CN106754758A - A kind of construction method of the restructuring enterovirus phenotype hybrid system of factor-containing adjuvant and its application - Google Patents

Abstract

The invention provides a kind of construction method of the restructuring enterovirus phenotype hybrid system of factor-containing adjuvant, the recombinant attenuated enterovirus strain of VP1 recombinant cell lines and load cells factor gene is built respectively first；Recombinant attenuated enterovirus strain is carried out into infection amplification in VP1 recombinant cell lines afterwards to obtain final product；VP1 recombinant cell lines are expression enterovirns type 71, one or two the cell line of the VP1 of coxsackievirus A16；The recombinant attenuated enterovirus strain of load cells factor gene is selected from Coxsackievirus B3, enterovirns type 71 or poliovirus I types；Cell factor is selected from cholera toxin or interferon gamma；The recombinant attenuated enterovirus infection VP1 recombinant cell lines of load cells factor gene, harvest progeny virus after cytopathy, progeny virus can activate host immune, immunoprotection are produced for various enteroviruses, with application value.

Description

A kind of structure side of the restructuring enterovirus phenotype hybrid system of factor-containing adjuvant Method and its application

Technical field

The present invention relates to biological technical field, more particularly, to a kind of restructuring enterovirus of factor-containing adjuvant The construction method of phenotype hybrid system and its application.

Background technology

Hand-foot-and-mouth disease（Hand-foot-mouth disease, HFMD）It is a kind of infection caused by enterovirus infection Property disease, be mainly in 5 years old Infants Below, clinical manifestation is heating, apocleisis, cries and screams, in portions such as hand, foot, mucous membrane of mouth, crissum There is bleb or ulcer in position.Generally there is hand-foot-and-mouth disease self limiting, the self-healing in one week or so of most infants, but a small number of infants to occur The central nervous systems such as aseptic meningitis, encephalitis, myocarditis, pulmonary edema, cardiovascular system and respiratory system complication, rapidly Severe hand-foot-and-mouth disease is progressed to, can be caused death when serious.Hand-foot-and-mouth disease is occurred frequently in China, is that China's publilc health brings huge Threaten, the Ministry of Public Health in 2008 is included Class C infectious disease and is managed.

Triggering the enterovirus of HFMD has CA group 2-10,12,16,24 type, 1-5 types and the enteron aisle disease of B groups Malicious 71 types（EV71）Deng wherein topmost cause of disease is EV71 and coxsackievirus A16（CA16）.Usual CA16 causes Symptom it is relatively light but cases of infection quantity is big, EV71 is more easy to cause the severe hand-foot-and-mouth disease such as neurological complication, and The separation rate of the CA6 in the groove since 2012 also increasingly increases.Treatment hand-foot-and-mouth disease lacks effective medicine at present, mainly With to the ill and based on supportive treatment.

CA16, EV71 and CA6 belong to Picornaviridae enterovirus genus, are nonencapsulated positive single stranded RNA disease Poison, its capsid is icosahedral symmetry structure, and viral capsid is made up of VP1, VP2, VP3 and VP4, and wherein VP1 is that its is main Capsid protein, while being also VAP, plays a decisive role in viruses adsorption and during penetrating, therefore VP1 is again disease The neutralization antigen of poison.The epidemic situation was severe for hand-foot-and-mouth disease, and only has inactivated vaccine at present for EV71 viruses in terms of preventive means It has been listed that, CA16 there is no vaccine application.

The type of coxsackie B group 3 virus, poliovirus I types, II types and type III virus also belong to Picornaviridae intestines Road Tobamovirus, the virus of enterovirus genus has similarity on biological characteristics.Wherein, the virus of enterovirus genus is being replicated All it is that, with genome as template, read-through transcription is translated as precursor protein into a mRNA, then in virus protein in cycle The effect Self cleavage of enzyme forms various virus proteins.Virus VP 1, VP2, VP3 and VP4 in packing stage, infection cell Progeny virus capsid can be formed, filial generation genome is wrapped up and ultimately forms complete progeny virus is discharged.Packing Cheng Zhong, the virus VP 1 function of enterovirus genus is similar, therefore, a such as cell is by two or more enterovirus genus virus senses Dye, it may occur that the phenomenon of phenotype mixing, i.e., a kind of genome of virus can be wrapped up by the capsid of another virus, this virus Capsid and genomic source in different enteroviruses.

The phenotype mixing phenomena of enterovirus genus virus, the potential value with vaccine research, but natural phenotype mixing There is problem in actual mechanical process.Cell can trigger interference phenomenon to two or more enterovirus simultaneously, make virus The reduction of propagation efficiency, and duplication propagation efficiency after different virus mixed infection differs, it is impossible to carry out effective Quality Control, and right Higher duplication efficiency is needed in the strain of vaccine application value, this is also that current vaccine research field is each increased using monotype virus Grow, the various vaccine that then will be manufactured separately is mixed on demand, without breeding disease using various viral infection cells simultaneously Poison, does not go using phenotype mixed mechanism.

For the virus of " natural " phenotype mixing, in addition to the bottleneck that interference phenomenon and propagation efficiency differ, if by force Strain source then needs to carry out inactivation treatment, is prepared as inactivated vaccine, and on the one hand its inactivated vaccine is noninductive using having inactivated The viral capsid of metachromia, by after internal professional antigen presenting cells working process after intramuscular injection, activation body produces immune answering Answer, be that the exogenous antigen that MHC-II quasi-molecules are relied on is offered, and virus infection is more with MHC-I classes point under natural conditions The endogenous antigen mode of offering that son is relied on activates immunity of organism, therefore protection not as the attenuated live epidemic disease based on attenuation strain Seedling.On the other hand, such as use attenuation enterovirus strain to carry out phenotype mixing, equally there is interference phenomenon and propagation is imitated The bottleneck that rate differs, at the same more limitation phenotype mixing application, various attenuation enterovirus strain mixed infection cells, by Can be complementary with generating function between strain, and unexpected genetic recombination can occur, can greatly increase attenuation strain and reply poison The risk of power.

Therefore, enterovirus phenotype mixing phenomena is such as applied to enterovirus vaccine research and development, it is necessary to set up one The method for planting safe and efficient phenotype hybrid system, can avoid various viruses from infecting caused interference phenomenon simultaneously, breed Efficiency differs, unexpected genetic recombination, attenuation strain reply virulence, while again better than inactivated vaccine immune protective effect.

The content of the invention

The technical problems to be solved by the invention be overcome prior art exist drawbacks described above, there is provided one kind containing cell because The construction method of the restructuring enterovirus phenotype hybrid system of sub- adjuvant.

Second object of the present invention is to provide the restructuring enterovirus table of the factor-containing adjuvant of methods described acquisition Type hybrid system.

Third object of the present invention is to provide the application of the hybrid system.

The purpose of the present invention is achieved by the following technical programs：

A kind of construction method of the restructuring enterovirus phenotype hybrid system of factor-containing adjuvant, builds VP1 weights respectively first The recombinant attenuated enterovirus strain of group cell line and load cells factor gene；Then the restructuring of load cells factor gene is subtracted Malicious enterovirus strain carries out the restructuring enterovirus phenotype that infection amplification obtains final product factor-containing adjuvant in VP1 recombinant cell lines Hybrid system；The VP1 recombinant cell lines are individually or simultaneously to express enterovirns type 71, the VP1 of coxsackievirus A16 One or two cell line；The recombinant attenuated enterovirus strain of the load cells factor gene is selected from CB 3 types of group, enterovirns type 71 or poliovirus I types；The cell factor is selected from cholera toxin or interferon gamma.

The system includes two parts of attenuation enterovirus strain of VP1 recombinant cell lines and load cells factor gene. Wherein VP1 recombinant cell lines are：Enterovirns type 71, the VP1 carrier for expression of eukaryon of coxsackievirus A16 are built, through turning Dye screening obtains the various source VP1 Protein reconstitution expression cells systems of stabilization expression.The attenuation enteron aisle disease of load cells factor gene Poison background strain be：Enterovirns type 71 is attenuated attenuation strain or the polio disease of strain or the type of Sa Qi virus B groups 3 Malicious I types are attenuated strain.On the basis of above-mentioned background strain, infection clones are built, cytokine gene is inserted into viral base Because between P1 the and P2 areas that organize, and adding virus protease restriction enzyme site, through the transfection of infection clones carrier and virus rescue, obtain Obtain the attenuation enterovirus of heterogenous expression cell factor.Cell factor therein can be cholera toxin or interferon gamma. In the system, the recombinant attenuated enterovirus containing load cells factor gene infects other enterovirus VP1 recombination expressions thin After born of the same parents system, in the packing stage of virus multiplication, can be mixed into the VP1 of other enteroviruses in progeny virus capsid by progeny virus. For example, by the progeny virus bred, its virus core is that Coxsackievirus B3 is attenuated strain genome, and its surface is sick VP1 in malicious capsid is loaded in mixture, containing from the VP1 including enterovirns type 71, coxsackievirus A16.Obtained Progeny virus can infection host, but because virus core is the recombinant attenuated enterovirus containing load cells factor gene The genome of strain, its duplication in host and pathogenic is restricted；The cell factor of recombination expression can strengthen place simultaneously Main immune response, and progeny virus contains the VP1 albumen of various enteroviruses, and VP1 is that enterovirus has type specificity Neutralization antigen, therefore, the progeny virus that this kind of system is formed can activate host immune, be produced for various enteroviruses immune Protection.

Preferably, the preparation method of the restructuring enterovirus phenotype hybrid system of the factor-containing adjuvant, including with Lower step：

S1. the VP1 genes of amplification enterovirns type 71 and/or coxsackievirus A16, are connected in carrier for expression of eukaryon, VP1 recombinant cell lines are obtained after transfection, screening；

S2. Coxsackievirus B3, enterovirns type 71 or poliovirus I types are carried out into genome cloning, Under reverse genetics system, insertion cell factor obtains load cells factor gene between P1 the and P2 areas of viral full-length genome Recombinant attenuated enterovirus strain；

The VP1 recombinant cell lines that the recombinant attenuated enterovirus strain infection S1 of the load cells factor gene that S3. S2 is obtained is obtained Obtain final product.

The preparation side of the recombinant attenuated enterovirus strain of VP1 recombinant cell lines of the present invention and load cells factor gene Method is the routine techniques of biology field.

Preferably, the preparation method of VP1 recombinant cell lines is to extract the RNA of corresponding virus, using polyA or random primer Reverse transcription is carried out, cDNA is obtained.Using the specific primer of corresponding virus, the VP1 bases for obtaining corresponding virus are expanded by PCR Cause, using digestion connection by VP1 genetic fragments insertion carrier for expression of eukaryon.Carrier for expression of eukaryon can be used Neo or Puyo to resist Property gene, the carrier for expression of eukaryon for building is using liposome transfection to eukaryotic Vero cells（Or 293, Hep2, HeLa etc. Cell）In, then screened using G418 or puromycin, through western blotting qualification and identified by immunofluorescence after, be somebody's turn to do A portion of phenotype hybrid system, i.e. VP1 recombinant cell lines.

Preferably, the preparation method of the recombinant attenuated enterovirus of load cells factor gene is：By above-mentioned enterovirus In a certain type carry out genome cloning, virus infection clones are built, under reverse genetics system, in the P1 and P2 of virus The region and specific restriction enzyme region of encoding proteins restriction enzyme site are introduced between area, then using restriction enzyme enzyme Enzyme site, inserts cell factor.Cell factor is cholera toxin, to promote the recombinant attenuated strain to exempt from the mucous membrane of intestinal mucosa Epidemic disease response；Also interferon gamma can be used, promotes MHC-II antigens to offer, improve the VP1 subsequently containing various enteroviruses source Immune response efficiency.

The present invention also provides the restructuring enterovirus phenotype hybrid system of the factor-containing adjuvant that the above method is obtained.

In this way, the recombinant attenuated enterovirus infection VP1 recombinant cell lines of load cells factor gene, receive after cytopathy Progeny virus is obtained, obtained containing various separate sources enterovirus VP1 capsids, contained attenuation enterovirus strain genome core The heart, can heterogenous expression cell factor the recombinant attenuated strain of mixing phenotype；The progeny virus that this kind of system is formed can activate host It is immune, produce immunoprotection for various enteroviruses.

Therefore, the present invention also provides the restructuring enterovirus phenotype hybrid system of factor-containing adjuvant in preparation treatment intestines The application of the vaccine approach of road virus.

Compared with prior art, the invention has the advantages that：

The invention provides a kind of construction method of the restructuring enterovirus phenotype hybrid system of factor-containing adjuvant, divide first Not Gou Jian VP1 recombinant cell lines and load cells factor gene recombinant attenuated enterovirus strain；Then by the load cells factor The recombinant attenuated enterovirus strain of gene carries out the restructuring that factor-containing adjuvant is remembered in infection amplification in VP1 recombinant cell lines Enterovirus phenotype hybrid system；The VP1 recombinant cell lines are individually or simultaneously to express enterovirns type 71, Coxsackie virus One or two the cell line of the VP1 of the type of A groups 16；The recombinant attenuated enterovirus strain of the load cells factor gene is selected from Coxsackievirus B3, enterovirns type 71 or poliovirus I types；The cell factor be selected from cholera toxin or Interferon gamma；The recombinant attenuated enterovirus infection VP1 recombinant cell lines of load cells factor gene, harvest son after cytopathy Generation virus, obtain containing various separate sources enterovirus VP1 capsids, containing attenuation enterovirus strain genome core, can The recombinant attenuated strain of mixing phenotype of heterogenous expression cell factor；The progeny virus that this kind of system is formed can activate host immune, Immunoprotection is produced for various enteroviruses, the phenotype hybrid system has actual and is widely applied value.

Brief description of the drawings

Fig. 1 is that CA16 and EV71 strain VP1 fragments PCR expands electrophoretogram；M：NEB 1kb DNA ladder；1：CA16 poison Strain VP1 fragment PCR products；2：EV71 strain VP1 fragment PCR products.

Fig. 2 is the digestion recovery of CA16 and EV71 strain VP1 fragments and carrier for expression of eukaryon pcFlag；M：NEB 1kb DNA ladder；1：CA16 strain VP1 fragment digestion products；2：EV71 strain VP1 fragment digestion products；3：PcFlag digestions are produced Thing.

Fig. 3 is the VP1 eukaryon expression plasmids of VP1 the eukaryon expression plasmids pcFlag-CA16-VP1 and EV71 of CA16 The bacterium colony PCR identifications of pcFlag-EV71-VP1；M：NEB 1kb DNA ladder；1-8：PcFlag-CA16-VP1 bacterium colonies PCR Product；9-16：PcFlag-EV71-VP1 bacterium colony PCR primers.

Fig. 4 is pcFlag-CA16-VP1's and pcFlag-EV71-VP1HindIII andXhoI double digestions are identified；M： NEB 1kb DNA ladder；1-2：PcFlag-CA16-VP1 plasmidsHindIII andXhoI double digestions are identified；9-16： PcFlag-EV71-VP1 plasmidsHindIII andXho I double digestions are identified.

Fig. 5 is the Immunofluorescence test that CA16 and EV71 restructuring VP1 albumen is expressed in cell.

Fig. 6（a）Three sections of PCR expand Sabin1 full length genes, and F1 clip sizes are 2510bp, and F2 clip sizes are 3210bp, F3 fragment are 1880bp.（b）Three fragment PCR bridge joints obtain Sabin1 total lengths, and Sabin1 sizes are 7441bp.（c） The Sabin1 genes and pMD19-T carriers that PCR bridge joints are obtained are connected by EcoR1 and Sal1 cohesive terminus,cohesive terminis and obtain pv-1, pv-2 Two cloning vectors, identify, theory obtains four fragment bands, and size is respectively 5730bp, 2471bp with BamH1 digestions, 1879bp, 30bp, electrophoretic analysis only have three purpose bands, and 30bp is too small, it is impossible to recognize, it may be determined that be positive colony.（d） With EcoR1 and Sal1 restriction enzyme cleavage pv-1, pv-2 Sabin1 carriers, the Sabin1 that size is 7441bp is obtained Fragment and the pMD19-T carrier segments that size is 2692bp or so.

Fig. 7（a）To Sabin1-f1, Sabin1-f2, Sabin1-f3, Sabin1-f4 cloned plasmids carry out digestion and reclaim mesh Fragment, Sabin1-f1 clip sizes be 2481bp, Sabin1-f2 clip sizes be 2136bp, Sabin1-f3 clip sizes It is 1017bp, Sabin1-f4+pMD19-T clip sizes are 4487bp.（b） Sabin1-f1, Sabin1-f2, Sabin1- F3, Sabin1-f4+pMD19-T segmentation connection obtain Sabin1 full length genes, are identified with BamH1 digestion with restriction enzyme, Theory obtains four fragment bands, and size is respectively 5730bp, 2471bp, 1879bp, 30bp, and electrophoretic analysis only has three purposes Band, 30bp is too small, it is impossible to recognize, Sabin1-1, Sabin1-2 are can be determined that substantially, and Sabin1-3 is positive colony.

Fig. 8 (a) bridges the Sabin1 carriers for building EcoR1 and Sal1 digestion with restriction enzyme and reclaims by PCR Sabin1 genes, are connected with the pcDNA3 that EcoR1 and Xho1 cohesive terminus,cohesive terminis are obtained using EcoR1 and Xho1 digestion with restriction enzyme Connect, cloned plasmids identified with BamH1 digestions, theory there are 5 fragments not of uniform size, is 8236bp, 2471bp, 1879bp, 256bp, 30bp.Wherein agarose gel electrophoresis identification, it can be seen that 8236bp, 2471bp, 1879bp size Fragment, 256bp, 30bp is too small, it is impossible to effectively identification, primarily determines that to be positive colony.（b）Connect what is built by fragment PMD19-T_Sabin1 carriers EcoR1 and Not1 digestion with restriction enzyme reclaim Sabin1 fragments and using EcoR1 and The clone that the pcDNA3 connections that Not1 digestion with restriction enzyme is obtained are obtained, uses EcoR1 and Sal1 restriction enzyme enzymes Identification is cut, theory there are 5 fragments not of uniform size：7441bp, 2285bp, 2188bp, 903bp, 34bp.Actual agarose Gel electrophoresis identification may only differentiate 7441bp and（2285bp, 2188bp）Two bands, initial analysis is positive colony.

Fig. 9 is pCV-CS plasmid maps.

Specific embodiment

Present disclosure is further illustrated with reference to specific embodiment, but be should not be construed as limiting the invention. Without departing from the spirit and substance of the case in the present invention, the simple modification or replacement made to the inventive method, step or condition, Belong to the scope of the present invention；If not specializing, technological means used is well known to those skilled in the art in embodiment Conventional meanses.

Embodiment 1

First, the structure of the cell of the VP1 of stabilization expression CA16 and EV71

The coxsackievirus A16 of clinical and Laboratory Diagnosed（Hereinafter referred to as CA16）And enterovirns type 71（Hereinafter referred to as EV71）The sample of cases of infection, the viral RNA of cases of infection is extracted using viral RNA extracts kit respectively, is utilized SuperScript III reverse transcriptases and random primer, reverse transcription obtain the viral cDNA of CA16 and EV71.

With CA16 and EV71 viruses cDNA as template, the sense primer of CA16-VP1 genes：5’- CCTAAGCTTTCTGGGTACTTTGACTATTACACC, anti-sense primer 5 '- CAGCTCGAGTCATGTTGTTATCTTGTCTCTACTAC.The sense primer of EV71-VP1 genes：5’- CCTAAGCTTTATGCCCGAGATGGAGTGTTTGAC, anti-sense primer 5 '- CAGCTCGAGTCATTTCCCAAGAGTGGTGATTGCTG。

Amplification reaction condition：Enter circulation after 94 DEG C of predegeneration 3min, 94 DEG C are denatured 30s, 52 DEG C of renaturation 30s, and 72 DEG C are prolonged 2min is stretched, 72 DEG C of extension 5min after 30 circulations.Through 1.2% agarose gel electrophoresis, corresponding product segment is reclaimed.PCR is produced Owner is about 1100bp or so with size, as a result fulfills the expectation（Fig. 1）.

CA16 and EV71 strain VP1 PCR primers, using agarose gel electrophoresis, reclaim the amplification master tape of estimated size, UtilizeHindIII andXhoI is to VP1 fragments and pCMV-C-Flag plasmids（Abbreviation pcFlag plasmids）Carry out double digestion, digestion Product reuse agarose gel electrophoresis reclaim respective segments, CA16 and EV71 strains VP1 respectively with pCMV-C-Flag plasmids It is attached（Fig. 2）.CA16 and EV71 strains VP1 is attached with pCMV-C-Flag plasmids respectively, transformed competence colibacillus cell Afterwards, respectively selecting 8 through the single bacterium colony of resistance screening carries out bacterium colony PCR identifications, as shown in figure 3, the VP1 eukaryon expression plasmids of CA16 16 bacterium colonies of the VP1 eukaryon expression plasmids pcFlag-EV71-VP1 of pcFlag-CA16-VP1 and EV71 can be amplified accordingly VP1 fragments.

Through bacterium colony PCR identifications, positive 2 clones of each picking of bacterium colony carry out Bacteria Culture and plasmid extraction, carry out digestion mirror It is fixed, as shown in figure 4, throughHindIII andXhoAfter I double digestions, there is the VP1 exogenous sequences of 1100bp or so and about 5kb PcFlag carrier segments.The plasmid of digestion identification carries out sequencing analysis, and as a result completely correct, plasmid is respectively designated as pcFlag- CA16-VP1 and pcFlag-EV71-VP1.

293T cells, RD cells, Vero cells use DMEM（Containing 10% FBS）In 37 DEG C, 5% CO₂, under the conditions of water saturation Culture.Before transfection, the cell that will grow to more than 95% fusion rate is inoculated in 6 porocyte culture plates, treats 20 ~ 24h of cell growth extremely Transfected when cell density is up to 70 ~ 90%.Transfection procedure enters according to the operation manual of the transfection reagents of Lipofectamine 2000 OK.

PcFlag-CA16-VP1 and pcFlag-EV71-VP1 plasmid transfections 293T and RD through digestion and sequence verification is thin Born of the same parents, immune-blotting method is carried out using FLAG antibody, and estimated size strip is occurred in that in the position of about 32Kd, shows eukaryotic expression Plasmid can give expression to the VP1 recombinant proteins of FLAG fusions in 293T and RD cells.

PcFlag-CA16-VP1 and pcFlag-EV71-VP1 plasmid transfection 293T cells, using Immunofluorescence test weight The expression of group VP1, as shown in figure 5, CA16 and EV71 restructuring VP1 albumen is distributed mainly in cell cytosol.

By pcFlag-CA16-VP1 and pcFlag-EV71-VP1 plasmids, with 1：1 ratio cotransfection Vero cells, turn 72h is screened using G418 after dye, by the screening of 3 weeks or so, obtains resistant cell colonies, stabilization is obtained after testing and is expressed The Vero cell line of the VP1 of CA16 and EV71.

2nd, the preparation of the recombinant attenuated enterovirus strain of load cells factor gene

Attenuation enteron aisle background Strain can be used the Coxsackievirus B3 of attenuation or the enterovirns type 71 of attenuation or subtract The poliovirus I types of poison（Sabin vaccine strains）.The total length of clonal virus strain, builds infection clones and reversely something lost Biography system.

It is background virus with poliovirus Sabin strain I types, is cloned using the mode of cDNA clones.Draw Thing sequence is as follows：

The clone that full-length genome is carried out by bridging PCR, it is identified to obtain Sabin strain I type reverse genetic pUC pUCs（Figure 6-8）.Then using PCR in P1 the and P2 areas of Sabin strain I type reverse genetics system plasmids, introducing contains protease cutting site Restriction enzyme site, be inserted into the nontoxic B subunit genes fragment of cholera toxin.Then transfect to Vero cells and save out Recombinant attenuated enterovirus strain Sabin strains I types containing load cells factor gene.

Also pCV-CS plasmids can be used, the Coxsackievirus B3 full-length genome of attenuation is included, and contain protease The restriction enzyme site of enzyme site（Fig. 9）, insert the nontoxic B subunit genes fragment of cholera toxin.Then transfect to Vero cells The recombinant attenuated enterovirus strain Coxsackievirus B3 containing load cells factor gene is saved out afterwards.

Recombinant attenuated enterovirus strain Sabin strains I types containing load cells factor gene, or containing load cells because Subbase because recombinant attenuated enterovirus strain Coxsackievirus B3, stabilization expression CA16 and EV71 VP1 Vero it is thin Born of the same parents system is infected, harvesting supernatant after 48h, and the restructuring enterovirus that phenotype mixes is obtained using supercentrifugation.

SEQUENCE LISTING

<110>Medical College of Shantou University

<120>A kind of construction method of the restructuring enterovirus phenotype hybrid system of factor-containing adjuvant and its application

<130>

<160> 4

<170> PatentIn version 3.3

<210> 1

<211> 33

<212> DNA

<213>The sense primer of CA16-VP1 genes

<400> 1

cctaagcttt ctgggtactt tgactattac acc 33

<210> 2

<211> 35

<212> DNA

<213>The anti-sense primer of CA16-VP1 genes

<400> 2

cagctcgagt catgttgtta tcttgtctct actac 35

<210> 3

<211> 33

<212> DNA

<213>The sense primer of EV71-VP1 genes

<400> 3

cctaagcttt atgcccgaga tggagtgttt gac 33

<210> 4

<211> 35

<212> DNA

<213>The anti-sense primer of EV71-VP1 genes

<400> 4

cagctcgagt catttcccaa gagtggtgat tgctg 35

Claims (4)

1. a kind of factor-containing adjuvant restructuring enterovirus phenotype hybrid system construction method, it is characterised in that first The recombinant attenuated enterovirus strain of VP1 recombinant cell lines and load cells factor gene is built respectively；Then by load cells because Subbase because recombinant attenuated enterovirus strain infection amplification carried out in VP1 recombinant cell lines obtain final product the weight of factor-containing adjuvant Group enterovirus phenotype hybrid system；The VP1 recombinant cell lines are for individually or simultaneously expression enterovirns type 71, COxsackie are sick One or two the cell line of the VP1 of the malicious type of A groups 16；The recombinant attenuated enterovirus of the load cells factor gene is selected good strains in the field for seed From Coxsackievirus B3, enterovirns type 71 or poliovirus I types；The cell factor is selected from cholera toxin Or interferon gamma.

2. according to claim 1 factor-containing adjuvant restructuring enterovirus phenotype hybrid system preparation method, its Feature is having, and comprises the following steps：

S1. the VP1 genes of amplification enterovirns type 71 and/or coxsackievirus A16, are connected in carrier for expression of eukaryon, VP1 recombinant cell lines are obtained after transfection, screening；

S2. Coxsackievirus B3, enterovirns type 71 or poliovirus I types are carried out into genome cloning, Under reverse genetics system, insertion cell factor obtains load cells factor gene between P1 the and P2 areas of viral full-length genome Recombinant attenuated enterovirus strain；

The VP1 recombinant cell lines that the recombinant attenuated enterovirus strain infection S1 of the load cells factor gene that S3. S2 is obtained is obtained Obtain final product.

3. the methods described of claim 1 or 2 obtain factor-containing adjuvant restructuring enterovirus phenotype hybrid system.

4. the restructuring enterovirus phenotype hybrid system of factor-containing adjuvant described in claim 3 is preparing treatment enterovirus Vaccine approach application.