CN106636001A - Construction method of recombinant enterovirus phenotype hybrid system and application - Google Patents

Abstract

The invention provides a construction method of a recombinant enterovirus phenotype hybrid system. A VP1 recombinant cell system is constructed, and a toxicity attenuation enterovirus strain is subjected to infection amplification in the VP1 recombinant cell system so as to obtain the recombinant enterovirus phenotype hybrid system; the VP1 recombinant cell system is a cell system separately or simultaneously expressing one or two of VP1 of enterovirus 71-type and coxsackie virus A-group 16-type; the toxicity attenuation enterovirus strain is selected from coxsackie virus B-group 3-type, enterovirus 71-type or poliovirus I-type; the toxicity attenuation enterovirus strain infects the VP1 recombinant cell system, and after a cytopathic effect, a progeny virus is obtained, and a hybrid phenotype recombinant toxicity attenuation strain comprising various different sources of enterovirus VP1 capsids and comprising a genome core of the toxicity attenuation enterovirus strain is obtained; the progeny virus formed by the system can activate host immunity so as to generate immune protection for various enteroviruses, and the phenotype hybrid system has actual and wide application value.

Description

A kind of construction method of restructuring enterovirus phenotype hybrid system and application

Technical field

The present invention relates to biological technical field, more particularly, to a kind of structure of restructuring enterovirus phenotype hybrid system Construction method and application.

Background technology

Hand-foot-and-mouth disease（Hand-foot-mouth disease, HFMD）It is a kind of infection caused by enterovirus infection Property disease, be mainly in 5 years old Infants Below, clinical manifestation is heating, apocleisis, cries and screams, in portions such as hand, foot, mucous membrane of mouth, crissum There is bleb or ulcer in position.Generally there is hand-foot-and-mouth disease self limiting, the self-healing in one week or so of most infants, but minority infant to occur The central nervous systems such as aseptic meningitis, encephalitis, myocarditis, pulmonary edema, cardiovascular system and respiratory system complication, rapidly Severe hand-foot-and-mouth disease is progressed to, can be caused death when serious.Hand-foot-and-mouth disease is occurred frequently in China, is that China's publilc health brings huge Threaten, the Ministry of Public Health in 2008 is included Class C infectious disease and is managed.

Causing the enterovirus of HFMD has CA group 2-10,12,16,24 types, the 1-5 types of B groups and enteron aisle disease Malicious 71 types（EV71）Deng wherein topmost cause of disease is EV71 and coxsackievirus A16（CA16）.Generally CA16 causes Symptom it is relatively light but cases of infection quantity is big, EV71 is more easy to cause the severe hand-foot-and-mouth disease such as neurological complication, and The separation rate of the CA6 in the groove since 2012 also increasingly increases.At present treatment hand-foot-and-mouth disease lacks effectively treatment medicine, mainly With to the ill and based on supportive treatment.

CA16, EV71 and CA6 belong to Picornaviridae enterovirus genus, are nonencapsulated positive single stranded RNA disease Poison, its capsid is icosahedral symmetry structure, and viral capsid is made up of VP1, VP2, VP3 and VP4, and wherein VP1 is that its is main Capsid protein, while being also VAP, plays a decisive role in viruses adsorption and during penetrating, therefore VP1 is again disease The neutralization antigen of poison.The epidemic situation was severe for hand-foot-and-mouth disease, and only has inactivated vaccine at present for EV71 viruses in terms of preventive means List, CA16 there is no vaccine application.

The type of coxsackie B group 3 virus, poliovirus I type, II types and type III virus also belong to Picornaviridae intestines Road Tobamovirus, the virus of enterovirus genus has similarity on biological characteristics.Wherein, the virus of enterovirus genus is being replicated All it is that, with genome as template, read-through transcription is translated as precursor protein into a mRNA, subsequently in virus protein in cycle The effect Self cleavage of enzyme forms various virus proteins.Virus VP 1, VP2, VP3 and VP4 in packing stage, infection cell Progeny virus capsid can be formed, filial generation genome is wrapped up and ultimately forms complete progeny virus is discharged.Packing Cheng Zhong, the virus VP 1 functional similarity of enterovirus genus, therefore, a such as cell is by two or more enterovirus genus virus senses Dye, it may occur that the phenomenon of phenotype mixing, i.e., a kind of genome of virus can be wrapped up by the capsid of another kind of virus, this virus Capsid and genomic source in different enteroviruses.

The phenotype mixing phenomena of enterovirus genus virus, the potential value with vaccine research, but natural phenotype mixing Have problems in actual mechanical process.Simultaneously cell can cause interference phenomenon to two or more enterovirus, make virus Propagation efficiency reduce, and the duplication propagation efficiency after different virus mixed infection differs, it is impossible to carry out effective Quality Control, and right Higher duplication efficiency is needed in the strain of vaccine using value, this is also that current vaccine research field uses monotype virus each to increase Grow, then on demand mixed the various vaccine being manufactured separately, and do not use various viral infection cells simultaneously to breed disease Poison, does not go using phenotype mixed mechanism.

For the virus of " natural " phenotype mixing, in addition to the bottleneck that interference phenomenon and propagation efficiency differ, if by force Strain source then needs to carry out inactivation treatment, is prepared as inactivated vaccine, and on the one hand its inactivated vaccine is noninductive using inactivating The viral capsid of metachromia, Jing after intramuscular injection by after internal professional antigen presenting cells working process, activation body produces immunity should Answer, be that the exogenous antigen that MHC-II quasi-molecules are relied on is offered, and virus infection is more with MHC-I classes point under natural conditions The endogenous antigen mode of offering that son is relied on activates immunity of organism, therefore protection not as the attenuated live epidemic disease based on attenuation strain Seedling.On the other hand, such as use attenuation enterovirus strain to carry out phenotype mixing, equally there is interference phenomenon and propagation effect The bottleneck that rate differs, while phenotype mixing application is more limited, various attenuation enterovirus strain mixed infection cells, by Can be complementary with generating function between strain, and unexpected genetic recombination can occur, can greatly increase attenuation strain and reply poison The risk of power.

Therefore, such as enterovirus phenotype mixing phenomena is applied into enterovirus vaccine research and development, needs to set up one The method for planting safe and efficient phenotype hybrid system, can avoid various viruses from infecting caused interference phenomenon simultaneously, breed Efficiency differs, unexpected genetic recombination, attenuation strain reply virulence, while and better than inactivated vaccine immune protective effect.

The content of the invention

The technical problem to be solved is the drawbacks described above for overcoming prior art to exist, there is provided one kind restructuring enteron aisle The construction method of virus phenotype hybrid system.

Second object of the present invention is to provide the restructuring enterovirus phenotype hybrid system of methods described acquisition.

Third object of the present invention is to provide the application of the hybrid system.

The purpose of the present invention is achieved by the following technical programs：

A kind of construction method of restructuring enterovirus phenotype hybrid system, is to build VP1 recombinant cell lines, will be attenuated enterovirus Strain carries out infection amplification in VP1 recombinant cell lines and obtains final product restructuring enterovirus phenotype hybrid system；The VP1 recombinant cell lines Individually or simultaneously to express one or two the clone of enterovirns type 71, the VP1 of coxsackievirus A16；It is described Attenuation enterovirus strain is selected from Coxsackievirus B3, enterovirns type 71 or poliovirus I type.

Using the stable transfected cells of the recombinant expressed various enterovirus VP1 albumen of external source, amplification attenuation enterovirus, obtain The attenuation enterovirus of various different enteron aisle VP1 viral capsids must be contained.The system includes VP1 recombinant cell lines and attenuation enteron aisle Two parts of virus stain.Within the system, after being attenuated the recombinant expressed clones of enterovirus virus strain infection enterovirus VP1, For example, in the packing stage of virus multiplication, progeny virus can be mixed into the VP1 of other enteroviruses in progeny virus capsid.Jing The progeny virus of propagation is crossed, its virus core is Coxsackievirus B3 attenuation strain genome, and its surface viral capsid In VP1 load in mixture, containing from including the VP1 of enterovirns type 71, coxsackievirus A16.The son for being obtained For virus can infection host, but due to virus core be attenuated enterovirus strain genome, its duplication in host and It is pathogenic to be restricted；And progeny virus contains the VP1 albumen of various enteroviruses, and VP1 is that enterovirus has type special Property neutralization antigen, therefore, the progeny virus that this kind of system is formed can activate host immune, produce for various enteroviruses and exempt from Epidemic disease is protected.

Preferably, the preparation method of the restructuring enterovirus phenotype hybrid system, comprises the following steps：

S1. the VP1 genes of enterovirns type 71 and/or coxsackievirus A16 are expanded, in being connected to carrier for expression of eukaryon, VP1 recombinant cell lines are obtained Jing after transfection, screening；

S2. the VP1 recombinant cell lines that recombinant attenuated enterovirus strain infection S1 is obtained are obtained final product.

The preparation side of the recombinant attenuated enterovirus strain of VP1 recombinant cell lines of the present invention and load cells factor gene Method is the routine techniques of biology field.

Preferably, the preparation method of VP1 recombinant cell lines is to extract the RNA of corresponding virus, using polyA or random primer Reverse transcription is carried out, cDNA is obtained.Using the specific primer of corresponding virus, the VP1 bases of corresponding virus are obtained by PCR amplifications Cause, is inserted VP1 genetic fragments in carrier for expression of eukaryon using digestion connection.Carrier for expression of eukaryon can be anti-using Neo or Puyo Property gene, the carrier for expression of eukaryon for building using liposome transfection to eukaryotic Vero cells（Or 293, Hep2, HeLa etc. Cell）In, then screened using G418 or puromycin, Jing after western blotting qualification and identified by immunofluorescence, it is somebody's turn to do A portion of phenotype hybrid system, i.e. VP1 recombinant cell lines.

The present invention also provides the restructuring enterovirus phenotype hybrid system that methods described is obtained.

Thus, attenuation enterovirus strain infection VP1 recombinant cell lines, harvest progeny virus after cytopathy, contained Various separate sources enterovirus VP1 capsids, the mixing phenotype containing attenuation enterovirus strain genome core are recombinant attenuated Strain；The progeny virus that this kind of system is formed can activate host immune, and for various enteroviruses immunoprotection is produced.

The present invention also provides the restructuring enterovirus phenotype hybrid system in the vaccine approach for preparing treatment enterovirus Application.

Compared with prior art, the invention has the advantages that：

The invention provides a kind of construction method of restructuring enterovirus phenotype hybrid system, is to build VP1 recombinant cell lines, will Attenuation enterovirus strain carries out infection amplification in VP1 recombinant cell lines and obtains final product restructuring enterovirus phenotype hybrid system；It is described VP1 recombinant cell lines be individually or simultaneously express enterovirns type 71, the VP1 of coxsackievirus A16 one or two Clone；The attenuation enterovirus strain is selected from Coxsackievirus B3, enterovirns type 71 or polio disease Malicious I types；Attenuation enterovirus strain infection VP1 recombinant cell lines, harvest progeny virus after cytopathy, obtain and contain various differences Source enterovirus VP1 capsids, the recombinant attenuated strain of mixing phenotype containing attenuation enterovirus strain genome core；It is this kind of The progeny virus that system is formed can activate host immune, and for various enteroviruses immunoprotection, the phenotype hybrid system are produced With reality and being widely applied value.

Description of the drawings

Fig. 1 is that CA16 and EV71 strain VP1 fragments PCR expand electrophoretogram；M：NEB 1kb DNA ladder；1：CA16 is malicious Strain VP1 fragment PCR products；2：EV71 strain VP1 fragment PCR products.

Fig. 2 is the digestion recovery of CA16 and EV71 strain VP1 fragments and carrier for expression of eukaryon pcFlag；M：NEB 1kb DNA ladder；1：CA16 strain VP1 fragment digestion products；2：EV71 strain VP1 fragment digestion products；3：PcFlag digestions are produced Thing.

Fig. 3 is the VP1 eukaryon expression plasmids of VP1 the eukaryon expression plasmid pcFlag-CA16-VP1 and EV71 of CA16 The bacterium colony PCR identifications of pcFlag-EV71-VP1；M：NEB 1kb DNA ladder；1-8：PcFlag-CA16-VP1 bacterium colony PCR Product；9-16：PcFlag-EV71-VP1 bacterium colony PCR primers.

Fig. 4 is pcFlag-CA16-VP1's and pcFlag-EV71-VP1HindIII andXhoI double digestions are identified；M： NEB 1kb DNA ladder；1-2：PcFlag-CA16-VP1 plasmidsHindIII andXhoI double digestions are identified；9-16： PcFlag-EV71-VP1 plasmidsHindIII andXho I double digestions are identified.

Fig. 5 is the Immunofluorescence test that CA16 and EV71 restructuring VP1 albumen is expressed in cell.

Specific embodiment

Present disclosure is further illustrated with reference to specific embodiment, but be should not be construed as limiting the invention. Without departing from the spirit and substance of the case in the present invention, simple modification the inventive method, step or condition made or replacement, Belong to the scope of the present invention；If not specializing, technological means used is well known to those skilled in the art in embodiment Conventional meanses.

First, the structure of the cell of the VP1 of CA16 and EV71 is stably expressed

The coxsackievirus A16 of clinical and Laboratory Diagnosed（Hereinafter referred to as CA16）And enterovirns type 71（Hereinafter referred to as EV71）The sample of cases of infection, using viral RNA extracts kit the viral RNA of cases of infection is extracted respectively, is utilized SuperScript III reverse transcriptases and random primer, reverse transcription obtains the viral cDNA of CA16 and EV71.

With CA16 and EV71 virus cDNA as template, the upstream primer of CA16-VP1 genes：5’- CCTAAGCTTTCTGGGTACTTTGACTATTACACC, downstream primer 5 '- CAGCTCGAGTCATGTTGTTATCTTGTCTCTACTAC.The upstream primer of EV71-VP1 genes：5’- CCTAAGCTTTATGCCCGAGATGGAGTGTTTGAC, downstream primer 5 '- CAGCTCGAGTCATTTCCCAAGAGTGGTGATTGCTG。

Amplification reaction condition：Enter after 94 DEG C of denaturations 3min and circulate, 94 DEG C of denaturation 30s, 52 DEG C of renaturation 30s, 72 DEG C are prolonged 2min is stretched, 72 DEG C of extension 5min after 30 circulations.The agarose gel electrophoresis of Jing 1.2%, reclaims corresponding product segment.PCR is produced Owner is about 1100bp or so with size, as a result fulfills the expectation（Fig. 1）.

CA16 and EV71 strain VP1 PCR primers, using agarose gel electrophoresis, reclaim the amplification master tape of estimated size, UtilizeHindIII andXhoI is to VP1 fragments and pCMV-C-Flag plasmids（Abbreviation pcFlag plasmids）Carry out double digestion, digestion Product reuse agarose gel electrophoresis reclaim respective segments, CA16 and EV71 strains VP1 respectively with pCMV-C-Flag matter Grain is attached（Fig. 2）.CA16 and EV71 strains VP1 is attached respectively with pCMV-C-Flag plasmids, and transformed competence colibacillus are thin After born of the same parents, the single bacterium colony of Jing resistance screenings respectively selects 8 carries out bacterium colony PCR identifications, as shown in figure 3, the VP1 eukaryotic expression matter of CA16 16 bacterium colonies of the VP1 eukaryon expression plasmid pcFlag-EV71-VP1 of grain pcFlag-CA16-VP1 and EV71 can amplify phase The VP1 fragments answered.

Positive 2 clones of each picking of bacterium colony of Jing bacterium colonies PCR identifications carry out Bacteria Culture and plasmid extraction, carry out digestion mirror It is fixed, as shown in figure 4, JingHindIII andXhoAfter I double digestions, there are the VP1 exogenous sequences and about 5kb of 1100bp or so PcFlag carrier segments.The plasmid of digestion identification carries out sequencing analysis, and as a result completely correct, plasmid is respectively designated as pcFlag- CA16-VP1 and pcFlag-EV71-VP1.

293T cells, RD cells, Vero cells use DMEM（Containing 10% FBS）In 37 DEG C, 5% CO₂, under the conditions of water saturation Culture.Before transfection, the cell for growing to more than 95% fusion rate is inoculated in into 6 porocyte culture plates, treats 20 ~ 24h of cell growth extremely Transfected when cell density is up to 70 ~ 90%.Transfection procedure enters according to the operation manual of the transfection reagents of Lipofectamine 2000 OK.

PcFlag-CA16-VP1 and pcFlag-EV71-VP1 plasmid transfections 293T and RD of Jing digestions and sequence verification is thin Born of the same parents, using FLAG antibody immune-blotting method is carried out, and in the position of about 32Kd estimated size strip is occurred in that, shows eukaryotic expression Plasmid can give expression to the VP1 recombinant proteins of FLAG fusions in 293T and RD cells.

PcFlag-CA16-VP1 and pcFlag-EV71-VP1 plasmid transfection 293T cells, using Immunofluorescence test weight The expression of group VP1, as shown in figure 5, CA16 and EV71 restructuring VP1 albumen is distributed mainly in cell cytosol.

By pcFlag-CA16-VP1 and pcFlag-EV71-VP1 plasmids, with 1：1 ratio cotransfection Vero cells, turn 72h is screened using G418 after dye, through the screening of 3 weeks or so, obtains resistant cell colonies, and stable expression is obtained after testing The Vero cell line of the VP1 of CA16 and EV71.

The preparation of recombinant attenuated enterovirus strain the 2nd,

Attenuation enterovirus strain can be using the enterovirns type 71 or attenuation of the Coxsackievirus B3 of attenuation or attenuation Poliovirus I type（Sabin vaccine strains）.By attenuated virus the VP1 of stable expression CA16 and EV71 Vero cells System is infected, harvesting supernatant after 48h, and using supercentrifugation the restructuring enterovirus of phenotype mixing is obtained.

SEQUENCE LISTING

<110>Medical College of Shantou University

<120>A kind of construction method of restructuring enterovirus phenotype hybrid system and application

<130>

<160> 4

<170> PatentIn version 3.3

<210> 1

<211> 33

<212> DNA

<213>The upstream primer of CA16-VP1 genes

<400> 1

cctaagcttt ctgggtactt tgactattac acc 33

<210> 2

<211> 35

<212> DNA

<213>The downstream primer of CA16-VP1 genes

<400> 2

cagctcgagt catgttgtta tcttgtctct actac 35

<210> 3

<211> 33

<212> DNA

<213>The upstream primer of EV71-VP1 genes

<400> 3

cctaagcttt atgcccgaga tggagtgttt gac 33

<210> 4

<211> 35

<212> DNA

<213>The downstream primer of EV71-VP1 genes

<400> 4

cagctcgagt catttcccaa gagtggtgat tgctg 35

Claims (4)

1. it is a kind of restructuring enterovirus phenotype hybrid system construction method, it is characterised in that build VP1 recombinant cell lines, will Attenuation enterovirus strain carries out infection amplification in VP1 recombinant cell lines and obtains final product restructuring enterovirus phenotype hybrid system；It is described VP1 recombinant cell lines be individually or simultaneously express enterovirns type 71, the VP1 of coxsackievirus A16 one or two Clone；The attenuation enterovirus strain is selected from Coxsackievirus B3, enterovirns type 71 or polio disease Malicious I types.

2. the preparation method of enterovirus phenotype hybrid system of recombinating according to claim 1, its feature is having including following Step：

S1. the VP1 genes of enterovirns type 71 and/or coxsackievirus A16 are expanded, in being connected to carrier for expression of eukaryon, VP1 recombinant cell lines are obtained Jing after transfection, screening；

S2. the VP1 recombinant cell lines that recombinant attenuated enterovirus strain infection S1 is obtained are obtained final product.

3. the restructuring enterovirus phenotype hybrid system that the methods described of claim 1 or 2 is obtained.

4. enterovirus phenotype hybrid system of recombinating described in claim 3 should the vaccine approach for preparing treatment enterovirus With.