CN116904512A - Construction and application of porcine epidemic diarrhea virus attenuated FJzz1 strain infectious clone - Google Patents

Abstract

The application provides a reverse genetic system for rescuing porcine epidemic diarrhea virus FJzz1 strain based on an in-vitro connection means and application thereof. By analyzing the whole genome, we divide the genome into seven fragments of unequal sizes of A, B, C, D, E, F and G on the basis of unique restriction enzyme cleavage sites in the whole genome. Subsequently to increase the efficiency of subsequent ligation, we integrated these seven small fragments into three large fragments AB, CDE and FG. Full-length cDNA is transcribed into RNA transcripts in vitro by using a T7 in vitro transcription kit, and the RNA transcripts and N gene RNA transcripts are transfected into Vero cells to rescue viruses. The rFJzz1 attenuated infectious clone strain which can be inherited stably and has genetic markers is successfully obtained, and a technical platform is provided for the subsequent research of the PEDV pathogenesis of the FJzz1 strain and the development of novel vaccines.

Description

Construction and application of porcine epidemic diarrhea virus attenuated FJzz1 strain infectious clone

Technical Field

The application relates to the technical field of porcine epidemic diarrhea virus reverse genetics, in particular to a reverse genetics system for rescuing porcine epidemic diarrhea virus FJzz1 strain based on an in vitro connection means.

Background

Porcine epidemic diarrhea is an acute, highly contagious intestinal infectious disease in pigs, caused by porcine epidemic diarrhea virus (porcine epidemic diarrhea virus, PEDV). The disease is characterized by acute enteritis, vomiting, watery diarrhea and appetite decrease. Pigs of all ages are susceptible, but the morbidity and mortality of the pigs are up to 90-100% when the pigs are most seriously born. The disease has become one of the major infectious diseases seriously jeopardizing the pig industry. Currently, epidemic PEDV in asia and america is mainly G2 subtype strain, and the ratio of PEDV to strain is more than 90%, which poses a great threat to the global pig industry.

Reverse genetics technology provides powerful tools for comprehensively researching genome structure, gene function, expression and regulation of protein, pathogenic mechanism of virus, research and development of novel vaccine and the like of PEDV. However, infectious clones of PEDV were not first reported until 2013, mainly for two reasons: firstly, PEDV is large in genome (about 28 Kb), and no suitable cloning vector accommodates the full-length cDNA molecule; another major reason is that the partial replicase sequences in the PEDV genome are unstable in bacterial cloning systems and are highly susceptible to recombination and other variations. For the two main reasons above, the difficulty in studying PEDV using traditional reverse genetics techniques is heavy. Thus, researchers have developed non-traditional reverse genetics techniques based thereon, including mainly targeted RNA recombination techniques and construction of full-length infectious cDNA clones. The targeted RNA recombination technology is the earliest established coronavirus reverse genetics manipulation technology, which allows researchers to modify 1/3 genomes of all structural protein genes, auxiliary protein genes, 3 '-non-coding regions and the like at the 3' -end of coronaviruses. However, targeted RNA recombination techniques also have the disadvantage that they do not allow for engineering of the 5' non-coding region of coronaviruses and replicase genes, thus limiting their development.

The current construction method of coronavirus full-length cDNA infectious clone mainly comprises bacterial artificial chromosome system (BAC system) and in vitro cDNA connection method. However, at present, there are problems that prevent the construction of full-length infectious cDNA clones of coronaviruses, such as large genome (27-32 kb) of coronaviruses, difficulty in handling conventional techniques, instability of some replicase gene cDNA clones in bacteria, heterogeneity of transcripts obtained in vitro, and the like. In addition, the restriction of enzyme cutting sites in the conventional method is more, and the in vitro enzyme cutting and connecting efficiency of a plurality of large fragments is lower, so that the method is difficult to be suitable for constructing full-length infectious clones of other strains. In addition, transcripts obtained by in vitro transcription by using the added T7 promoter have heterogeneity and lower virus rescue efficiency. In the using process of the vaccine prepared by the prior art, particularly when the vaccine strain immunity is distinguished from the wild strain infection, the detection and the identification are difficult, the workload is large, and the time consumption is long.

In contrast, for coronaviruses with huge genomes, the in vitro cDNA ligation method is used for constructing virus infectious clones, only a single small fragment is required to clone in bacteria, and the full-length cDNA of the genome of the virus is not required to clone in bacteria, so that the technical defects that the cloning of toxic fragments in bacteria is unstable and the full-length genome of the virus is difficult to obtain and the like are overcome. The method simplifies the operation procedure for obtaining the full-length cDNA of the viral genome, and provides convenience for the construction of virus infectious clone.

Disclosure of Invention

Aiming at the defects existing in the prior art, the application establishes a reverse genetic system for rescuing porcine epidemic diarrhea virus FJzz1 strain based on an in vitro connection means, solves the problem that the coronavirus partial replicase gene cDNA clone in the prior art cannot be stably stored in bacteria, solves the problem of lower traditional enzyme digestion connection efficiency, and also solves the problem of transcript heterogeneity caused by in vitro transcription.

Meanwhile, the F200 strain of FJzz1 saved by the system obviously reduces the pathogenicity of piglets, has low replication level in the piglets, cannot cause obvious pathological damage to intestinal tissues, can induce the bodies of the piglets to generate high-level I-type interferon and III-type interferon, and has development potential as a PEDV attenuated live vaccine. Meanwhile, the attenuated strain is obtained by in vitro passage attenuation of PEDV FJzz1 virulent strain, has strong cell adaptability and genetic stability of genome. In particular, in the application, a genetic marker Xma I restriction enzyme cutting site is introduced into the strain through silent mutation, and the molecular marker can be stably inherited, so that the application is convenient for differential diagnosis with naturally infected PEDV wild viruses. By using the conventional infectious cloning technology, due to the complicated operation procedure, some new gene mutations are easily caused, so that the typical gene characteristic fidelity such as 2 continuous amino acid deletions, disappearance of an N-linked glycosylation site and the like in the F200 generation attenuated strain S protein of FJzz1 is difficult to ensure, and the biological characteristics of the attenuated strain can be possibly changed.

Specifically, the application provides a reverse genetic system for rescuing porcine epidemic diarrhea virus FJzz1 strain based on an in vitro connection means, which comprises the following components:

(a) An engineered vector pBSK, further, the vector pBSK is obtained by engineering a multiple cloning site region (MCS) between Kpn I and Sac I in plasmid pBluescript II SK (+), wherein the engineered multiple cloning site region (MCS) is specifically: kpn I-Sac II-BamH I-Avr II-Pac I-Xma I-Blp I-Age I-Asc I-Sac I.

(b) The full-length 7 fragments of the PEDV genome are specifically: A. b, C, D, E, F and G (corresponding to Genbank number, MK288006.1, corresponding to specific positions: A (1-3497 nt), B (3497-9503 nt), C (9503-13014 nt), D (13014-16224 nt), E (16224-20712 nt), F (20712-25571 nt), G (25571-28035 nt), and the 7 fragments are linked by 6 restriction sites of BamHI, avrII, pacI, xma I, blpI and AgeI, respectively). Further, adding a T7 prokaryotic promoter at the 5' end of the A fragment; 23 poly A tails are added at the 3' end of the G fragment; the restriction enzyme cleavage site Xma I between the D fragment and the E fragment is a genetic marker introduced by silent mutation.

It is further preferred that the full-length 7 fragments of the PEDV genome are integrated into three major fragments AB, CDE and FG, and further that a T7 prokaryotic promoter is added at the 5' end of the AB fragment for subsequent in vitro transcription. Meanwhile, in order to improve the packaging efficiency of the rescuing virus, a tail consisting of 23 poly A is added at the 3' end of FG fragment.

(c) Helper plasmids containing the N gene of the porcine epidemic diarrhea virus (wherein, the specific sequence of the N gene is Genbank number: MK288006.1, corresponding specific position 26376-27701 nt),

the application also provides a method for rescuing porcine epidemic diarrhea virus FJzz1 strain, which comprises the following steps: and co-transfecting the recombinant expression vector and the auxiliary plasmid in the system into host cells, repeatedly freezing and thawing after cytopathy, and collecting supernatant to obtain the rescued virus.

The application also provides the rescuing virus obtained by the rescuing method.

The application also provides application of the virus rescue, which is as follows:

the application in creating a novel porcine epidemic diarrhea virus marker vaccine;

the application in screening the anti-porcine epidemic diarrhea virus drugs;

the application in the research of the pathogenesis of the porcine epidemic diarrhea virus;

or in the gene function research of porcine epidemic diarrhea virus.

Advantageous effects

The PEDV reverse genetic operating system provided by the application provides a powerful tool for comprehensively researching the genome structure, gene function, protein expression and regulation, virus pathogenic mechanism, research and development of novel vaccines and the like of PEDV. The method has the advantages of large capacity, low copy and high replication stringency, and can ensure that large fragment genome sequences of PEDV can be stably stored in bacteria.

According to the application, firstly, the whole genome is analyzed, and on the basis of the unique restriction enzyme cleavage sites in the whole genome, the whole genome is divided into seven fragments with unequal sizes of A, B, C, D, E, F and G. Subsequently, to increase the efficiency of subsequent ligation, we integrated these seven small fragments into three large fragments AB, CDE and FG, and added a T7 prokaryotic promoter at the 5' end of the AB fragment for subsequent in vitro transcription. Meanwhile, in order to improve the packaging efficiency of the rescuing virus, a tail consisting of 23 poly A is added at the 3' end of FG fragment. In addition, according to the degeneracy principle of amino acid codons, a genetic marker is introduced between the D fragment and the E fragment by a silent mutation method, and is also a restriction enzyme cleavage site Xma I, and the two characteristics can be used for distinguishing the rescue virus from the parent strain. Three large fragments of AB, CDE and FG are respectively constructed to the modified cloning vector pBSK through homologous recombination technology, and three cloning plasmids pBSK-AB, pBSK-CDE and pBSK-FG are constructed. Notably, by dividing the full-length cDNA into three large fragments, particularly two large fragments of AB and CDE, it happens that the toxic fragments (replicase genes) of PEDV can be separated, so that instability caused by the toxic fragments in the full-length cDNA of PEDV in the process of E.coli proliferation is avoided, and the virus rescue efficiency is improved.

Subsequently, three cloned plasmids pBSK-AB, pBSK-CDE and pBSK-FG were double digested respectively, and the respective AB, CDE and FG target fragments were recovered. Three large fragments AB, CDE and FG were ligated into full-length cDNA clones by T4 ligase based on the cohesive ends between the fragments generated by the same restriction enzyme cleavage. After phenol chloroform extraction, the full-length cDNA was transcribed in vitro into RNA transcripts using the T7 in vitro transcription kit. Meanwhile, a pBSK-N cloning plasmid is constructed, and an SP6 prokaryotic promoter is added in front of an N gene start codon. After single enzyme digestion linearization, the pBSK-N cloning plasmid uses SP6 in vitro transcription kit to transcribe N gene into RNA transcript in vitro, and transfect into Vero cell together with full-length cDNA in vitro RNA transcript. As a result, it was found that the transfection efficiency of the rescued virus could be significantly improved by simultaneously carrying out the in vitro RNA transcripts of the N gene transcript and the full-length cDNA of PEDV during the virus rescue.

Since PEDV genome is large, about 28kb, we used electric shock method to electrically transfect the two RNA transcripts into Vero cells for virus rescue. The results showed that 36 hours after transfection, significant cytopathy was observed on Vero cells. The first generation of rescue virus was harvested and passed on to 20 passages in Vero cells. RT-PCR and sequencing results show that the introduced genetic marker Xma I exists stably in the passage process. Analysis of the biological properties of the rescued virus showed that the replication level and plaque size of the rescued virus were similar. The results fully show that the rFJzz1 attenuated infectious clone strain which can be inherited stably and has genetic markers is successfully obtained through an in vitro connection method, and a technical platform is provided for the subsequent research of the pathogenic mechanism of the PEDV strain FJzz1 and the development of novel vaccines.

The virus rescue system disclosed by the application is favorable for further developing experimental researches on pathogenic mechanism and gene function of PEDV, and has very important application value in antiviral drug screening and vaccine research and development. The obtained infectious clone strain has a genetic marker Xma I, and the molecular marker can be stably inherited and can be used for differential diagnosis of the wild virus of the naturally infected PEDV.

Drawings

FIG. 1 is a schematic diagram of pBluescript II SK (+) vector engineering, wherein A: pBluescript II SK (+) vector maps; b, modifying a sequence enzyme cutting site schematic diagram; c, reconstructing a vector identification primer schematic diagram; and D, modifying the vector for PCR identification.

FIG. 2 is a schematic diagram showing the design of full-length cDNA fragments of FJzz1 attenuated strain.

FIG. 3 is a graph showing the amplification results of three objective fragments and the linearization vectors thereof, wherein A is AB fragment and the linearization vectors thereof; the CDE fragment and linearization carrier thereof are amplified; FG fragment and linearization vector amplification thereof.

FIG. 4 is a graph of the results of three large fragment plasmid constructions, wherein A is the pBSK-AB plasmid identification; b, pBSK-CDE plasmid identification; and C, identifying pBSK-FG plasmid.

FIG. 5 is a graph showing the identification result of pBSK-N plasmid.

FIG. 6 is a schematic diagram of the construction of full-length cDNA infectious clones.

FIG. 7 is a diagram showing virus rescue and identification, wherein A is cytopathic 18h after infection of Vero cells with the first generation of rescue virus; b, rescuing cytopathy caused by virus 18h after infection of Vero cells in the second generation; the method comprises the steps of C, carrying out indirect immunofluorescence staining on the rescuing virus by PEDV N protein monoclonal antibody to rescue the plaque morphology of the virus; d, a genetic marker enzyme digestion identification schematic diagram; e, single enzyme digestion identification of genetic markers; f, sequencing and identifying genetic markers.

FIG. 8 is the identification of rescue virus genetic markers.

FIG. 9 is an in vitro biological profile of a rescued virus wherein A is cytopathic 18h after infection of Vero cells with the rescued virus; b, rescuing the virus, and performing indirect immunofluorescence staining by using PEDV N protein monoclonal antibody; rescuing plaque morphology of the virus; and D, saving a growth curve of the virus.

Detailed Description

The following detailed description of embodiments of the application is, therefore, to be taken in conjunction with the accompanying drawings, and it is to be understood that the scope of the application is not limited to the specific embodiments.

Throughout the specification and claims, unless explicitly stated otherwise, the term "comprise" or variations thereof such as "comprises" or "comprising", etc. will be understood to include the stated element or component without excluding other elements or components.

Material preparation

Main reagent

Cell culture medium DMEM, 0.25% -EDTA pancreatin, fetal bovine serum FBS, PBS and anti-mouse fluorescent secondary antibody Alexa488donkey anti-mouse IgG(H+L)antibody(Invitrogen ^TM ) And Revert Aid First Strand cDNA Synthesis Kit, etc. are all available from Life Technologies; trypsin was purchased from Sigma; the RNA extraction Kit RNeasy Mini Kit was purchased from Qiagen; plasmid small lifterThe kit and the PCR product gel recovery kit are all purchased from OMEGA; plasmid middling kit was purchased from MACHEREY-NAGEL; />High-Fidelity DNA Polymerase, each restriction enzyme and T4DNA ligase were purchased from NEB; in-)>HD Cloning Kit, LA Taq Premix were all purchased from TaKaRa; pBluescript II SK (+) plasmid was maintained by the present laboratory.

Main instrument

The instruments used in this study were mainly: PCR instrument, UV gel imaging system, biosafety cabinet, cell incubator inverted fluorescence microscope, 4 ℃ low temperature centrifuge, 4 ℃ refrigerator, -80 ℃ ultra low temperature refrigerator, american Bio-rad Bere Gene Pulser Xcell electroporation system, etc.

Example 1pBluescript II SK (+) vector engineering

An important factor in constructing infectious clones of viruses is that the copy number of the vector used for gene cloning in E.coli is low, because the high copy number vector is unstable in the E.coli proliferation process, which can cause the full-length genome cDNA clone of the virus to be easy to generate gene mutation, deletion, insertion and the like, thereby losing the authenticity of the virus cDNA clone. Meanwhile, the gene cloning vector contains the necessary multiple cloning sites suitable for gene cloning, so as to facilitate cloning of large genomes or complex full-length gene cDNAs of viruses. Commercial pBluescript II SK (+) belongs to a low-copy plasmid, can meet the cloning of a large fragment gene of a virus, but a plurality of commercial vectors including pBluescript II SK (+) belong to common restriction enzyme sites (MCS), and the restriction enzyme sites are not unique in a virus genome, so that when cDNA cloning is constructed by using the commercial vectors, the splicing errors of gene fragments are easy to cause the disordered arrangement of the sequence of the virus genome, and correct infectious cDNA cloning is difficult to obtain by using the conventional restriction enzyme sites, thereby increasing the difficulty of obtaining correct cloning. Therefore, in order to increase the efficiency of obtaining the correct gene clone and to increase the fidelity of the obtained viral cDNA clone, it is necessary to modify the polyclonal restriction site (MCS) of pBluescript II SK (+) according to the restriction site characteristics contained in the F200 generation viral genome sequence of FJzz1, so that the efficiency and authenticity of the viral genome cDNA clone can be improved. For this purpose, the application requires a vector modification of pBluescript II SK (+).

The multiple cloning site region (MCS) between Kpn I and Sac I in plasmid pBluescript II SK (+) was engineered for subsequent construction of full-length cDNA infectious clones according to restriction enzyme site analysis of the full-genome sequence of PEDV of FJzz1 attenuated strain. The synthesized modified sequence was replaced by restriction ligation with the sequence of the multiple cloning site between restriction enzymes Kpn I and Sac I in the pBluescript II SK (+) vector (see FIG. 1).

Synthesis of the engineered sequences

According to the designed enzyme cutting site sequence, the following single-chain sequence and the reverse complement thereof are synthesized by Shanghai Yingsu biological limited company: GGTACCCCGCGGGGATCCCCTAGGTTAATTAACCCGGGGCTCAGCACCGGTGGCGCGCC GAGCTC (SEQ ID NO. 1). After dissolution, respectively taking an equivalent single-stranded sequence and a reverse complementary sequence thereof into a 1.5mL centrifuge tube, placing the single-stranded sequence and the reverse complementary sequence into a prepared water bath kettle with the temperature of 98 ℃, naturally cooling to normal temperature to obtain a double-stranded modified sequence, and preserving the double-stranded modified sequence at the temperature of minus 20 ℃ for later use.

pBluescript II SK (+) plasmid enzyme digestion and recovery

Plasmid pBluescript II SK (+) 2. Mu.g was taken and double digested simultaneously with restriction enzymes Kpn I and Sac I. The enzyme digestion system is as follows:

after 3h in a 37 ℃ water bath, 0.8% agarose nucleic acid gel electrophoresis is carried out, and gel cutting recovery is carried out according to the specification by using a gel recovery kit of OMEGA company, and the gel is preserved at-20 ℃ for standby.

Preparation of modified vectors

And respectively taking pBluescript II SK (+) linearization fragments and modified sequences recovered after enzyme digestion, uniformly mixing according to a ratio of 1:10, and connecting at 16 ℃ overnight under the action of T4 ligase. The ligation product transformed Top 10 competent cells, plated to ampicillin-resistant LB solid medium. The culture is carried out for 16 hours in an inverted mode at 37 ℃,12 monoclonal colonies are respectively picked up on an ampicillin-resistant LB liquid culture medium, and shake culture is carried out for 3 hours at 37 ℃.

Bacterial liquid PCR identification of modified vector

The 12 monoclonal bacterial solutions were taken and subjected to bacterial solution PCR identification by LA Taq Premix of TaKaRa company. The PCR system was as follows (MCS-F and MCS-R sequences are shown in Table 1):

the PCR products were subjected to 0.8% agarose nucleic acid gel electrophoresis. The positive bacterial liquid is continued to be cultured for 12 hours by shaking table at 37 ℃, after bacterial preservation, plasmids are extracted by using a plasmid extraction kit of OMEGA company according to the instruction of use, and sent to Shanghai Ying Weijie biological limited company for first generation sequencing. The bacterial liquid PCR results show that the 12 selected monoclonal colonies are positive, and the pBluescript II SK (+) vectors are negative. The sequence of the 12 selected monoclonal colonies is completely correct through further verification by sequencing, which shows that the 12 monoclonal colonies are successfully transformed and can be used for the construction of subsequent infectious clones. The modified correct vector was designated pBSK.

Example 2FJzz1 attenuated strain full-length genome segment design and Synthesis

In order to conveniently obtain full-length PEDV cDNA with the genome of about 28Kb later, simplify the operation procedure of frequently cloning and splicing the gene components into excessive small gene fragments, avoid adverse factors such as gene mutation, deletion, insertion and the like caused by frequent cloning of the excessive gene fragments, analyze the restriction enzyme cutting sites of the full genome sequence of the FJzz1 attenuated strain, divide the full genome of the FJzz1 attenuated strain into 7 fragments with different sizes of A, B, C, D, E, F and G, and the designed 7 gene fragments can ensure the high efficiency of amplification by using high-fidelity DNA polymerase and have strong specificity. But also avoids the unstable factors of potential toxic sequences in the viral genome in a bacterial cloning system, and improves the efficiency of gene cloning. In addition, unique specific restriction endonuclease cleavage sites in 6 genomes of BamHI, avrII, pacI, xmaI, blpI, ageI and the like are respectively designed among the 7 fragments (see FIG. 2), so that the subsequent homologous recombination of the three fragments into three large fragments is facilitated. Meanwhile, a T7 prokaryotic promoter is added at the 5' end of the A fragment and is connected with an transformation vector pBSK through a SacII enzyme cutting site; 23 poly A tails were added to the 3' end of the G fragment and ligated to the engineering vector pBSK at the Asc I cleavage site. In addition, the restriction enzyme cleavage site Xma I between the D fragment and the E fragment is a genetic marker introduced through silent mutation, and is used for the identification of the subsequent rescue virus.

Primer design and Synthesis

Since the PEDV genome is large, about 28Kb, its full-length 7 fragments are further divided into three large fragments of AB, CDE and FG, and these three large fragments are homologously recombined into the engineering vector pBSK, respectively, using the method of homologous recombination. Therefore, when designing the primer, the upstream homology arm and the downstream homology arm are respectively added at the 5 'end and the 3' end of 7 fragments, a T7 promoter sequence is added at the 5 'end of the A fragment, and a poly A (23A) tail is added at the 3' end of the G fragment. Meanwhile, when designing N gene amplification primers, an SP6 promoter sequence is added at the 5 'end and a poly A (23A) tail is added at the 3' end. All primers were synthesized by the english weijie company and the sequences were as follows:

TABLE 1primer sequences Table 4.1Primer sequences used in this study used in this study

Amplification of 7 fragments of full-Length Gene and engineering vector

cDNA of PEDV attenuated with FJzz1 strain (Chen P, zhao X, zhou S, zhou T, tan X, wu X, tong W, gao F, yu L, jiang Y, yu H, yang Z, tong G, zhou Y.A Virulent PEDV Strain FJzz, with Genomic Mutations and Dele)tions at the High Passage Level Was Attenuated in Piglets via Serial Passage In Vitro. Virol sin.2021Oct;36 1052-1065.Doi:10.1007/s 12250-021-00368-w.) and the transformation vector pBSK as templates, and the above primers were used as specific primers by NEB companyHigh-Fidelity DNA Polymerase, 7 fragments A, B, C, D, E, F and G, N gene fragments with different homology arms, and 3 linearized vectors, respectively, were amplified. The amplification system is as follows (the F and R sequences are shown in Table 1):

the PCR reaction procedure was as follows:

the agarose nucleic acid gel electrophoresis result shows that 7 fragments with different homology arms and three linearized vector fragments are successfully amplified, the target fragment has good specificity and the size is consistent with the expectations (see figure 3). The PCR product was subjected to 0.8% agarose nucleic acid gel electrophoresis, and then purified using an OMEGA gel recovery kit according to the protocol, and the purified product was stored at-20℃for further use after concentration measurement.

Construction of 3 Large fragment plasmid by homologous recombination method

By TaKaRa In-HD Cloning Kit three large fragments AB, CDE and FG were homologously recombined into the engineering vector pBSK according to the instruction manual, respectively, to construct three large fragment plasmids, pBSK-AB, pBSK-CDE and pBSK-FG. The system is as follows:

pBSK-AB：

pBSK-CDE：

pBSK-FG：

note that: the optimal cloning vector usage= (0.02×vector base pair number) ng;

optimal insert usage = (0.04 x insert base pair number) ng.

If the system is > 10. Mu.L, 5 XIn-Fusion HD Enzyme Premix is doubled, water is added to make up to 20. Mu.L.

The reaction conditions were as follows: water bath at 50 ℃ for 15min, and standing on ice for 2min. The reaction product can be used directly for transformation into Top 10 competent cells of Tiangen, inc., or stored at-20 ℃.

Identification of positive colonies and plasmid extraction

And respectively picking a plurality of monoclonal colonies on an ampicillin-resistant LB liquid medium, carrying out shaking culture at 37 ℃ for 3 hours, and carrying out bacterial liquid PCR identification by using LA Taq Premix of TaKaRa company. The PCR system is as follows:

(wherein the F and R sequences are shown in Table 1)

The PCR products were subjected to 0.8% agarose nucleic acid gel electrophoresis to identify positive colonies.

And (3) continuing shaking culture of the positive bacterial liquid with the identification accuracy at 37 ℃ for 12 hours, and preserving the bacterial strain according to the proportion that the final concentration of glycerol is 15-20%. The residual bacterial liquid is used for extracting plasmids according to the using instructions by using an OMEGA plasmid extraction kit, and is sent to Shanghai Yingxi Weijiki company for first-generation sequencing verification. The bacterial liquid PCR identification result shows that three large fragment plasmids pBSK-AB, pBSK-CDE and pBSK-FG are successfully constructed, and the double enzyme digestion identification result shows that the four plasmids can be cut by specific restriction enzymes, and the sizes of the obtained three large fragments AB, CDE and FG are correct and accord with expectations (see figure 4). The plasmids with correct bacterial liquid PCR identification and enzyme digestion identification are sequenced by the Shanghai Yingjieshiki company, and the result is completely correct.

In the same way, the N gene fragment recovered by PCR is subjected to homologous recombination to a modified vector pBSK, so as to construct a pBSK-N plasmid. The bacterial liquid PCR identification result shows that the selected monoclonal colony is positive, and the single and double enzyme digestion identification results show that the pBSK-N plasmid can be cut by restriction enzymes KpnI and BamHI, which are consistent with expectations (see figure 5). In addition, plasmids with correct bacterial liquid PCR identification and enzyme digestion identification are sent to the Haiyangwei Jieshiki company for sequencing, and the result is completely correct. The above results indicate that the pBSK-N plasmid was constructed successfully.

The positive bacterial liquid with correct sequencing verification is transferred to 200mL of LB liquid medium with ampicillin resistance according to the proportion of 1:100, and then is subjected to shaking culture for 16 hours at 37 ℃ by using a plasmid extraction kit of Macherey-Nagel company, and plasmid extraction is carried out according to the operation instructions. Three plasmids pBSK-AB, pBSK-CDE and pBSK-FG were double digested respectively with NEB restriction enzymes, and the desired fragment was recovered. The cleavage system for the three plasmids is as follows:

pBSK-AB：

pBSK-CDE：

pBSK-FG：

cleavage reaction conditions: water bath at 37 ℃ for 3h. The enzyme-digested product is subjected to 0.8% agarose nucleic acid gel electrophoresis, and three large linear fragments AB, CDE and FG are respectively recovered by using a gel recovery kit of OMEGA company, and the concentration is measured and then stored at-20 ℃ for standby.

Full-length cDNA in vitro ligation

Three large linear fragments AB, CDE and FG are respectively taken for recycling products by adopting an in-vitro connection method, and are mixed according to an equimolar ratio. Under the action of T4 ligase, the AB fragment and CDE fragment were linked by avrII, and the CDE fragment and FG fragment were linked by BlpI (see FIG. 6). Finally, three large linear fragments AB, CDE and FG are connected to form linearized ABCDEFG, and the full-length cDNA is obtained after phenol chloroform extraction and purification. The connection system is as follows:

connection reaction conditions: the ligation product was purified by phenol chloroform extraction overnight at 16 ℃.

In vitro transcription

The purified full-length cDNA ligation products were transcribed in vitro using mMESSAGE mMACHINE T7 Transcription Kit as described; simultaneously, mMESSAGE mMACHINE SP, 6 and Transcription Kit are used for in vitro transcription of the N gene fragment to obtain N transcripts. The transcription system is as follows:

full-length cDNA (T7):

N(SP6)：

reaction conditions: 40.5 ℃ for 25min; transcription is carried out for 60min at 37 ℃;40.5℃for 25min.

Example 3 Virus rescue and identification

Virus rescue

The full-length cDNA transcripts and N gene transcripts were co-transfected into Vero cells using a Bio-rad company Gene Pulser Xcell electroporation system to rescue the virus. The specific operation is as follows:

1) After one bottle of T75 Vero cells is full, 3mL of Trypsin is added, and the mixture is digested for 2min at 37 ℃, and the Trypsin is discarded;

2) The cell flask was tapped, 10mL DMEM with 10% FBS was added to blow the cells and transferred to a 15mL centrifuge tube;

3) Centrifuging at 1000rpm at 4 ℃ for 5min, and discarding the culture medium;

4) The cells were resuspended in 10mL cold PBS, centrifuged at 1000rpm at 4℃for 5min, and the supernatant discarded;

5) Repeating step 4);

6) Re-suspending the cells with 800uL cold PBS, adding full-length cDNA transcripts and N gene transcripts, fully mixing, and transferring to a cuvette;

7) Setting Gene Pulser Xcell to 450V,50 μF, three consecutive shocks (interval 10s, no disturbance of cells);

8) Standing at room temperature for 10min, transferring to a 15mL centrifuge tube containing 12mL 10% FBSDEM, fully mixing, and spreading to a six-hole plate;

9)、37℃，5％ CO ₂ culturing in an incubator for 4 hours to adhere cells;

10 After 4h, changing into DMEM without FBS (little pancreatin is added), and supplementing pancreatin to a final concentration of 10 mug/mL after 12 h;

11)、37℃，5％ CO ₂ culturing in incubator for 2-4d, and observing CPE.

Identification of rescue Virus

The rescued virus needs to be validated in one step to ensure that CPE is caused by the rescued virus, not the parental strain. The specific operation is as follows:

1) When most cells have cytopathy, placing the six-hole plate in a refrigerator at-80 ℃ for 1h, then placing the six-hole plate in normal temperature for freezing and thawing once to obtain first-generation virus rFJ-F1, packaging and storing in the refrigerator at-80 ℃;

2) 100. Mu.L of the first generation virus solution was diluted in 3mL of DMEM (final concentration of pancreatin 10. Mu.g/mL), inoculated in T25Vero cells, 37℃and 5% CO ₂ The incubator feel for 1h; PBS was used to wash the cells twice, and 5mL DMEM (final pancreatin concentration 10. Mu.g/mL) was used instead, 37℃and 5% CO ₂ Culturing in an incubator for 24-36h, and observing CPE;

3) Collecting the second-generation virus rFJ-F2 when most cells have cytopathy, and sub-packaging and storing;

4) Taking a proper amount of second-generation virus liquid, inoculating Vero cells according to the method, and performing IFA identification;

5) 100. Mu.L of a second generation virus solution was used to extract RNA according to manual instructions using the RNeasy Mini Kit;

6) Reverse transcription of the RNA into cDNA using Revert Aid First Strand cDNA Synthesis Kit;

7) PCR amplification (50. Mu.L system) was performed using LA Taq Premix from TaKaRa, inc., with cDNA as a template and XmaI-F/XmaI-R as a primer;

8) 5 mu L of PCR product is taken for XmaI single enzyme digestion identification, and the rest PCR product is sent to sequencing company for sequencing verification.

The results confirm that the in vitro linked full-length cDNA was transcribed into RNA transcripts by the T7 in vitro transcription kit. The full-length cDNA transcripts and N gene transcripts were then co-transfected into Vero cells using a Bio-rad company Gene Pulser Xcell electroporation system to rescue the virus. The results indicated that around 36h post-transfection, significant CPE could be observed (see fig. 7). After the cells are completely diseased, the first generation virus is collected and designated rFJzz1-F1. Re-infection of Vero cells with rFJzz1-F1 still allowed the observation of typical CPE. IFA results show that the specific green fluorescence can be observed under an inverted fluorescence microscope by using the anti-PEDV N protein murine monoclonal antibody prepared in the laboratory as a primary antibody and rescuing Vero cells infected by the virus rFJzz1-F2 in the second generation. In addition, according to the principle of degeneracy of amino acids, a genetic marker was introduced at position 16244 of the FJzz1 attenuated strain genome by silent mutation, and was also a restriction enzyme site Xma I. Through single enzyme digestion identification and sequencing verification of Xma I, the genetic marker is completely correct, which shows that the PEDV FJzz1 attenuated infectious clone strain rFJzz1 strain is successfully rescued.

Genetic stability analysis to rescue viruses

The rescued virus was blinded in vitro to 20 passages (rFJzz 1-F20) on Vero cells as described above. And selecting rFJzz1-F5, rFJzz1-F10 and rFJzz1-F20 viruses, extracting total RNA, and performing reverse transcription to obtain cDNA. PCR amplification is carried out by taking cDNA of different generations of rescuing viruses as a template and XmaI-F/XmaI-R as a primer. The PCR amplified products are respectively subjected to XmaI single enzyme digestion identification and sequencing verification. The results showed that the PCR products amplified using XmaI-F/XmaI-R as primers could be completely cut by the restriction enzyme XmaI, and the sequencing results showed that the introduced genetic marker XmaI was completely correct in sequence (see FIG. 8). The results fully show that the genetic markers introduced in the construction process of the infectious clone can exist stably along with the in vitro passage of the virus.

Plaque assay to rescue viruses

The rFJzz1-F5, rFJzz1-F10 and rFJzz1-F20 viruses were selected for plaque assay. First, six 1.5mL EP tubes were taken, and 0.9mL of DMEM (pancreatin concentration 10. Mu.g/mL) was added to each tube. 0.1mL of virus solution supernatant was added to the first tube, and after vortexing, 0.1mL was added to the second tube for 10-fold gradient dilution. Then, 1mL of virus dilutions were added to six well plates, which were grown with a monolayer of Vero cells, respectively. After incubation for 1 hour at 37℃the six well plates were washed three times with PBS and 3mL of a pre-prepared liquid low melting agarose solution containing 10. Mu.g/mL pancreatin was added to each well. After allowing to stand at room temperature for 2 hours until agar is completely solidified, the six-well plate is allowed to stand at 37℃for culture. Crystal violet staining is performed when the plaque is large enough and clearly visible under a microscope and the naked eye.

Indirect immunofluorescence to rescue viruses

Appropriate amounts of rFJzz1-F5, rFJzz1-F10 and rFJzz1-F20 virus were inoculated into Vero cells, respectively, and when apparent CPE appeared on the cells, the cells were fixed with 80% cold ethanol at 4℃for 1 hour. After washing twice with PBS, the diluted anti-PEDV N monoclonal antibody primary antibody was added to the corresponding wells and incubated at 37℃for 1 hour. After three washes with PBS, FITC-labeled donkey anti-mouse IgG (1:800 dilution) was used as secondary antibody to the monoclonal antibody-incubated cells. After incubation at 37℃for 1 hour, the cells were washed three times with PBS and observed under a fluorescence microscope.

Growth curve for rescuing viruses

And respectively selecting rFJzz1-F5, rFJzz1-F10 and rFJzz1-F20 viruses to measure a growth curve. First, the virus was inoculated into 96-well plates at 0.01MOI, and cell culture supernatants were collected at 6h, 12h, 18h, 24h, 30h, and 36h, respectively, after inoculation. Viral titers of these samples were then measured by half the tissue culture infection count (TCID ₅₀ ) The measurement is carried out as follows: the sample was first subjected to 10-fold gradient dilution (10 ^-1 -10 ^-8 ) Then, the diluted virus solutions with different concentrations are inoculated into a 96-well plate full of monolayer Vero cells, each dilution virus solution is respectively inoculated into 8 vertical cell culture holes from left to right, and the cells are placed into a 37 ℃ cell culture box for culturing for 4-5 days, and cytopathy caused by virus infection is observed. And finally, drawing a virus growth curve according to the virus titer at different time points after virus infection.

The results show that typical syncytial CPE appears after rFJzz1-F5, rFJzz1-F10 and rFJzz1-F20 viruses infect Vero cells, and specific green fluorescence can be observed under an inverted fluorescence microscope by taking the anti-PEDV N protein murine monoclonal antibody prepared in the laboratory as a primary antibody, which is similar to the parent virus. Plaque test results show that plaque morphology of rFJzz1-F5, rFJzz1-F10 and rFJzz1-F20 is similar to that of the parent toxin, and no obvious difference exists. The results of the multi-step growth curves showed that the proliferation capacity of rFJzz1-F5, rFJzz1-F10 and rFJzz1-F20 viruses was similar, and the highest virus titer was reached 24h after infection, but the highest virus titer was slightly increased with the increase of the generation number (see FIG. 9).

The foregoing descriptions of specific exemplary embodiments of the present application are presented for purposes of illustration and description. It is not intended to limit the application to the precise form disclosed, and obviously many modifications and variations are possible in light of the above teaching. The exemplary embodiments were chosen and described in order to explain the specific principles of the application and its practical application to thereby enable one skilled in the art to make and utilize the application in various exemplary embodiments and with various modifications as are suited to the particular use contemplated. It is intended that the scope of the application be defined by the claims and their equivalents.

Claims (9)

1. A reverse genetics system for rescuing porcine epidemic diarrhea virus FJzz1 strain based on in vitro ligation, comprising:

(a) The modified vector pBSK;

(b) Full-length segments of PEDV genome;

(c) A helper plasmid comprising the porcine epidemic diarrhea virus N gene.

2. The reverse genetics system of claim 1 wherein vector pBSK is engineered from a multiple cloning site region (MCS) between Kpn I and Sac I in plasmid pBluescript II SK (+) wherein the sequence of the engineered multiple cloning site region (MCS) is Kpn I-Sac II-BamH I-Avr II-Pac I-Xma I-Blp I-Age I-Asc I-Sac I.

3. The reverse genetics system of claim 1 wherein the full length PEDV genome is divided into A, B, C, D, E, F and 7 fragments of unequal G size, the 7 fragments being joined by 6 specific restriction endonuclease sites of bamhi, avr ii, pachi, xma I, blpi and Age I, respectively.

4. The reverse genetics system of claim 3 wherein a T7 prokaryotic promoter is added to the 5' end of the a fragment; 23 poly A tails are added at the 3' end of the G fragment; the restriction enzyme cleavage site Xma I between the D fragment and the E fragment is a genetic marker introduced by silent mutation.

5. A reverse genetics system according to claim 3 wherein the full-length 7 fragments of PEDV genome are integrated into three major AB, CDE and FG fragments, and further wherein a T7 prokaryotic promoter is added to the 5' end of the AB fragment for subsequent in vitro transcription. Meanwhile, in order to improve the packaging efficiency of the rescuing virus, a tail consisting of 23 poly A is added at the 3' end of FG fragment.

6. The reverse genetics system of claim 1 wherein the gene sequence of the N gene.

7. A method of rescuing porcine epidemic diarrhea virus FJzz1 strain comprising the steps of: co-transfecting the recombinant expression vector and helper plasmid of the system of any one of claims 1 to 6 into a host cell, repeatedly freezing and thawing after cytopathic effect, and collecting supernatant to obtain the rescued virus.

8. The rescued virus obtained by the method of claim 7.

9. Use according to claim 8 for rescuing viruses, wherein said use is:

application in creating novel porcine epidemic diarrhea virus marker vaccine, and rapid identification and differentiation of vaccine strain immunity and wild strain infection can be realized

Dyeing;

the application in screening the anti-porcine epidemic diarrhea virus drugs;

the application in the research of the pathogenesis of the porcine epidemic diarrhea virus;

or in the gene function research of porcine epidemic diarrhea virus.