattactgccctgggtccaccacgtacgtcccaattacggtcacgatagccc

caatgtgtgccgagtacaatgggttacgtttagcagggcaccagggcttaccaaccatgaatactccggggagctgtcaa

tttctgacatcagacgacttccaatcaccatccgccatgccgcaatatgacgtcacaccagagatgaggatacctggtga

ggtgaaaaacttgatggaaatagctgaggttgactcagttgtcccagtccaaaatgttggagagaaggtcaactctatgg

aagcataccagatacctgtgagatccaatgaaggatctggaacgcaagtattcggctttccactgcaaccagggtactcg

agtgtttttagtcggacgctcctaggagagatcttgaactattatacacattggtcaggcagcataaagcttacgtttat

gttctgtggttcggccatggctactggaaaattccttttggcatactcaccaccaggtgctggagctcctacaaaaaggg

ttgatgccatgcttggtactcatgtagtttgggacgtggggctacaatcaagttgcgtgctgtgtataccctggataagc

caaacacactaccggtatgttacttcagatgagtataccgcagggggttttattacgtgctggtatcaaacaaacatagt

ggtcccagcggatgcccaaagctcctgttacatcatgtgtttcgtgtcagcatgcaatgacttctctgtcaggctattga

aggacactcctttcgtttcgcagcaaaacttttaccagggcccagtggaagatgcgataacagccgctatagggagagtt

gcggataccgtgggtacagggccaaccaactcagaagctataccagcactcactgctgctgagacaggtcacacgtcaca

agtagtgccgggtgacaccatgcagacacgccacgttaagaactaccattcaaggtccgagtcaaccatagagaacttcc

tatgtaggtcagcatgcgtgtactttacggcgtatagaaactcaggtgccaagcggtatgctgaatgggtattaacacca

cgacaagcagcacaacttaggagaaagctagaattctttacctacgtccggttcgacctggagctgacgtttgtcataac

aagtactcaacagccctcaaccacacagaaccaagacgcacagatcctaacacaccaaattatgtatgtaccaccaggtg

gacctgtaccagataaagttgattcatacgtgtggcaaacatctacgaatcccagtgtgttttggaccgagggaaacgcc

ccgccgcgcatgtccataccgtttttgagcattggcaacgcctattcaaatttctatgacggatggtctgaattttccag

gaacggagtttacggcatcaacacgctaaacaacatgggcacgctatatgcaagacatgtcaacgctggaagcacgggtc

caataaaaagcaccattagaatctacttcaaaccgaagcatgtcaaagcgtggatacctagaccacctagactctgccaa

tacgagaaggcaaagaacgtgaacttccaacccagcggagttaccactactaggcaaagcatcactacaatgacaaatac

gggcgcatttggacaacaatcaggggcaatcgatcgcaggcctacaatgacaaatacgggcgcatttggacaacaatcag

gggcagtgtatgtggggaactacagggtagtaaatagacatctagctaccagtgctgactggcaaaactgtgtgtgggaa

agttacaacagagacctcttagtgagcacgaccacagcacatggatgtgatattatagccagatgtcagtgcacaacggg

agtgtacttttgtgcgtccaaaaacaagcactacccaatttcgtttgaaggaccaggtctagtagaggtccaagagagtg

aatactaccccaggagataccaatcccatgtgcttttagcagctggattttccgaaccaggtgactgtggcggtatccta

aggtgtgagcatggtgtcattggcattgtgaccatggggggtgaaggcgtggtcggctttgcagacatccgtgatctcct

gtggctggaagatgatgcaatggaacagggagtgaaggactatgtggaacagcttggaaatgcattcggctccggcttta

ctaaccaaatatgtgagcaagtcaacctcctgaaagaatcactagtgggtcaagactccatcttagagaaatctctaaaa

gccttagttaagataatatcagccttagtaattgtggtgaggaaccacgatgacctgatcactgtgactgccacactagc

ccttatcggttgtacctcgtccccgtggcggtggctcaaacagaaggtatcacaatattacggaatccctatggctgaac

gccaaaacaatagctggcttaagaaatttactgaaatgacgaatgcttgcaagggtatggaatggatagctgtcaaaatt

cagaaattcattgaatggctcaaagtaaaaattttgccagaggtcagggaaaaacacgaattcctgaacagacttaaaca

actccccttattagaaagtcagatcgccacaatcgagcagagcgcgccatcccaaagtgaccaggaacaattattttcca

atgtccaatactttgcccactattgcagaaagtacgctcccctctacgcagctgaagcaaagagggtgttctcccttgag

aagaagatgagcaattacatacagttcaagtccaaatgccgtattgaacctgtatgtttgctcctgcacgggagccctgg

tgccggcaagtcggtggcaacaaacttaattggaaggtcgcttgctgagaaactcaacagctcagtgtactcactaccgc

cagacccagatcacttcgacggatacaaacagcaggccgtggtgattatggacgatctatgccagaatcctgatgggaaa

gacgtctccttgttctgccaaatggtttccagtgtagattttgtaccacccatggctgccctagaagagaaaggcattct

gttcacctcaccgtttgtcttggcatcgaccaatgcaggatctattaatgctccaaccgtgtcagatagcagagccttgg

caaggagatttcactttgacatgaacatcgaggttatttccatgtacagtcagaatggcaagataaacatgcccatgtca

gtcaagacttgtgacgatgagtgttgcccggtcaattttaaaaagtgctgccctcttgtgtgtgggaaggctatacaatt

cattgatagaagaacacaggtcagatactctctagacatgctagtcaccgagatgtttagggagtacaatcatagacaca

gcgtggggaccacgcttgaggcactgttccagggaccaccagtatacagagagatcaaaattagcgttgcaccagagaca

ccaccaccgcccgccattgcggacctgctcaaatcggtagacagtgaggctgtgagggagtactgcaaagaaaaaggatg

gttggttcctgagatcaactccaccctccaaattgagaaacatgtcagtcgggctttcatttgcttacaggcattgacca

catttgtgtcagtggctggaatcatatatataatatataagctctttgcgggttttcaaggtgcttatacaggagtgccc

aaccagaagcccagagtgcctaccctgaggcaagcaaaagtgcaaggccctgcctttgagttcgccgtcgcaatgatgaa

aaggaactcaagcatggtgaaaactgaatatggcgagtttaccatgctgggcatctatgacaggtgggccgttttgccac

gccacgccaaacctgggccaaccatcttgatgaatgatcaagaggttggtgtgctagatgccaaggagctagtagacaag

gacggcaccaacttagaactgacactactcaaattgaaccggaatgagaagttcagagacatcagaggcttcttagccaa

ggaggaagtggaggttaatgaggcagtgctagcaattaacaccagcaagtttcccaacatgtacattccagtaggacagg

tcacagaatacggcttcctaaacctaggtggcacacccaccaagagaatgcttatgtacaacttccccacaagagcaggc

cagtgtggtggagtgctcatgtccaccggcaaggtactgggtatccatgttggtggaaatggccatcagggcttctcagc

agcactcctcaaacactacttcaatgatgagcaaggtgaaatagaatttattgagagctcaaaggacgccgggtttccag

tcatcaacacaccaagtaaaacaaagttggagcctagtgttttccaccaggtctttgaggggaacaaagaaccagcagta

ctcaggagtggggatccacgtctcaaggccaattttgaagaggctatattttccaagtatataggaaatgtcaacacaca

cgtggatgagtacatgctggaagcagtggaccactacgcaggccaactagccaccctagatatcagcactgaaccaatga

aactggaggacgcagtgtacggtaccgagggtcttgaggcgcttgatctaacaacgagtgccggttacccatatgttgca

ctgggtatcaagaagagggacatcctctctaagaagactaaggacctaacaaagttaaaggaatgtatggacaagtatgg

cctgaacctaccaatggtgacttatgtaaaagatgagctcaggtccatagagaaggtagcgaaaggaaagtctaggctga

ttgaggcgtccagtttgaatgattcagtggcgatgagacagacatttggtaatctgtacaaaactttccacctaaaccca

ggggttgtgactggtagtgctgttgggtgtgacccagacctcttttggagcaagataccagtgatgttagatggacatct

catagcatttgattactctgggtacgatgctagcttaagccctgtctggtttgcttgcctaaaaatgttacttgagaagc

ttggatacacgcacaaagagacaaactacattgactacttgtgcaactcccatcacctgtacagggataaacattacttt

gtgaggggtggcatgccctcgggatgttctggtaccagtattttcaactcaatgattaacaatatcataattaggacact

aatgctaaaagtgtacaaagggattgacttggaccaattcaggatgatcgcatatggtgatgatgtgatcgcatcgtacc

catggcctatagatgcatctttactcgctgaagctggtaagggttacgggctgatcatgacaccagcagataagggagag

tgctttaacgaagttacctggaccaacgtcactttcctaaagaggtattttagagcagatgaacagtaccccttcctggt

gcatcctgttatgcccatgaaagacatacacgaatcaattagatggaccaaggatccaaagaacacccaagatcacgtgc

gctcactgtgtctattagcttggcataacggggagcacgaatatgaggagttcatccgtaaaattagaagcgtcccagtc

ggacgttgtttgaccctccccgcgttttcaactctgcgcaggaagtggttggactccttttagattagagacaatttgaa

ataatttagattggcttaaccctactgtgctaaccgaaccagataacggtacagtaggggtaaattctccgcattcggtg

cggaaaaaaaaaaaaaaagcggccgc

<210>3

<211>15

<212>DNA

<213> Artificial sequence

<223> sequence of multicloning site MCS

<400>SEQ ID NO：3

ATCGATCGCAGGCCT

<210>4

<211>42

<212>DNA

<213> Artificial sequence

<223>2Apro enzyme digestion recognition sequence

<400>SEQ ID NO：4

ACAATGACAAATACGGGCGCATTTGGACAACAATCAGGGGCA （TMTNTG/AFGQQSQA）

<210>5

<211>53

<212>DNA

<213> Artificial sequence

<223> primer set for multiple cloning site MCS

<400>SEQ ID NO：5

GTACTCGAGTGTTTTTAGTCGGACG；CGATCGATTGCCCCTGATTGTTGTCCA

<210>6

<211>54

<212>DNA

<213> Artificial sequence

<223>2Apro primers for cleavage of recognition sequence

<400>SEQ ID NO：6

CAATCGATCGCAGGCCTACAATGACAAATA；CCACTAGTGATTCTTTCAGGAGG

<210>7

<211>45

<212>DNA

<213> Artificial sequence

<223> primer set for introducing GFP-encoding gene into multiple cloning site of pCV-CS

<400>SEQ ID NO：7

TCATCGATATGGTGAGCAAGGG；TAAGGCCTCTTGTACAGCTCGT

Claims (8)

1. The recombinant coxsackie B3 virus with the fluorescent protein label is characterized in that the virus is infectious recombinant virus rCV-CS and recombinant virus rCV-GFP expressing GFP, and the sequence is shown as SEQ ID NO: 1.

2. the method for constructing the recombinant coxsackie B3 virus with the fluorescent protein label according to claim 1, which is characterized by comprising the following steps:

(1) on the basis of the full-length infectious cDNA clone plasmid pCV of CVB3, a full-length infectious clone plasmid pCV-CS of CVB3, which contains a multiple cloning site MCS and has a sequence of SEQ ID NO: 2;

amplifying a GFP fragment by taking pEGFP as a template to obtain a GFP coding gene;

(2) introducing a GFP coding gene into a multiple cloning site of pCV-CS to construct a CVB3 whole-gene infectious cloning plasmid pCV-GFP expressing GFP;

(3) the pCV-GFP is transfected and amplified by liposome to obtain recombinant coxsackie B3 virus rCV-GFP with a fluorescent protein label.

3. The method for constructing a recombinant coxsackie B3 virus with a fluorescent protein tag according to claim 2, wherein the multi-cloning site MCS is introduced into a region between P1 and P2 of a full-length infectious cDNA genome of CVB3 in the step (1); the sequence of the multicloning site MCS is SEQ ID NO: 3;

2Apro enzyme digestion recognition sequence is SEQ ID NO: 4.

4. the method for constructing a recombinant coxsackie B3 virus with a fluorescent protein label according to claim 3, wherein a primer pair inserted into the multiple cloning site MCS is SEQ ID NO: 5; the nucleotide sequence of SEQ ID NO: 5 in the upstream sequence of the primer pairXhoⅠAnd (4) enzyme cutting sites.

5. The method for constructing the recombinant coxsackie B3 virus with the fluorescent protein label according to claim 3, wherein a primer pair inserted with a 2Apro enzyme cutting recognition sequence is SEQ ID NO: 6; the nucleotide sequence of SEQ ID NO: 6 in the downstream sequence of the primer pairSpeⅠAnd (4) enzyme cutting sites.

6. The method for constructing a recombinant coxsackie B3 virus with a fluorescent protein label according to claim 2, wherein the primer pair for introducing the GFP encoding gene into the multiple cloning site of pCV-CS in the step (2) is SEQ ID NO: 7.

7. the application of the recombinant coxsackie B3 virus with the fluorescent protein label, which is constructed according to any one of claims 2-6, in the preparation of medicaments for tracing the viruses of the living animals.

8. The use of claim 7, wherein the virally-tagged living animal cells comprise Vero cells, pancreatic cells, cardiac cells.

Images