CN104130977A - Antitumor medicine screening cell model and application thereof - Google Patents
Antitumor medicine screening cell model and application thereof Download PDFInfo
- Publication number
- CN104130977A CN104130977A CN201410381401.6A CN201410381401A CN104130977A CN 104130977 A CN104130977 A CN 104130977A CN 201410381401 A CN201410381401 A CN 201410381401A CN 104130977 A CN104130977 A CN 104130977A
- Authority
- CN
- China
- Prior art keywords
- gene
- sequence
- cell
- cell model
- screening
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to an antitumor medicine screening cell model and an application thereof, and belongs to the technical field of bioengineering. The antitumor medicine screening cell model is a DNA construct which is separated from spongioblastoma and site-specifically integrated with tumor stem cells of reporter genes and contains an A-B-C-D structure, wherein A and D represent a molecular marker gene promoter of stem cells of the spongioblastoma and a downstream sequence; B represents a reporter gene sequence; C represents a puro sequence of a puromycin resistance gene; the molecular marker gene of the stem cells of the spongioblastoma comprises Nestin genes; the reporter genes include green fluorescent protein genes GFP or red fluorescent protein genes RFP and luciferase reporter genes. The cell model of an antitumor medicine is used for screening cytotoxicity and inducing differentiated materials. The cell model has the beneficial effects that 1, the adverse effects caused by the traditional cell transgenosis method are avoided, and the action effect of the medicine is correctly reflected according to a detection result; 2, a compound for resisting the tumor stem cells is obtained.
Description
Technical field:
The present invention relates to a kind of screening anti-tumor medicine cell model and application thereof, belong to technical field of bioengineering.
Background technology:
Cancer stem cell has and the similar molecule marker of tissue stem cell, self and differentiation function, after transplanting, can reappear the feature such as histology, molecular biology of former cancer, resistance to conventional radiotheraphy and chemotherapy, be the major cause that cancer occurs, recurs and shift, therefore cancer stem cell is just becoming the key areas of cancer research and the main target of cancer therapy.But current antitumor drug mainly obtains with the screening of cancer cell system, lacks the medicine for tumor stem cell, also lacks the good medicaments sifting model based on tumor stem cell.
Glioblastoma multiforme is modal cerebral tumor, and grade malignancy is high.Along with the progress of cancer research, the curative ratio of most of cancer and lifetime have all obtained obvious improvement, but not significantly do not take on a new look in the past few decades glioblastoma multiforme patient's lifetime, and on average only approximately 1 year, in the urgent need to researching and developing new medicine.Glioblastoma multiforme stem cell is one of solid tumor stem cell of determining the earliest, is also few in number one of tumor stem cells of long-term cultivation of stablizing in vitro, lays a good foundation for utilizing glioblastoma multiforme stem cell to carry out drug screening.
Medicaments sifting model is to find and find one of essential condition of novel drugs.At present the screening method of antitumor drug is mainly comprising in body and in-vitro screening method, and in body, screening method cost is high, and operation easier is large, is unfavorable for high-throughout drug screening; In-vitro screening method is mainly realized on molecule and cell levels, has material usage few, and mechanism of action is clear and definite, is easy for the advantages such as Large-scale Screening, is the main method of drug screening.
The conventional reporter gene radom insertion of drug screening cell model is set up stable cell line, the promoter activity of controlling the expression of external source marker gene is often subject to the impact of integration site annex genomic dna, therefore the variation of marker gene can not reflect the variation of native gene completely, affects the evaluation of drug effect.
In sum, be necessary to set up the good screening anti-tumor medicine model based on glioblastoma multiforme stem cell.
Summary of the invention:
The present invention is directed to the deficiency that existing screening anti-tumor medicine technology exists, a kind of easy, quick, direct, economic screening anti-tumor medicine cell model and establishment method and application are provided.
The cell model of antitumor drug of the present invention separates from glioblastoma multiforme, site-directed integration the tumor stem cell of reporter gene, the DNA construction that contains A-B-C-D structure, wherein:
A, D is glioblastoma multiforme stem cell molecular marker gene promotor and downstream sequence, and B is reporter gene sequence, and C is puromycin resistance gene puro sequence;
The dry extracellular molecule marker gene of glioblastoma multiforme is but is not limited to Nestin gene; Reporter gene for but be not limited to green fluorescence protein gene EGFP, or YFP, RFP fluorescin, or luciferase luciferase.
The construction process of screening anti-tumor medicine cell model of the present invention, use homologous recombination technique, reporter gene green fluorescent protein EGFP site-directed integration, to molecular marker for cancer stem cell gene Nestin promotor downstream, is set up to cytotoxicity and the induction Screening Platform of medicine.
The cell model of antitumor drug of the present invention is for screening the cytotoxicity of resisting tumour stem cells and the material (as micromolecular compound, polypeptide) of induction differentiation.That is:
Candidate substances is added in above-mentioned culturing cell, with the expression of reporter gene in high intension equipment or fluorescent microscope detection of drugs group, and with control group comparison, described control group is the above-mentioned cell that does not add candidate substances.If reporter gene expression cell count is lower than control group in test group, just show that candidate substances can suppress tumor stem cell propagation or cell death inducing; If reporter gene expression level reduces in individual cells, illustrate that candidate substances can induced tumor differentiation of stem cells.
The cell model of antitumor drug of the present invention can also carry out further cell/experimentation on animals to the resisting tumour stem cells material filtering out, to determine the prospect of these materials in antitumor drug research and development.
Beneficial effect of the present invention is:
1, avoided genomic instability, transgenosis insertion due to multiple copied transgenosis can destroy native gene, transgenosis promotor used and affected by insertion point both sides sequence can not to reflect the disadvantageous effect that promoter activity changes completely, detected result can correctly reflect drug effect effect.
2, have advantages of easy, quick, direct, economical.
Brief description of the drawings:
Fig. 1 is the target practice schematic diagram to nestin promotor downstream by EGFP site-directed integration.
Fluirescence observation result after Fig. 2-a and Fig. 2-b demonstration adenovirus infection tumor stem cell.
After Fig. 3-a and Fig. 3-b shows adenovirus infection tumor stem cell, PCR detects positive colony cell.
Embodiment:
Below in conjunction with drawings and Examples, further set forth the present invention.Unreceipted concrete experimental technique in the following example, the method described in molecular cloning experiment guide (sambrook, J.) according to normal condition conventionally, or according to experiment agents useful for same or instrument specification sheets suggesting method.
One, construction and carrier
Described construction contains nestin promoter sequence from 5 ' end successively to 3 ' end, reporter gene sequence, internal ribosome entry site sequence (IRES) or certainly shear 2A peptide sequence, puromycin resistance gene sequence (puro), transcription termination signal sequence (polyA) and nestin promotor downstream sequence.
Described reporter gene comprises: green fluorescent protein (GFP) gene, red fluorescent protein (RFP) gene or luciferase gene (luciferase).GFP is as a kind of labelled protein, and its endogenous fluorophor is being subject to when blue-light excited efficiently launching apparent green glow.Described GFP is also included on wild-type GFP basis and carries out improved albumen, for example, carry out gene optimization (as removed disguised intron); Or improve correct fold of GFP apoprotein under hot conditions by amino acid substitution, and change GFP spectral response curve.In the present invention, described GFP is the green fluorescent protein of enhancement type (EGFP), and EGFP is the albumen after green fluorescent protein is improved, and has very high homology with GFP, and effect luminous after expression is even more ideal.
Red fluorescent protein (RFP) is the one of cloning from coral polyp and the fluorescin of green fluorescent protein (GFP) homology, under the irradiation of UV-light, can send red fluorescence.Compared with GFP, RFP have excite with emission wavelength longer, the lower advantage of imaging background in cell, but also have oligomerization, maturation to limit slowly simultaneously.Described RFP is also included on wild-type RFP basis and carries out improved albumen, for example dsRed, mKate2.
Described " luciferase reporter gene " system is to detect the active a kind of reporting system of Photinus pyralis LUC (fireflyluciferase) taking fluorescein (luciferin) as substrate.It has the following advantages: 1. endogenous is low, and Mammals is without endogenic luciferase expression; 2. highly sensitive, the chemiluminescence reaction efficiency of luciferase mediation is high, luminous strong, is easy to detect; 3. sensing range is wide, and amplitude is crossed over and is greater than 107; 4. economical and practical, and reproducible.
Described internal ribosome entry site (IRES) is one section of nucleotide sequence, in the time that this section of nucleotide sequence is translated into RNA, can be folded into the structure that is similar to initial tRNA, be combined with RNA thereby mediate rrna, the translation of initial downstream protein sequence.In this construction, IRES is between green fluorescent protein sequence and puromycin resistance gene sequence, and green fluorescent protein is by the initial translation of 5 ' cap sequence, and tetracycline relies on the initial translation of IRES.Therefore the expression of tetracycline and EGFP is subject to same promoters driven.
The described 2A of shearing certainly peptide comes from foot and mouth disease virus, is in recent years to use more a kind of instrument that builds multigene carrier.Research points out, by series system, 2A peptide and gene is placed in to same opening code-reading frame and can realizes and under the regulation and control of same promotor, express multiple genes.
Described " promotor " refers to a kind of nucleotide sequence, it is present in the upstream of goal gene encoding sequence conventionally, can guiding nucleus acid sequence being transcribed into mRNA. nestin promoter sequence of the present invention is tumor stem cell/neural stem cell internal specific promotor, therefore drives the EGFP and the puro thereof that express only in tumor stem cell/neural stem cell, to express by it.
Described " transcription termination signal sequence " refers in structure gene DNA molecular for stopping the element of Transcription, claims again terminator; Terminator has one section of GC enrichment region, has again subsequently one section of AT enrichment region.In GC enrichment region, have one section of inverted repeats, so that the mRNA that Transcription generates there is the complementary hairpin structure forming in its corresponding sequence.
As optimal way of the present invention, described reporter gene is EGFP, the in the situation that of lysing cell not, can be by microscope direct observing the expression to EGFP in cell, thereby judge variation and the cytodifferentiation situation of cell survival, growth.
As particularly preferred mode of the present invention, in described construction, in the downstream of reporter gene, also comprise puromycin resistance gene Puro sequence.When foreign gene enters after cell, there is the probability of homologous recombination very little, therefore usually use microbiotic selective marker to screen to have integrated goal gene with the cell of resistance.Puro uses one of microbiotic very widely in drug screening, it is little for the impact of upstream and downstream element, can be well for the screening and identification of cell strain.
In described construction, between each element, operatively connect, various functional operability mode of connection are that biological field is common, for masses known.Conventionally, between each element, there is the intervening sequence of 0-1000bp.
The present invention also provides a kind of carrier, and described carrier contains foregoing construction.One of described carrier is adenovirus carrier.As optimal way of the present invention, described adenovirus carrier is pAd-BLOCK serial carrier, more preferably pAd-BLOCK-iT-DEST carrier.After the pAd-BLOCK-iT-DEST carrier package that contains described construction is adenovirus, very high to tumor stem cell infection rate, reach 100%.
In described carrier, also include other elements that some are expressed for EGFP and growth does not have negative left and right to tumor stem cell.
Two, cell model and purposes
Described cell is that cultured cell in vitro is cells of mamma animals, and it for separating tumor stem cell from people's glioma; And in described cellular genome site-directed integration foregoing construction.The expression of described intracellular reporter gene is subject to nestin promoters driven, and when antitumor drug is processed after described cell, the expression of reporter gene directly reflects variation and the cytodifferentiation situation of cell survival, growth.
As optimal way of the present invention, described cell behaviour glioma tumor stem cell.Nestin albumen can be expressed at people's glioma stem cells internal specific, also expressed at people's glioma stem cells internal specific by the reporter gene of nestin promoters driven.
Described cell is with antibiotics resistance, and described antibiotics resistance is tetracycline puro resistance, can be well for the screening and identification of homologous recombination positive cell.
Cell of the present invention is as cell model, for screening the virose medicine of tumor stem cell, also for screening the medicine that can cause tumor stem cell differentiation.Described medicine comprises natural drug, synthetic medicine and other pure substances for oncotherapy and mixture.
Structure report gene cell model of the present invention obtains via lower step;
(1) reporter gene sequence is connected on pENTR-u6 carrier, obtains the LR restructuring entry vector that comprises reporter gene sequence;
(2) IRES sequence or 2A peptide sequence are connected on the carrier of (1) acquisition, after IRES or 2A peptide sequence are positioned at reporter gene terminator codon;
(3) puromycin resistance gene puro is connected on the carrier of (2) acquisition, puro gene order is positioned at IRES or 2A peptide sequence sequence downstream, together be subject to nestin promoters driven with reporter gene, for the screening of homologous recombination positive cell;
(4) nestin promoter sequence is connected on the carrier of (3) acquisition, nestin promoter sequence is positioned at reporter gene upstream, 5 ' the required homology arm during as homologous recombination;
(5) nestin promotor downstream sequence is connected on the carrier that (4) obtain, nestin promotor downstream sequence is positioned at puro gene downstream, required 3 ' homology arms during as homologous recombination;
(6) the gateway entry vector (5) being obtained reacts with the LR that adenoviral gene group carrier pAd-BLOCK-iT-DEST carries out gateway clone, obtains the pAd-BLOCK-iT-DEST adenovirus carrier that comprises described construction;
(7) design, for the activating transcription factor sample effector nuclease (TALEN) of nestin First Exon, after verifying its efficiency, is cloned in gateway entry vector pENTR-u6;
(8) the gateway entry vector (7) being obtained reacts with the LR that adenoviral gene group carrier pAd-BLOCK-iT-DEST carries out gateway clone, obtains the pAd-BLOCK-iT-DEST adenovirus carrier that comprises talen;
(9) difference transfection 293A cell after the adenovirus carrier linearizing (6) and (8) being obtained, encapsidated adenovirus virus;
(10) adenovirus (9) being obtained infects people's glioma tumor stem cell jointly, cultivates metainfective cell, and puro screened after 3 weeks, and the mono-clonal of picking band reporter gene, cultivates into clone under the microscope.
Screening method (purposes):
Cell behaviour tumor stem cell of the present invention, screening is for the medicine of tumor stem cell, and drug effect is cellular cytoxicity activity or Cell differentiation inducing activity.
The invention provides a kind of drug toxicity screening model based on tumor stem cell.Concrete grammar is: medicine to be screened is joined in described cell model, the cell model that does not add medicine is set for contrasting simultaneously.By the equipment Inspection reporter gene expression situation of high intension equipment or fluorescent microscope.Detect the expression of reporter gene in test group, and with control group comparison; If this medicine has cytotoxicity, can cause that necrocytosis, cell proliferation reduce, reporter gene positive cell number will reduce.
Meanwhile, the present invention also provides a kind of differentiation of the medicine based on tumor stem cell screening model.Specific implementation method is: medicine to be screened is joined in described cell model, the cell model that does not add medicine is set for contrasting simultaneously.By the equipment Inspection reporter gene expression situation of high intension equipment or fluorescent microscope.If testing drug induced tumor differentiation of stem cells, the reporter gene expression intensity of individual cells can weaken.
Embodiment 1: containing the structure of reporter gene adenovirus carrier
1. taking pRL-CMV plasmid as masterplate, obtain polyA element fragment with pcr amplification, and add restriction enzyme NheI at primer two ends, SalI site.Cut gateway entry vector pENTR-U6 with restriction enzyme XbaI and SalI enzyme, purifying is connected with the polyA fragment of pcr amplification after reclaiming.Connect product and transform escherichia coli DH5a, picking colony after 12h, extracting plasmid, and carry out enzyme and cut qualification.Plasmid through qualification successful connection is designated as pENTR-polyA.
PolyA primer sequence:
seq1：
ACGTGTCGACAGTTCTAGATCAAGATCTATAGCGGCCGCTTCGAGCAGA
Seq2：
TGTCATGCTAGCACTACTAGTATCGGATCCTTATCGATTTTAC
2. with taking tumor stem cell genome as masterplate, with PCR method amplification nestin promotor downstream sequence, obtain the required downstream homology arm 3 ' arm of homologous recombination, and add restriction enzyme digestion sites BamHI and speI in primer both sides.With restriction enzyme BamHI and speI double digestion pENTR-polyA carrier, purifying is connected with nestin-3 ' the arm fragment of pcr amplification after reclaiming.Connect product and transform escherichia coli DH5a, picking colony after 12h, extracting plasmid, and carry out enzyme and cut qualification.Plasmid through qualification successful connection is designated as pENTR-polyA-3 ' arm.
Nestin-3 ' arm fragment primer sequence:
seq3：ATCTggatccGACGAGCAGGATGGAGGGCT
Seq4：ATCTactagtGCAGAGTTGCCATCACCTACACC
3. taking Qrich2-shCTR carrier as masterplate, increase and obtain EGFP-2A-puro fragment by PCR method, and add restriction enzyme digestion sites XbaI and NotI in primer both sides.Taking tumor stem cell genome as masterplate, with PCR method amplification nestin promoter sequence, obtain the required upstream homology arm 5 ' arm of homologous recombination, and add restriction enzyme digestion sites SalI and NheI in primer both sides.With restriction enzyme SalI and NotI double digestion ENTR-polyA-3 ' arm carrier, purifying is connected with nestin-5 ' arm and EGFP-2A-puro tri-fragments of pcr amplification after reclaiming.Connect product and transform escherichia coli DH5a, picking colony after 12h, extracting plasmid, and carry out enzyme and cut qualification.Plasmid through qualification successful connection is designated as pENTR-nes-EGFP-puro. (Fig. 1 is shown in by plasmid schematic diagram)
4. the entry vector pENTR-nes-EGFP-puro of structure is reacted with the LR that adenovirus carrier pAd-BLOCK-iT-DEST carries out gateway, obtain the adenovirus carrier pAd/BLOCK-IT-DEST-nes-EGFP-puro containing described construction
Nestin-5 ' arm fragment primer sequence:
seq5:tgacgtcgacACCTGAAGTCAGGAGTTCAAACC
seq6:tctagctagcTGACCCACTGAGGATGGACA
EGFP-2A-puro fragment primer sequence:
Seq7:GCTATCTAGAGGTTTAGTGAACCGTCAGG
Seq8:GTAAGCGGCCGCTCCGGAACGCGTTCAGGCA
Embodiment 2: containing the adenovirus packaging of described construction
1. use PacI single endonuclease digestion adenovirus carrier pAd/BLOCK-IT-DEST-nes-EGFP-puro, linearized vector, by the extracting of phenol chloroform, isopropanol precipitating, reclaims linearizing fragment
2. cultivate 293A cell in 3.5cm flat board, treat that cell degree of converging grows to 80%, transfection linearization plasmid pAd/BLOCK-IT-DEST-nes-EGFP-puro.Agents useful for same is Lipofectamine2000 (invitrogen)
3. after transfection 10-15d, in the time there is big area plaque, cleer and peaceful cell in collection; 37 degree water-baths and-80 DEG C of multigelations 3 times, make lysis, discharge virion.
4. the virion of collection is infected to 293A cell again, amplification adenovirus
5. infect after 7d, again collect upper cleer and peaceful cell, as the method cracking of step 3.
6. purify the collected virus of enrichment step 5 with biomiga adenovirus purification kit Adenovirus purification miniprep Kit.
7. extract viral genome, Realtime PCR detects adenovirus titre
Identifying virus the primer:
Seq9：GCCATTACCTTTGACTCTTC?TGT
Seq10：CCTGTTGGTAG?TCCTTGTATTTAGTATC
Embodiment 3: utilize adenovirus to set up sieve medicine clone
Design is for the talen of nestin First Exon, and by talen sequence clone to adenovirus carrier pAd-BLOCK-iT-DEST, then method as described in Example 2, is adenovirus by these two carrier packages, is designated as pAd-BLOCK-nestalenL and pAd-BLOCK-nestalenR.
Tri-adenovirus of pAd-BLOCK-nestalenL, pAd-BLOCK-nestalenR and pAd/BLOCK-IT-DEST-nes-EGFP-puro infect the tumor stem cell strain separating from people's glioma after mixing according to 1:1:1.After 4 days, see that green fluorescence expresses (Fig. 2-a and Fig. 2-b).Utilize limiting dilution assay to separate unicellular, and add tetracycline (puro) screening of 1ug/ml.Cultivate and extract cellular genome after 20 days, utilize primer PCR qualification positive colony across homology arm (Fig. 3-a and Fig. 3-b).By the positive colony cell enlarged culturing of qualification frozen.
Across 5 ' homology arm primers designed sequence:
Seq13：CCACCCTACCTCTTTAGGGGA
Seq14：CTGCGGACCAGTTATCATCCG
Across 3 ' homology arm primers designed sequence:
Seq15：AGAAGAACGGCATCAAGGTGA
Seq16：TCCTTGGTCTCAGCCATTTCTA?。
Claims (2)
1. a screening anti-tumor medicine cell model, it is characterized in that this screening anti-tumor medicine cell model separates from glioblastoma multiforme, site-directed integration the tumor stem cell of reporter gene, the DNA construction that contains A-B-C-D structure, wherein:
A, D is glioblastoma multiforme stem cell molecular marker gene promotor and downstream sequence, and B is reporter gene sequence, and C is puromycin resistance gene puro sequence;
The dry extracellular molecule marker gene of glioblastoma multiforme comprises Nestin gene; Reporter gene comprises green fluorescence protein gene GFP or red fluorescent protein gene RFP or luciferase reporter gene luciferase.
2. the cell model of antitumor drug claimed in claim 1 is for screening the cytotoxicity of resisting tumour stem cells and the material of induction differentiation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410381401.6A CN104130977B (en) | 2014-08-05 | 2014-08-05 | A kind of screening anti-tumor medicine cell model and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410381401.6A CN104130977B (en) | 2014-08-05 | 2014-08-05 | A kind of screening anti-tumor medicine cell model and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104130977A true CN104130977A (en) | 2014-11-05 |
| CN104130977B CN104130977B (en) | 2017-06-13 |
Family
ID=51803831
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410381401.6A Active CN104130977B (en) | 2014-08-05 | 2014-08-05 | A kind of screening anti-tumor medicine cell model and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104130977B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107916270A (en) * | 2017-10-20 | 2018-04-17 | 中国人民解放军第四军医大学 | Detect cell in vitro propagation carrier and cell in vitro proliferation dynamics detection method |
| CN109294975A (en) * | 2018-10-23 | 2019-02-01 | 山东华思生物科技有限公司 | A kind of stem cell drugs screening technique |
| CN109876009A (en) * | 2019-02-27 | 2019-06-14 | 白玥 | A kind of construction method of human glioma mouse model in situ |
| CN109988807A (en) * | 2017-12-31 | 2019-07-09 | 厦门大学 | The method for obtaining highly purified transfer cell derived from multipotential stem cell based on the bis- reporter genes of HCN4 |
| CN110389212A (en) * | 2019-06-26 | 2019-10-29 | 湖北工业大学 | Screen P53PTCThe method for reading over synergistic antitumor drug |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102220284A (en) * | 2011-04-30 | 2011-10-19 | 上海交通大学 | Fluorescent cell model for screening of antitumor drugs, labeling method and application thereof |
| CN102321587A (en) * | 2011-08-25 | 2012-01-18 | 上海吉凯基因化学技术有限公司 | Construction of lung cancer drug screening cell line |
| CN102492656A (en) * | 2011-12-16 | 2012-06-13 | 兰州大学 | High-flux anti-tumor drug screening cell model based on STAT3 and NF-kB two-signal channel serving as target, as well as building and application of high-flux anti-tumor drug screening cell model |
| CN102517373A (en) * | 2011-12-16 | 2012-06-27 | 兰州大学 | Antineoplastic drug screening cell model utilizing STAT3 as target and creation and application thereof |
-
2014
- 2014-08-05 CN CN201410381401.6A patent/CN104130977B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102220284A (en) * | 2011-04-30 | 2011-10-19 | 上海交通大学 | Fluorescent cell model for screening of antitumor drugs, labeling method and application thereof |
| CN102321587A (en) * | 2011-08-25 | 2012-01-18 | 上海吉凯基因化学技术有限公司 | Construction of lung cancer drug screening cell line |
| CN102492656A (en) * | 2011-12-16 | 2012-06-13 | 兰州大学 | High-flux anti-tumor drug screening cell model based on STAT3 and NF-kB two-signal channel serving as target, as well as building and application of high-flux anti-tumor drug screening cell model |
| CN102517373A (en) * | 2011-12-16 | 2012-06-27 | 兰州大学 | Antineoplastic drug screening cell model utilizing STAT3 as target and creation and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| DAVIDE DANOVI ET AL.: "Imaging-based chemical screens using normal and glioma-derived neural stem cells", 《BIOCHEMICAL SOCIETY TRANSACTIONS》 * |
| KOPPANY VISNYEI ET AL.: "A Molecular Screening Approach to Identify and Characterize Inhibitors of Glioblastoma Stem Cells", 《MOL CANCER THER》 * |
| STEVEN M. POLLARD ET AL.: "Glioma Stem Cell Lines Expanded in Adherent Culture Have Tumor-Specific Phenotypes and Are Suitable for Chemical and Genetic Screens", 《CELL STEM CELL》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107916270A (en) * | 2017-10-20 | 2018-04-17 | 中国人民解放军第四军医大学 | Detect cell in vitro propagation carrier and cell in vitro proliferation dynamics detection method |
| CN107916270B (en) * | 2017-10-20 | 2021-09-28 | 中国人民解放军第四军医大学 | Carrier for detecting in vitro cell proliferation and in vitro cell proliferation dynamic detection method |
| CN109988807A (en) * | 2017-12-31 | 2019-07-09 | 厦门大学 | The method for obtaining highly purified transfer cell derived from multipotential stem cell based on the bis- reporter genes of HCN4 |
| CN109294975A (en) * | 2018-10-23 | 2019-02-01 | 山东华思生物科技有限公司 | A kind of stem cell drugs screening technique |
| CN109876009A (en) * | 2019-02-27 | 2019-06-14 | 白玥 | A kind of construction method of human glioma mouse model in situ |
| CN110389212A (en) * | 2019-06-26 | 2019-10-29 | 湖北工业大学 | Screen P53PTCThe method for reading over synergistic antitumor drug |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104130977B (en) | 2017-06-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110128550B (en) | Novel replicative oncolytic adenovirus capable of simultaneously blocking immune check points PD-L1 and TIGIT and application | |
| US7527967B2 (en) | Recombinant baculovirus and virus-like particle | |
| JP4024830B2 (en) | Recombinant viral vector derived from HHV-7, production method thereof, host cell transformation method using the same, host cell transformed therewith and gene therapy method using the same | |
| CN104130977A (en) | Antitumor medicine screening cell model and application thereof | |
| CN111606999B (en) | Replicative oncolytic adenovirus with functions of activating immune co-stimulatory signaling pathway and blocking immune checkpoint and application thereof | |
| CN111607571B (en) | Replicative oncolytic adenovirus for specifically activating immune co-stimulation pathway and preparation method and application thereof | |
| Pu et al. | Development of pseudotyped retroviral system for effective gene transfer and expression in penaeid shrimp cells | |
| CN113637705A (en) | Monkey type 1 adenovirus (SAdV-1) vector system and application thereof | |
| CN109055427A (en) | The false type MERS-CoV virus of infection animal, preparation method and use | |
| He et al. | Rana grylio virus as a vector for foreign gene expression in fish cells | |
| CN104762322B (en) | A kind of reverse transcription virus gene transfer system for prawn cell | |
| CN109136200B (en) | Recombinant infectious hematopoietic necrosis virus and construction method and application thereof | |
| CN114672460B (en) | Preparation method and application of CD 44-targeted heterogeneous CIC cell model | |
| CN115948343A (en) | Steady transfer cell strain for expressing rabies virus glycoprotein and construction method and application thereof | |
| CN106636014A (en) | Novel in-vitro and in-vivo infection model based on Ebola virus-like particles | |
| CN106754982B (en) | Limited replication West Nile virus system for expressing green fluorescent protein and application thereof | |
| CN105274089B (en) | A kind of construction method for the REV viral infectivities clone for expressing green fluorescence cyst membrane fusion protein | |
| CN110117579B (en) | Recombinant virus for expressing 16 type bluetongue virus VP2 gene and construction method and application thereof | |
| CN111500632A (en) | Construction and application of oncolytic adenovirus expressing ST13 and TRAI L | |
| CN116410991B (en) | Recombinant nucleic acid molecules, recombinant vectors and recombinant viruses of vesicular stomatitis virus and novel coronavirus and application of recombinant nucleic acid molecules, recombinant vectors and recombinant viruses | |
| CN106636208A (en) | Method of utilizing bombyx mori nuclear polyhedrosis virus vector system to excessively express microRNA | |
| CN112190591B (en) | Use of ribosomal protein RPL13 inhibitor for the preparation of a medicament for inhibiting IRES-dependent translation of viral replication | |
| WO2021036246A1 (en) | Chimeric antigen receptor t cell targeting egfrviii and interfering with il-6 expression, preparation method therefor and application thereof | |
| Cheng et al. | Construction of cytomegalovirus promoter‐driven gene expression system in Laodelphax striatellus | |
| CN106609283A (en) | Method for simultaneously operating multiple genes by using transposon |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |