CN108060172A - A kind of recombinant virus for detecting the method for 6 type neutralizing antibody of Coxsackie virus A group and its being applied - Google Patents

Abstract

The invention discloses the recombinant viruses for detecting the detection method of 6 type of Coxsackie virus A group (CV A6) neutralizing antibody and being applied.The pseudovirus system detectio neutralizing antibody that the present invention is packed using 2 kinds of recombinant plasmids, as a result of the pseudovirus of single cycle infection, so safety problem when using live virus.By multiple experiments, the result shows that the pseudovirus detecting system stated in the invention is a kind of safety, it is sensitive, quickly, specifically, the method for easy and low-cost detection CV A6 neutralizing antibodies.More than feature is based on, which is very suitable for quickly, detects the experiment of neutralizing antibody on a large scale, and the development and detection patient for CV A6 viral vaccines are personal and crowd's CV A6 specificity neutralizing antibody levels have important application value.

Description

It is a kind of to be used to detect the method for 6 type neutralizing antibody of Coxsackie virus A group and its be applied Recombinant virus

Technical field

The invention belongs to the detection methods of 6 type neutralizing antibody of biological technical field more particularly to detection Coxsackie virus A group And its special pseudovirus, and in particular to for the method, special packed the two of special pseudovirus kinds of recombinant plasmids, prepare the plasmid Pseudovirus and quick detection kit.

Background technology：

6 type of Coxsackie virus A group (Coxsackievirus A6, CV-A6) belongs to Picornaviridae (Picornaviridae) enterovirus genus (Enterovirus).CV-A6 is single strand plus RNA virus, and virion is 20 The spherical structure of face body cubic symmetry, diameter are about 30mm, no coating and protrusion.CV-A6 full-length genomes about 7400bp, gene Group is made of an open reading frame and 2 noncoding regions (5 '-UTR and 3 '-UTR).Open reading frame is 2202 amino Acid composition polyprotein, the albumen by virus itself coding protease be further hydrolyzed to 3 precursor proteins (P1, P2, P3), wherein P1 precursor proteins encode 4 viral capsid proteins (VP1-VP4), and P2 and P3 encode 7 non-structural protein (2A-2C And 3A-3D).Since Finland in 2008 reports that CV-A6 causes hand-foot-and-mouth disease prevalence for the first time, Europe, Asia and South America etc. Start to report breaking out for CV-A6 correlation hand-foot-and-mouth diseases in succession.In recent years, CV-A6 is in Global prevalence trend, the especially Pacific Ocean Area, is included in China, TaiWan, China, Japan and Singapore etc., CV-A6 be substituted 71 type (EV-A71) of enterovirus A groups and Coxsackie virus A group 16 (CV-A16) type becomes the main pathogens for causing hand-foot-and-mouth disease.CV-A6 not only easy infection children, Normal adults can be caused diseased.Clinical symptoms are except fever, pharyngalgia and hand, foot, mouth skin and mucosa bleb caused by CV-A6 infects Outside Deng typical hand-foot-and-mouth disease symptom, it is more easy to the atypia hands such as atypia bleb, piptonychia disease, Herpangina and epididymitis occur Sufficient stomatosis symptom.The CV-A6 infection for showing recent prevalence in addition with report can cause serious central nervous system (CNS) Acute complications, such as aseptic meningitis and brainstem encephalitis.The detection of neutralizing antibody to CV-A6 epidemiological investigations with And vaccine research and development evaluation has very important significance.

Currently used goldstandard enterovirus neutralize antibody titers method is the cytopathy based on live virus (cytopathic effect, CPE) neutralization test [Chonmaitree T, Ford C, Sanders C, Lucia HL.Comparison of cell cultures for rapid isolation of enteroviruses.J Clin Microbiol.1988 Dec；26(12):2576-80.], i.e., by observing the cytopathy journey in neutralizing antibody and after virus It spends to judge the level of serum neutralizing antibody.This method reliable results, shortcoming are that antigen easily occurs in succeeding generations for live virus Drift, it is often more important that the dangerous property during test operation, therefore will for the operation and safety equipment of technical staff Ask higher.And it is cumbersome, observation cytopathy needs the time longer, and as a result interpretation is affected by subjective factor, and It can only obtain the testing result of sxemiquantitative.

The method that the present invention utilizes the pseudovirus system detectio neutralizing antibody of CV-A6 employs the cape horn fever of single cycle infection Malicious system, so safety problem when not using live virus.The pseudovirus detecting system is a kind of safety, sensitive, quickly, special It is different, the method for easy and low-cost detection neutralizing antibody.It is suitable for experiment that is quick, detecting to scale neutralizing antibody, it is right There is important application valency in the development of viral vaccine and detection individual patients and crowd's CV-A6 specificity neutralizing antibody levels Value.

The content of the invention：

One aspect of the present invention provides one kind for packing 6 type of Coxsackie virus A group (Coxsackievirus A6, CV- A6) recombinant expression plasmid of pseudovirus, the pseudovirus being assembled into and the kit thus prepared and using the plasmid, cape horn fever The recombinant expression plasmid of poison or kit detection CV-A6 neutralizing antibodies is named as pEGFP-CV-A6-capsid plasmids, The amino acid sequence of expression plasmid is for SEQ ID No.1 or in amino acid and/or the c-terminus addition of SEQ ID No.1 or missing What is obtained after several amino acid has the sequence of same or similar function with SEQ ID No.1.

PEGFP-CV-A6-capsid plasmids use Green fluorescent protein fusion vector, and this report gene nucleotide series are SEQID NO：DNA sequence dna shown in 2.The SEQ ID NO：2 the 1st to 717 encoding genes for green fluorescent protein； 718th to 732 recognition sites for the 2A protease of enterovirus；733rd to 3339 are all structure eggs of CV-A6 White encoding gene.

Another aspect of the present invention, provide it is a kind of build pEGFP-CV-A6capsid recombinant plasmids method, comprising with Lower step：1) gene order of green fluorescent protein and the gene order of CV-A6 structural proteins are spliced；2) and by 2A protease Restriction enzyme site insertion green fluorescence protein gene C-terminal；3) primer is designed；The primer sequence is：

IF-pcDNA6-GFP-F:

ACCCAAGCTGGCTAGCGCCACCATGGTGAGCAAGGGCG

IF-pcDNA6-CA6-VP1-R:

GGTGATGATGACCGGTTTAAGATGTTCTTTGTGGGCTTG

OL-GFP-AITTL-VP4-R:

CTTGGGCGCCAAGGGTAGTAATGGCCTTGTAC

OL-AITTL-CA6-VP4-F:

GGCCATTACTACCCTTGGCGCCCAAGTTTCAAC

In some preferred embodiments, the reporter gene is green fluorescence protein gene；

In other embodiments, the encoding gene of all structural proteins is following 1) -3) in any gene： 1) its nucleotides sequence is classified as in sequence table sequence the 733rd to shown in 3339；2) under strict conditions with 1) shown in gene Hybridize and encode the gene of the structural proteins；3) with gene 1) or 2) with described in more than 90% homology and coding The gene of structural proteins.

Another aspect of the present invention provides a kind of sub- plasmid of recombination expression for detecting CV-A6 neutralizing antibodies, recombination expression Sub- plasmid is named as pCV-A16-replicon, and the nucleotides sequence of expressor plasmid is classified as SEQ ID NO：3 or in SEQ ID NO：Add, lack or be mutated on 3 obtain after several amino acid with SEQ ID NO：3 have the sequence of same or similar function Row.

The reporter gene of the pCV-A16-replicon replicons is firefly luciferase reporter gene.The SEQ ID NO：3 the 1st to 745 5 ' the UTR nucleotide sequences for CV-A16；746th to 2395 are firefly luciferase The nucleotide sequence of gene；2396th to 2410 recognition sites for 2A protease；2411st to 6549 are CV- The encoding gene of A16 non-structural proteins.

Another aspect of the present invention provides a kind of method for building pCV-A16-replicon and recombinantly expressing sub- plasmid, It comprises the steps of：1) gene order of CV-A16 structural proteins is replaced with the gene order of firefly luciferase；It 2) and will The C-terminal of the restriction enzyme site insertion firefly luciferase gene of 2A protease；3) T7promoter sequences are introduced to 5 ' UTR Front end；4) primer is designed；The primer sequence is：

IF-NotI-T7-CA16-F:

TCAAGAATTGCGGCCGCGTAATACGACTCACTATAGGTTAAAACAG CCTGTGGGTTG

OL-CA16-5’UTR-luc-R:

CTTTATGTTTTTGGCGTCTTCCATTTCTTACAGTTAAGGAGCAATATA TAATTAAG

FL-luc-F：ATGGAAGACGCCAAAAAC

FL-luc-R：CAATTTGGACTTTCCGCC

OL-CA16-luc-KITTL-2A-F:

GGGCGGAAAGTCCAAATTGAAGATCACAACATTGGGAAAG

IF-SalI-EV-dT25-R:

CATGAGAATTGTCGACTTTTTTTTTTTTTTTTTTTTTTTTT

In some preferred embodiments, the reporter gene is firefly luciferase gene

In one aspect of the invention, said structure Protein reconstitution expression plasmid is provided or the kit thus prepared is being examined Survey the application of CV-A6 neutralizing antibodies.

Another aspect of the present invention provides a kind of restructuring pseudovirus, by pEGFP-CV-A6-capsid plasmid expressions The CV-A16 subgenomic RNAs that CV-A6 structural proteins and pCV-A16-replicon plasmids obtain under T7 polymerization enzyme effects exist Assemble in mammal passage cell；Preferably, the mammalian cell is 293T cells.The pseudovirus can be used for examining Survey CV-A6 specificity neutralizing antibodies.

The present invention provides a kind of kit of external, nondiagnostic detection CB-A6 neutralizing antibodies, which includes upper State pseudovirus.

In some embodiments, the restructuring pseudovirus be will be for packing the sub- matter of the recombination expression of CV-A6 pseudovirus It is packaged to be in grain pEGFP-CV-A6-capsid and the sub- plasmid pCV-A16-replicon cotransfections 293T cells of recombinant replication Recombinant virus.

The present invention provides a kind of method for detecting CV-A6 neutralizing antibodies, comprises the following steps：By the pseudovirus and series Diluted test antibodies sample (such as serum) mixing, obtains mixture；With mixture infection to the thin of CV-A6 sensitivities Whether born of the same parents are contained according in signal qualitative detection sample to be tested caused by the representation of reporter gene in the cell of the sensitivity CV-A6 specificity neutralizing antibody or the potency for quantitatively detecting CV-A6 specificity neutralizing antibodies in test antibodies sample.

The present invention is using the method for the pseudovirus system detectio neutralizing antibody of CV-A6 as a result of single cycle infection CV-A6 pseudovirus, there is no safety problems when using live virus.The neutralizing antibody content of sample then corresponds in neutralization test Into intracellular viral RNA subgenome (delete structural gene, and replace with the viral genome of luciferase gene) Expression obtains the amount of luciferase in the cell.Chemiluminescence reaction occurs for the substrate that luciferase is added in cell pyrolysis liquid Afterwards, the amount of luciferase can be by Chemiluminescence Apparatus accurate quantification.The logarithm of luciferase chemiluminescence reaction reading is in larger model In enclosing and remaining virus quantity has good linear relationship.Experiment process is easy to operate, of less demanding to technical staff.This method Large-scale screening test can be carried out into the cell in 96 holes.By multiple experiments, the result shows that stated in the invention Pseudovirus system is a kind of safety, sensitive, quickly, specifically, the method for easy and low-cost detection neutralizing antibody.Based on Upper feature, the pseudovirus system are suitable for quickly, detect the experiment of neutralizing antibody on a large scale, development for viral vaccine and Detection individual patients and crowd's hand-foot-and-mouth-disease specific neutralizing antibody level have important application value.

The method of the present invention has further the advantage that：

(1) it is easy to standardize：When packing pseudovirus, it is only necessary to the recombination expression sub- plasmid above-mentioned to 293T cell transfectings and The sub- plasmid of recombinant replication.The structural protein gene of virus is structured on plasmid, can steadily be stored at -20 DEG C.Therefore it is false The shortcomings that virus system can overcome live virus that antigenic drift easily occurs in succeeding generations.Therefore in being done using pseudovirus system With the detection of antibody, the stability of experiment is high, is easy to standardize.

(2) uniformity：The neutralizing antibody of one group of serum is parallelly detected with CV-A6 wild types live virus and pseudovirus.Than Compared with double-blind trial as a result, finding that correlation is very high.This illustrates work of the pseudovirus system when detecting virucidin with classics Virus neutralization tests has good uniformity.

(3) it is high-throughput：The neutralization test of pseudovirus can carry out in 96 porocyte culture plates, and the difference of each serum is dilute Multiple multiple holes can be done by releasing gradient, and difference between hole can be eliminated from the perspective of statistics.Pseudovirus is mixed with detection sample When 10-20 is small after conjunction object addition Tissue Culture Plate, you can lysate cell lysis will be used, and with the volley of rifle fire 10ul-30ul is taken to crack Sample is used for the reading of Chemiluminescence Apparatus.When obtaining data, it is only necessary to read luciferase chemistry hair automatically with Chemiluminescence Apparatus The reading of light reaction.

(4) single cycle infection：The packaging system of pseudovirion is made of two parts.Virus is constructed on one plasmid Structural protein gene constructs the RNA replicon of virus on another plasmid.The pseudovirus of CV-A6 will undress when entering cell Shell, and the replicon rna of virus is discharged into cell interior.5 ' ends of replicon are Internal ribosome entry site (IRES).Therefore, the luciferase after the element and nonstructural protein gene can directly be turned over by intracellular ribosomes It translates.Non-structural protein can help replicon to be replicated in the cell after being translated.Single stranded positive-sense RNA bases in pseudovirion Because the structural protein gene of group is deleted, and replaced by luciferase gene.Therefore, pseudovirus is in single invasion cell Afterwards, it is impossible to structural proteins are translated, so new infectious viral particle can not be assembled.Pseudovirus infection system eliminates After live virus infects for the first time, the problem of repetition into cell.When carrying out infection experiment in same cell line, pseudovirus is most The reading of luciferase chemiluminescence reaction obtained by whole infection cell is only subject to virion to be interfered when invading cell The influence of factor (such as neutralizing antibody).

(5) it is specific：Neutralization test, result of the test are done to CV-A6 pseudovirus with specific and nonspecific antiserum Showing the pseudovirus of CV-A6 can selectively be neutralized by the special neutralizing antibody of CV-A6, but can not be by non-CV-A6 Special antiserum neutralizes.So the pseudovirus of CV-A6 shows to detect the effect of specific neutralizing antibody well.

(6) it is highly sensitive：Pseudovirus system has very high sensitivity for detection neutralizing antibody, only needs a small amount of serum just Detectable special neutralizing antibody.

Description of the drawings：

Fig. 1 enteroviruses and single cycle infection pseudovirus schematic diagram

The CV-A6 pseudovirus system detectio neutralize antibody titers comparison diagrams of Fig. 2 wild type CV-A6 live viruses and the present invention

Fig. 3 CV-A6 pseudovirus system detectio neutralizing antibody Evaluation on specificity figures

Fig. 4 CV-A6 pseudovirus system linear scope tendency charts

Specific embodiment：

Experimental method used in following embodiments is conventional method unless otherwise specified.

The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.

RD cells (deriving from human rhabdomyosarcoma) (are purchased from ATCC, catalog number CCL-136^TM) and 293T cells (deriving from human embryonic kidney cell) (is purchased from ATCC, catalog number CRL-11268^TM) in 10%FBS, (hyclone is purchased from GIBCO, catalog number 10099-141) DMEM in cultivate.RD cells are thin for detecting the sensitivity of neutralizing antibody experiment Born of the same parents system.293T cells are used to the pseudovirus of packaging CV-A6.Full-length infectious cloned plasmids (the GenBank of CV-A6 No.KR706309), the full-length infectious cloned plasmids of CV-A16 are provided by Xiamen University Xia Ningshao professors laboratory, bibliography： Yang L,Li S,Liu Y,Hou W, Lin Q,Zhao H,Xu L,He D,Ye X,Zhu H,Cheng T,Xia N.Construction and characterization of an infectious clone of coxsackievirus A6that showed high virulence in neonatal mice.Virus Res.2015 Dec 2；210:165-8.

Embodiment one, the detection for detecting enterovirus CV-A6 neutralizing antibodies

1st, CV-A6 nucleocapsid proteins expression plasmid and CV-A16 replicon plasmids are built

(1) CV-A6 nucleocapsid protein expression plasmids are built

Using the full-length infectious cloned plasmids of CV-A6 as template, PCR amplification obtains the structural protein coding region section (bag of CV-A6 Containing VP4, VP2, VP3, VP1), and it is inserted into green fluorescent protein (EGFP) gene in Organization of viral genome albumen n end.It will The gene order of EGFP is spliced with the gene order of all structural proteins of CV-A6, and the restriction enzyme site of 2A protease is inserted into The C-terminal of EGFP gene, splicing obtain fusion (Figure 1B), and nucleotide sequence is as shown in SEQ ID No.2, wherein the 1st Position to 717 be green fluorescent protein encoding gene (amino acid sequence of green fluorescent protein is as shown in SEQ ID No.4)； 718th to 732 recognition sites for the 2A protease of enterovirus；733rd to 3339 are all structure eggs of CV-A6 White encoding gene, the protein of the amino acid sequence composition shown in coding SEQ ID No.1, i.e. all structure eggs of CV-A6 (VP4, VP2, VP3 and VPl of Figure 1A) in vain.Meanwhile by primer splicing obtain DNA fragmentation 5 ' end and 3 ' end draw respectively The sequence with the carrier end complementation of linearisation pCDNA6/HisA that is being generated after NheI/AgeI double digestions that is entering 15bp length. PCDNA6/HisA (is purchased from New England BioLabs with NheI；Catalog number is R0131) and AgeI (be purchased from New England BioLabs；Catalog number is R0552) digestion, then Insert Fragment is cloned into In-Fusion On the carrier (purchased from Takara, catalog number 638909) of pCDNA6/HisA, recombinant plasmid is obtained.

Recombinant plasmid verification method：1. choosing monoclonal, and bacterium is shaken, upgrading grain；2. with NheI and AgeI to recombinant plasmid into Row double digestion is identified；3. selecting restriction enzyme mapping, correctly clone send Invitrogen sequencing company to be sequenced.The restructuring that will be obtained Plasmid is named as pEGFP-CV-A6-capsid.It is as follows to build primer：

IF-pcDNA6-GFP-F:ACCCAAGCTGGCTAGCGCCACCATGGTGAGC AAGGGCG

IF-pcDNA6-CA6-VP1-R:

GGTGATGATGACCGGTTTAAGATGTTCTTTGTGGGCTTG

OL-GFP-AITTL-VP4-R:

CTTGGGCGCCAAGGGTAGTAATGGCCTTGTAC

OL-AITTL-CA6-VP4-F:

GGCCATTACTACCCTTGGCGCCCAAGTTTCAAC

(2) CV-A16 replicon plasmids are built

Using the full-length infectious cloned plasmids of CV-A16 as template, answering for the CV-A16 containing expressing luciferase gene is built System plasmid.Method is as follows：By the 5 ' UTR of CV-A16, the nonstructural protein gene of luciferase gene and CV-A16 genomes (P2 the and P3 areas for including CV-A16) and its sequence afterwards are spliced with overlapping PCR method, obtain fusion, nucleotide Sequence is as shown in SEQ ID No.3, wherein the 1st to 745 5 ' the UTR nucleotide sequences for CV-A16；746th is arrived 2395 nucleotide sequences for luciferase gene；2396th to 2410 recognition sites for 2A protease；2411st Position to 6549 be CV-A16 non-structural proteins encoding gene；It is introduced simultaneously before 5 ' UTR of obtained fusion The sequence (Figure 1B) of T7promoter.

The step of cloning CV-A16 replicons：1. PCR amplification is carried out by template of the full-length infectious cloned plasmids of CV-A16, Respectively obtain 5 ' UTR (UTR, the untraslated region of CV-A16；Noncoding region), nonstructural protein gene, 3 ' UTR； With pLuc (purchased from Agilent Technologies, catalog number 219087) for template amplification firefly Luciferase genes.2. the obtained segment of the first step is stitched together to obtain CV-A16-Fluc.3. by drawing by PCR Object splicing obtain CV-A16-Fluc DNA fragmentations 5 ' end and 3 ' end respectively introduce 15bp length with NotI (be purchased from New England BioLabs；Catalog number is R3189)/SalI (be purchased from New England BioLabs；Catalog number is Segment, is then inserted by the sequence of the carrier end complementation of the linearisation pSVA R3138) generated after double digestion with In-Fusion On the linearisation pSVA carriers generated after NotI/SalI double digestions, recombinant plasmid is obtained.Cloning identification method：1. picking Dan Ke It is grand, and bacterium is shaken, upgrading grain.2. gained recombinant plasmid is identified with digestion with NotI and SalI.3. it is correct to select restriction enzyme mapping Monoclonal is sequenced.Sequencing result shows to insert the DNA sequence dna shown in sequence table on pSVA carriers, illustrates recombinant plasmid structure It builds correctly, the recombinant plasmid of gained is named as pCV-A16-replicon.

It is as follows to build primer：

IF-NotI-T7-CA16-F:tcaagaattgcggccgcgTAATACGACTCACTATAGGtt aaaacagcctgtgggttg

OL-CA16-5’UTR-luc-R:CTTTATGTTTTTGGCGTCTTCCATTTCTTA CAGTTAAGGAGCAATATATAATTAAG

FL-luc-F：ATGGAAGACGCCAAAAAC

FL-luc-R：CAATTTGGACTTTCCGCC

OL-CA16-luc-KITTL-2A-F:GGGCGGAAAGTCCAAATTGAAGATC ACAACATTGGGAAAG

IF-SalI-EV-dT25-R:CATGAGAATTGTCGACTTTTTTTTTTTTTTTTT TTTTTTTT

2nd, the transfection of DNA and maternity leave virus

Before transfection, in the Tissue Culture Plate upper berth 293T cells of 10cm2, density is about 60-80%.With antibiotic-free 10%FBS-DMEM (purchased from Gico companies, catalog number C11965500BT) culture 293T cells, are usedTri- kinds of plasmid mixture pEGFP-CV- of (being purchased from Polyplus, catalog number 114-15) 10 μ g of transfection A6-capsid, pCV-A16 replicon, pcDNA3.0A-T7 polymerase (three kinds of plasmid isoconcentration mixing), at 37 DEG C Culture in cell incubator.In fluorescence microscopy Microscopic observation EGFP fluorescins so as to judging the expression water of structural proteins after for 24 hours It is flat.After 48h, 293T cells are resuspended with cell conditioned medium, are collected into 50ml centrifuge tubes, then with centrifuge 1500rpm Centrifugation 10 minutes；Supernatant is moved in new 50ml centrifuge tubes, remaining 2-3ml cell suspensions, and with liquid nitrogen fast freeze-thaw repeatedly Cell suspension is three times.By the precipitation mixing after the culture medium supernatant freeze thawing collected before, centrifuge is then used again 4000rpm is centrifuged 30 minutes, abandons precipitation, collects supernatant, and is dispensed into the EP pipes of 1.5ml, and it is spare to be stored in -80 DEG C of refrigerators.

3rd, the neutralization test of pseudovirus CV-A6

After the inactivation 30 minutes of 56 DEG C of test serum, (it is purchased from 96 porocyte culture platesCatalog number DMEM culture mediums are used from 1 to be 3599) middle:8 to 1:2048 carry out 2 times of gradient dilutions, and each gradient does 2 multiple holes, per 50 μ l of hole. Then, respectively with isometric CV-A6 pseudovirus (by above-mentioned pEGFP-CV-A6-capsid plasmids and pCV-A16- Replicon plasmids are under the action of the T7 polymerases obtained by cotransfection) mixing, be placed in 37 DEG C be incubated 2 it is small when.Then 100 μ are added in In the RD cells (5 × 104cells/well) of l, final volume is 200 μ l.Then, 96 orifice plates are transferred to 37 DEG C of CO2 cultures Be incubated in case, after incubation 16 it is small when after remove supernatant, per hole add in the 50 passive cell pyrolysis liquids of μ l (Promega) (be purchased from Promega, catalog number E1941) multigelation cell lysis twice, 30 μ l cell pyrolysis liquids are taken, with D- Luciferin (purchased from Becton Dickinson, catalog number 556678) is substrate, after setting program, is sent out with chemistry The reading of light instrument (purchased from Berthold, name of product is Centro LB960) detection chemiluminescence reaction.Then 50 μ are added L D- luciferase substrates, room temperature are protected from light 10min.It is detected by fluor tester and determines uciferase activity, by luminous intensity table Show.Cell controls, virus control, sample controls are set simultaneously in per plate.

4th, CV-A6 pseudovirus reporting system quantitatively detects CV-A6 neutralizing antibody titers in sample

Using the human serum (coming from National Institute for Food and Drugs Control) of potency known to portion as the product of referring to, with 10% FBS DMEM are from 1：10 are serially diluted to 20480 times for twice successively, neutralizing antibody detection are carried out to it with pseudovirus, to detect Fluorescent value logarithm (lg RLU) for ordinate, the logarithm of corresponding serum titer makees graph, linear regression for abscissa Applicable data is analyzed and there is higher accuracy.Therefore, the suitable range of linearity is chosen as working curve.Neutralizing antibody Potency is defined as：Sample to be tested is entered to the fluorescent value of the working curve range of linearity for the first time, brings gained working curve equation into, Value is calculated, and is multiplied by the extension rate of the point, is final serum neutralize antibody titers.

By test plasma with 10%FBS DMEM from 1：8 are serially diluted to 8192 times for twice successively, with pseudovirus to its into Row neutralizing antibody detects.Every block of plate is equipped with reference to sample wells, with the logarithm (lg RLU) of the fluorescent value detected for ordinate, phase The logarithm for the serum diluting multiple answered makees standard curve for abscissa.After bringing sample to be tested fluorescent value into working curve calculating, Determine the neutralize antibody titers of sample to be tested.The above method illustrate the pseudovirus system in detecting serum specificity in and , it can be achieved that quantitative detection during antibody.

The uniformity of embodiment two, the method and classical live virus neutralization test for examining the present invention

Parallelly in wild type CV-A6 live viruses and the CV-A6 pseudovirus of present invention detection lineup's plasma sample And antibody titer.The CV-A6 Strain of wild type is CV-A6-2014-XM, and calibrating sample source faces in three phase of EV-A71 vaccines Bed serum sample (comes from National Institute for Food and Drugs Control).Correlation analysis is done to two groups of testing results, as shown in Fig. 2, The result shows that the pseudovirus system of the present invention has well when detecting serum neutralizing antibody with classical live virus neutralization test Uniformity.

Embodiment three, the specificity for examining CV-A6 pseudovirus systems

In order to examine the specificity of CV-A6 pseudovirus systems, the anti-blood of specificity for CV-A6 in mouse source is used Clearly (come the serum for the SPF grade BALB/c mouse that the CV-A6 that uses by oneself (XM) inactivation of viruses was immunized), mouse source is directed to EV- The specific antisera of A71 (FY) is (come the blood for the SPF grade BALB/c mouses that the EV-A71 that uses by oneself (FY) inactivation of viruses was immunized Clearly), the specific antisera for CV-B3 (112) in mouse source (was immunized come the CV-B3 that uses by oneself (112) inactivation of viruses The serum of SPF grades of BALB/c mouses), the specific antisera for CV-A16 (G10) in mouse source is (come the CV-A16 that uses by oneself (G10) serum for the SPF grade BALB/c mouses that inactivation of viruses was immunized), the specificity for CV-B5 (417) in mouse source Antiserum (come the serum for the SPF grade BALB/c mouses that the CV-B5 that uses by oneself (417) inactivation of viruses was immunized) and the pin in mouse source To specific antisera (the SPF grades crossed come the Hepatitis E vaccine immunity for Wan Tai deep blue seas company production of using by oneself of Hepatitis E HEV The serum of BALB/c mouse) (obtained serum of taking a blood sample to the eye socket of SPF grades of BALB/c mouses, this is routine fashion；SPF grades BALB/c mouse is purchased from National Institute for Food and Drugs Control) neutralization test is done to CV-A6 pseudovirus.The results are shown in Figure 3.Meter The formula for calculating sero-fast opposite inhibition percentage is as follows：Test serum to the inhibiting rate (% inhibition) of pseudovirus= The chemistry of (chemiluminescence readings of the chemiluminescence readings of negative control sera group-test serum group)/negative control sera group Shine reading.The result shows that the pseudovirus of CV-A6 can be neutralized selectively by the special neutralizing antibody of CV-A6, but not It can be neutralized by other antiserums.Therefore, the pseudovirus of CV-A6 can specifically detect the neutralizing antibody for CV-A6.

Example IV, CV-A6 pseudovirus system linearity scopes

Pseudovirus stoste is serially diluted, infects RD cells, ordinate is the chemiluminescence reaction of fluorescin element Reading, that is, relative light unit (RLU, relative light unit) to numerical value.Linear regression analysis is carried out to data, is obtained One pseudovirus is serially diluted the tendency chart of infection, as shown in Fig. 4, the luciferase chemiluminescence read-out by Chemiluminescence Apparatus The range of linearity for reacting the logarithm (lg RLU) of reading is from 20 to 28.

Sequence table

<110>National Institute for Food and Drugs Control

<120>A kind of recombinant virus for detecting the method for 6 type neutralizing antibody of Coxsackie virus A group and its being applied

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 869

<212> PRT

<213> Coxsackievirus

<400> 1

Gly Ala Gln Val Ser Thr Gln Lys Ser Gly Ser His Glu Thr Arg Asn

1 5 10 15

Val Ala Thr Glu Gly Ser Thr Ile Asn Phe Thr Asn Ile Asn Tyr Tyr

20 25 30

Lys Asp Ser Tyr Ala Ala Ser Ala Ser Arg Gln Asp Phe Ala Gln Asp

35 40 45

Pro Ala Lys Phe Thr Arg Pro Val Leu Asp Thr Ile Arg Glu Val Ala

50 55 60

Ala Pro Leu Gln Ser Pro Ser Val Glu Ala Cys Gly Tyr Ser Asp Arg

65 70 75 80

Val Ala Gln Leu Thr Val Gly Asn Ser Thr Ile Thr Thr Gln Glu Ala

85 90 95

Ala Asn Ile Val Leu Ser Tyr Gly Glu Trp Pro Glu Tyr Cys Pro Ser

100 105 110

Thr Asp Ala Thr Ala Val Asp Lys Pro Thr Arg Pro Asp Val Ser Val

115 120 125

Asn Arg Phe Tyr Thr Leu Ser Thr Lys Ser Trp Lys Thr Glu Ser Thr

130 135 140

Gly Trp Tyr Trp Lys Phe Pro Asp Val Leu Asn Asp Thr Gly Val Phe

145 150 155 160

Gly Gln Asn Ala Gln Phe His Tyr Leu Tyr Arg Ser Gly Phe Cys Met

165 170 175

His Val Gln Cys Asn Ala Ser Lys Phe His Gln Gly Ala Leu Leu Val

180 185 190

Ala Ala Ile Pro Glu Phe Val Ile Ala Ala Ser Ser Pro Ala Thr Lys

195 200 205

Pro Asn Gly Arg Gly Leu Tyr Pro Asp Phe Ala His Thr Asn Pro Gly

210 215 220

Lys Asp Gly Gln Glu Phe Arg Asp Pro Tyr Val Leu Asp Ala Gly Ile

225 230 235 240

Pro Leu Ser Gln Ala Leu Val Phe Pro His Gln Trp Ile Asn Leu Arg

245 250 255

Thr Asn Asn Cys Ala Thr Ile Ile Met Pro Tyr Val Asn Ala Leu Pro

260 265 270

Phe Asp Ser Ala Leu Asn His Ser Asn Phe Gly Leu Val Val Ile Pro

275 280 285

Ile Ser Pro Leu Lys Tyr Cys Asn Gly Ala Thr Thr Glu Val Pro Val

290 295 300

Thr Leu Thr Ile Ala Pro Leu Asn Ser Glu Phe Ser Gly Leu Arg Gln

305 310 315 320

Ala Ile Lys Gln Gly Phe Pro Thr Glu Leu Lys Pro Gly Thr Asn Gln

325 330 335

Phe Leu Thr Thr Asp Asp Gly Thr Ser Pro Pro Ile Leu Pro Gly Phe

340 345 350

Glu Pro Thr Pro Leu Ile His Ile Pro Gly Glu Phe Thr Ser Leu Leu

355 360 365

Asp Leu Cys Gln Ile Glu Thr Ile Leu Glu Val Asn Asn Thr Thr Gly

370 375 380

Thr Ile Gly Val Ser Arg Leu Leu Ile Pro Val Arg Ala Gln Asn Asn

385 390 395 400

Val Asp Gln Leu Cys Ala Ser Phe Gln Val Asp Pro Gly Arg Asn Gly

405 410 415

Pro Trp Gln Ser Thr Met Val Gly Gln Ile Cys Arg Tyr Tyr Thr Gln

420 425 430

Trp Ser Gly Ser Leu Lys Val Thr Phe Met Phe Thr Gly Ser Phe Met

435 440 445

Ala Thr Gly Lys Met Leu Ile Ala Tyr Thr Pro Pro Gly Ser Ala Gln

450 455 460

Pro Ala Thr Arg Glu Ala Ala Met Leu Gly Thr His Ile Val Trp Asp

465 470 475 480

Phe Gly Leu Gln Ser Ser Val Thr Leu Val Ile Pro Trp Ile Ser Asn

485 490 495

Thr His Phe Arg Ala Val Lys Ile Gly Gly Val Tyr Asp Tyr Tyr Ala

500 505 510

Thr Gly Ile Val Thr Ile Trp Tyr Gln Thr Asn Phe Val Val Pro Pro

515 520 525

Asp Thr Pro Thr Glu Ala Asn Ile Ile Ala Leu Gly Ala Ala Gln Lys

530 535 540

Asn Phe Thr Leu Lys Leu Cys Lys Asp Thr Asp Glu Ile Gln Gln Thr

545 550 555 560

Ala Ala Tyr Gln Asn Asp Pro Ile Ala Asn Ala Val Glu Ser Ala Val

565 570 575

Ser Ala Leu Ala Asp Thr Thr Ile Ser Arg Val Thr Ala Ala Asn Thr

580 585 590

Thr Ala Ser Thr His Ser Leu Gly Thr Gly Arg Val Pro Ala Leu Gln

595 600 605

Ala Ala Glu Thr Gly Ala Ser Ser Asn Ala Ser Asp Glu Asn Leu Val

610 615 620

Glu Thr Arg Cys Val Met Asn Arg Asn Gly Val Asn Glu Ala Ser Val

625 630 635 640

Glu His Phe Tyr Ser Arg Ala Gly Leu Val Gly Val Val Glu Val Lys

645 650 655

Asp Ser Gly Thr Ser Leu Asp Gly Tyr Thr Val Trp Pro Ile Asp Val

660 665 670

Met Gly Phe Val Gln Gln Arg Arg Lys Leu Glu Leu Ser Thr Tyr Met

675 680 685

Arg Phe Asp Ala Glu Phe Thr Phe Val Ser Asn Leu Ser Asn Ser Thr

690 695 700

Thr Pro Gly Met Leu Leu Gln Tyr Met Tyr Val Pro Pro Gly Ala Pro

705 710 715 720

Lys Pro Asp Gly Arg Lys Ser Tyr Gln Trp Gln Thr Ala Thr Asn Pro

725 730 735

Ser Val Phe Ala Lys Leu Ser Asp Pro Pro Pro Gln Val Ser Val Pro

740 745 750

Phe Met Ser Pro Ala Thr Ala Tyr Gln Trp Phe Tyr Asp Gly Tyr Pro

755 760 765

Thr Phe Gly Glu His Lys Gln Ala Thr Asn Leu Gln Tyr Gly Gln Cys

770 775 780

Pro Asn Asn Met Met Gly His Phe Ala Ile Arg Thr Val Ser Glu Ser

785 790 795 800

Thr Thr Gly Lys Asn Val His Val Arg Val Tyr Met Arg Ile Lys His

805 810 815

Val Arg Ala Trp Val Pro Arg Pro Leu Arg Ser Gln Ala Tyr Met Val

820 825 830

Lys Asn Tyr Pro Thr Tyr Ser Gln Thr Ile Thr Asn Thr Ala Thr Asp

835 840 845

Arg Ala Ser Ile Thr Thr Thr Asp Tyr Glu Gly Gly Val Pro Ala Ser

850 855 860

Pro Gln Arg Thr Ser

865

<210> 2

<211> 3339

<212> DNA

<213> Coxsackievirus

<400> 2

atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60

ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120

ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180

ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240

cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300

ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360

gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420

aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480

ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540

gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600

tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660

ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaaggcc 720

attactaccc ttggcgccca agtttcaaca caaaaatctg ggtcgcacga gacaaggaat 780

gtagcaactg aagggtctac catcaacttc accaatatca attactacaa ggattcttat 840

gcagcgtcgg ctagtagaca ggactttgca caagatcctg caaagttcac acgtcctgtc 900

ttggatacca tcagggaagt tgccgctccg ttacaatccc cctctgttga ggcgtgcggg 960

tatagtgacc gagtcgcaca gttgaccgtg ggtaactcaa ccatcaccac ccaagaagca 1020

gctaatattg tgttgagcta tggagagtgg ccagaatact gtccttctac ggatgctaca 1080

gctgtggata agcctacccg ccctgacgta tcagtgaaca ggttctacac actgtcaact 1140

aagagctgga agacggagtc tactggctgg tactggaagt tccctgatgt gttaaatgac 1200

acaggagttt ttggccaaaa tgcccaattt cactacctgt accgctcggg tttctgcatg 1260

cacgttcaat gtaatgcaag caaattccat cagggggccc tcttagtagc cgcaatcccc 1320

gaatttgtga ttgctgcaag cagccctgct acgaagccta acgggcgagg attgtaccca 1380

gactttgccc atactaaccc aggtaaggat ggtcaagagt ttcgggatcc ttatgtcttg 1440

gacgctggaa tccccctaag tcaagcactg gttttccccc accaatggat caacctacga 1500

acaaacaact gtgcaaccat tattatgcca tatgttaacg cgcttccatt tgactcagcg 1560

cttaaccact cgaattttgg attagttgtg atccctatta gtcctttaaa atattgtaat 1620

ggagccacca cagaggtgcc agttacacta accatagccc cacttaattc agagttcagc 1680

ggcctccgac aagcaataaa acaagggttt cccacagagc tcaagcctgg gaccaatcag 1740

tttcttacaa ctgatgacgg gacatccccg ccaatactac ctggttttga accgactcca 1800

ttgatccata ttcctggaga gttcacctcc ttgttagatt tgtgtcaaat agagaccata 1860

ctagaagtta ataatactac cggcaccatt ggggtaagca gattgctaat tcctgttcga 1920

gcgcagaata atgtggacca gttatgtgcc tcgttccaag tagatcctgg acgcaatggc 1980

ccatggcaat ccacaatggt tggtcagatc tgtaggtatt acactcaatg gtctggttct 2040

ctcaaggtaa ccttcatgtt tacaggttct ttcatggcta cagggaaaat gctaatagcc 2100

tacacaccac ccggtagtgc tcagcccgct acaagggaag cagcgatgct tgggacgcac 2160

atagtgtggg attttggttt gcaatcatct gtcactttag tcataccctg gattagtaac 2220

acccatttta gagcggttaa gattggaggg gtatacgact actacgcgac tgggatcgtc 2280

accatttggt accagaccaa cttcgtagta ccaccagata cccccaccga ggctaacatc 2340

atagctcttg gagcagcaca aaagaacttt accctaaagt tgtgcaagga cactgatgaa 2400

atccaacaaa cagccgcata ccaaaatgat cctatcgcaa atgcggtaga aagtgctgta 2460

agcgcactcg ctgacaccac aatatcccga gtgaccgcag ccaacactac agctagcact 2520

cactccctgg gtacggggcg tgtaccagca ttgcaagccg cagaaacggg agcaagttct 2580

aatgctagtg acgaaaacct tgttgagact cgttgtgtga tgaatcgaaa cggggtcaat 2640

gaggcgagtg tggaacactt ttactcccgt gcagggctgg taggagttgt agaggtgaag 2700

gactcgggca ctagcctaga tggatataca gtgtggccca tagacgtgat gggttttgtg 2760

caacaacggc gcaaactgga gctatcgaca tacatgcgct ttgatgccga gttcactttt 2820

gtatccaacc tcagtaacag cacgacgccc ggaatgctgt tgcagtatat gtatgtgcca 2880

ccaggggccc ctaaaccgga tggtaggaag tcataccaat ggcagaccgc caccaacccg 2940

tcggtatttg caaaattgag tgatccaccc ccccaggtgt ctgtcccatt catgtctcca 3000

gcaacagctt atcagtggtt ctatgatggt taccctacat tcggtgagca caaacaagcc 3060

actaatttac aatatgggca gtgccctaac aacatgatgg gccattttgc catccgaaca 3120

gtcagtgagt ctactactgg gaagaacgtc catgttcggg tgtatatgag aattaaacat 3180

gtgagagctt gggtgcctag gcccctccga tcacaagctt acatggtcaa gaattatcca 3240

acatacagcc aaacaataac taatactgca actgaccgtg caagcataac taccacagac 3300

tatgaaggtg gggtaccagc aagcccacaa agaacatct 3339

<210> 3

<211> 6549

<212> DNA

<213> Coxsackievirus

<400> 3

ttaaaacagc ctgtgggttg ttcccaccca cagggcccac tgggcgctag cacactgatt 60

ctgcgggatc tttgtgcgcc tgttttataa ccccttccct aagcagtaac ttagaagctt 120

tatacactca cgaccaatag taggcgtggc gcgccagtca cgtcttggtc aagcacttct 180

gttcccccgg actgagtacc aatagactgc tcacgcggtt gaaggggaaa acgttcgtta 240

tccggctaac tacttcgaga aacctagtag caccgtgaaa gttgcggagt gtttcgctca 300

gcacttcccc cgtgtagatc aggtcgatga gtcactgtaa accccacggg cgaccgtgac 360

agtggctgcg ttggcggcct gcccatgggg taacccatgg gacgctctaa tacagacatg 420

gtgtgaagag tctattgagc tagttagtag tcctccggcc cctgaatgcg gctaatccta 480

actgcggagc acgcaccctc aacccagggg gtggcgtgtc gtaatgggta actctgcagc 540

ggaaccgact actttgggtg tccgtgtttc cttttattcc ttactggctg cttatggtga 600

caattgaaaa gttgttacca tatagctatt ggattggcca tccggtgtct aacagagcta 660

ttgtttacct atttattgga tacgtccctc ttaatctcaa ggccattcaa actcttaatt 720

atatattgct ccttaactgt aagaaatgga agacgccaaa aacataaaga aaggcccggc 780

gccattctat cctctagagg atggaaccgc tggagagcaa ctgcataagg ctatgaagag 840

atacgccctg gttcctggaa caattgcttt tacagatgca catatcgagg tgaacatcac 900

gtacgcggaa tacttcgaaa tgtccgttcg gttggcagaa gctatgaaac gatatgggct 960

gaatacaaat cacagaatcg tcgtatgcag tgaaaactct cttcaattct ttatgccggt 1020

gttgggcgcg ttatttatcg gagttgcagt tgcgcccgcg aacgacattt ataatgaacg 1080

tgaattgctc aacagtatga acatttcgca gcctaccgta gtgtttgttt ccaaaaaggg 1140

gttgcaaaaa attttgaacg tgcaaaaaaa attaccaata atccagaaaa ttattatcat 1200

ggattctaaa acggattacc agggatttca gtcgatgtac acgttcgtca catctcatct 1260

acctcccggt tttaatgaat acgattttgt accagagtcc tttgatcgtg acaaaacaat 1320

tgcactgata atgaattcct ctggatctac tgggttacct aagggtgtgg cccttccgca 1380

tagaactgcc tgcgtcagat tctcgcatgc cagagatcct atttttggca atcaaatcat 1440

tccggatact gcgattttaa gtgttgttcc attccatcac ggttttggaa tgtttactac 1500

actcggatat ttgatatgtg gatttcgagt cgtcttaatg tatagatttg aagaagagct 1560

gtttttacga tcccttcagg attacaaaat tcaaagtgcg ttgctagtac caaccctatt 1620

ttcattcttc gccaaaagca ctctgattga caaatacgat ttatctaatt tacacgaaat 1680

tgcttctggg ggcgcacctc tttcgaaaga agtcggggaa gcggttgcaa aacgcttcca 1740

tcttccaggg atacgacaag gatatgggct cactgagact acatcagcta ttctgattac 1800

acccgagggg gatgataaac cgggcgcggt cggtaaagtt gttccatttt ttgaagcgaa 1860

ggttgtggat ctggataccg ggaaaacgct gggcgttaat cagagaggcg aattatgtgt 1920

cagaggacct atgattatgt ccggttatgt aaacaatccg gaagcgacca acgccttgat 1980

tgacaaggat ggatggctac attctggaga catagcttac tgggacgaag acgaacactt 2040

cttcatagtt gaccgcttga agtctttaat taaatacaaa ggatatcagg tggcccccgc 2100

tgaattggaa tcgatattgt tacaacaccc caacatcttc gacgcgggcg tggcaggtct 2160

tcccgacgat gacgccggtg aacttcccgc cgccgttgtt gttttggagc acggaaagac 2220

gatgacggaa aaagagatcg tggattacgt cgccagtcaa gtaacaaccg cgaaaaagtt 2280

gcgcggagga gttgtgtttg tggacgaagt accgaaaggt cttaccggaa aactcgacgc 2340

aagaaaaatc agagagatcc tcataaaggc caagaagggc ggaaagtcca aattgaagat 2400

cacaacattg ggaaagtttg ggcagcaatc aggtgccata tatgtgggca actatagggt 2460

agtgaatcgg caccttgcca cacacaacga ctgggcaaat cttgtgtggg aggacagctc 2520

tagggacctg ttagtctctt ccaccaccgc ccaggggtgc gacactatcg ctagatgcaa 2580

ttgtcaaacc ggagtatact attgcagctc caaaaggaaa cactacccgg ttagtttcac 2640

caagcccagc ctgatatttg tcgaagctag tgagtattac ccagctagat accaatccca 2700

tctcatgctt gctgtgggtc actcggaacc tggtgactgt ggtggcatcc ttagatgcca 2760

acacggtgta gtaggaattg tctccactgg tggaaatggt ctcgtggggt ttgctgatgt 2820

cagagatctt ctatggctgg atgaagaagc aatggaacaa ggagtatctg actacatcaa 2880

aggcctcggt gatgcttttg gtgtgggttt cactgatgca gtgtccaggg aagtagaagc 2940

attgaagaac catttaattg gctcggaagg agctgttgag aagatcttga agaatttggt 3000

gaagctaatc tcagctttag tcatagtcgt tagaagtgac tatgacatgg tcaccctcac 3060

agctacgctt gccttgattg ggtgtcatgg aagcccttgg gcatggatca aagcgaagac 3120

agcctctatt cttggcattc ccatagtgca aaaacagagc gcttcatggc taaagaagtt 3180

taatgatatg gctaacgctg caaaagggct tgagtggatt tctagcaaaa tcagcaagtt 3240

cattgattgg cttaaggaaa aaattattcc ggccgctaag gagaaagttg aattcttaaa 3300

caacctgaag cagcttccct tgttggagaa ccaaatctca aatcttgaac agtctgctgc 3360

ctcgcaagag gatttagaag ctatgtttgg taatgtgtca tatttagccc acttctgccg 3420

caagtttcag ccactctacg cgactgaagc caaaagagtc tatgccctag agaaaaggat 3480

gaacaactac atgcagttca agagcaaaca ccgtattgaa cccgtatgtt tgatcattag 3540

aggctctcca ggaacaggca agtcacttgc tacgggcatc atagctagag ctattgctga 3600

caaataccat tctagcgttt actcactccc tccagaccca gaccattttg atggatacaa 3660

gcaacaagta gttactgtta tggatgatct ctgtcaaaac ccagatggaa aggacatgtc 3720

tctattttgt caaatggttt ctacagtgga ttttatacca cccatggcat cattggaaga 3780

gaaaggagtg tctttcacct ctaagttcgt cattgcatca accaatgcta gtaacatcgt 3840

agtccctaca gtttcagatt cagatgcgat tcgcaggcgg ttttatatgg actgcgatat 3900

agaggtgacg gactcctata agacggacct cggccgactc gacgcaggta gggccgctaa 3960

gctttgcaca gaaaataaca ccgctaactt caagagatgc agcccactag tgtgtggcaa 4020

agctattcaa ctaagagaca ggaagtctaa agtgagatat agtattgaca ctgtagtgtc 4080

agagctaatc agagaatata ataataggtc cgccattggg aataccatag aagccctctt 4140

ccaaggaccc cttaagttca agcctataag aattagcctt gaagaaaagc cagccccaga 4200

tgccatcagc gacctacttg ctagtgtaga tagcgaggag gttcgacaat actgcaggga 4260

acaggggtgg ataattccag aaacaccgac caatgtggaa cgtcacctca acagagcagt 4320

gttggtgatg cagtccatcg ccaccgtggt tgcagtcgtg tctcttgtct atgtcattta 4380

taaattgttt gctgggtttc agggtgctta ttctggagcg cctaagcaag ctctaaaaaa 4440

acccgtacta agaacagcca cagttcaagg accgagctta gactttgcct tatccctcct 4500

aaggcgcaac attagacagg tgcaaaccga ccaaggacac ttcactatgt taggggtgcg 4560

agatcgccta gccattttgc cacgccactc gcaaccagga aaaactatct gggtggagca 4620

caagttaatt aatgtgctgg atgctgtcga attagtggat gagcaaggtg taaacttgga 4680

actcacacta gtaaccttag acaccaacga aaagtttagg gatgttacca agtttattcc 4740

agagacgatc accggggcaa gcgacgcaac cttggtcatc aacactgagc acatgccctc 4800

aatgttcgtt ccagtgggtg atgttgtaca atatggattt ctgaatctca gcggtaagcc 4860

cacacaccga accatgatgt acaatttccc cacaaaggca ggacagtgtg gaggggtggt 4920

cacctcagtc ggtaagatca taggaattca cattggtggg aatggacgcc agggtttctg 4980

cgctggactg aagagaggct attttgccag tgaacaggga gagatccaat ggatgaagcc 5040

caataaagag actgggagac tgaacattaa tggcccaacc cgcaccaaac tggagcccag 5100

tgtgttccat gatgtgtttg agggcaacaa ggaaccagca gtcttaacca gtaaggatcc 5160

cagactcgag gttgattttg agcaagcttt gttttccaag tatgtgggaa acaccctgca 5220

cgagcctgac gagtacgtga cacaggctgc tctccactat gcaaatcagc taaagcaatt 5280

agacataaac attaataaga tgagcatgga agaagcatgt tatggcactg aatacctgga 5340

ggccatagac ctgcacacta gcgccgggta cccctatagt gccttgggtg ttaagaaaag 5400

agacatactt gacccaatca ctagagatac taccaaaatg aaattctaca tggataaata 5460

tgggttagac ttgccctatt ccacttatgt gaaggatgag cttagatcct tagacaagat 5520

taagaaaggg aaatcccgtt tgattgaagc cagtagcctg aatgactcag tctaccttag 5580

gatgactttt gggcatctct atgaaacttt ccatgccaac ccggggactg tgaccgggtc 5640

tgcagtaggg tgcaatcctg atgtgttctg gagtaaacta ccaatcctgc tgccaggatc 5700

gctctttgca tttgattatt cagggtacga tgcaagtctc agcccagtgt ggtttagagc 5760

tttagaggtg gttctccgag agatcggcta ctcagaggag gctgtgtcat taatagaagg 5820

gatcaaccac acccatcatg tgtatcggaa caagacatat tgtgtcctcg gtggaatgcc 5880

ctcaggctgt tccggcactt ccatcttcaa ttccatgatc aataacataa taatcagaac 5940

tctcttgatt aaaactttta aggggatcga tttagatgag ttaaatatgg tagcttatgg 6000

agatgatgtg ttagctagct acccgttccc tattgactgc tcggagttag ccaaaactgg 6060

taaagagtat ggactgacaa tgacacccgc tgacaagtca ccctgcttta atgaagttac 6120

ctgggaaaat gccacattct taaagagagg cttcctgcca gatcaccaat tcccgttcct 6180

tatccaccct accatgccca tgagggagat ccatgagtcc attcgttgga ctaaagacgc 6240

acgcaacact caggatcacg tgcgctcttt gtgcctctta gcatggcata atgggaagga 6300

ggaatatgaa aaatttgtga gtacaattag atcagttcct attggaaaag ccttggctat 6360

accaaatttc gagaacttga gaaggaattg gctcgaatta ttttaatata cagtttaaag 6420

ctgaacccca ccagaaatct ggtcgtgtta atgactggtg ggggtaaatt tgttataacc 6480

agaatagcaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 6540

aaaaaaaaa 6549

<210> 4

<211> 239

<212> PRT

<213> Coxsackievirus

<400> 4

Met Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu

1 5 10 15

Val Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly

20 25 30

Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile

35 40 45

Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr

50 55 60

Leu Thr Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys

65 70 75 80

Gln His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu

85 90 95

Arg Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu

100 105 110

Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly

115 120 125

Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr

130 135 140

Asn Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn

145 150 155 160

Gly Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly Ser

165 170 175

Val Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly

180 185 190

Pro Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu

195 200 205

Ser Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe

210 215 220

Val Thr Ala Ala Gly Ile Thr Leu Gly Met Asp Glu Leu Tyr Lys

225 230 235

<210> 5

<211> 38

<212> DNA

<213> Coxsackievirus

<400> 5

acccaagctg gctagcgcca ccatggtgag caagggcg 38

<210> 6

<211> 39

<212> DNA

<213> Coxsackievirus

<400> 6

ggtgatgatg accggtttaa gatgttcttt gtgggcttg 39

<210> 7

<211> 32

<212> DNA

<213> Coxsackievirus

<400> 7

cttgggcgcc aagggtagta atggccttgt ac 32

<210> 8

<211> 33

<212> DNA

<213> Coxsackievirus

<400> 8

ggccattact acccttggcg cccaagtttc aac 33

<210> 9

<211> 57

<212> DNA

<213> Coxsackievirus

<400> 9

tcaagaattg cggccgcgta atacgactca ctataggtta aaacagcctg tgggttg 57

<210> 10

<211> 56

<212> DNA

<213> Coxsackievirus

<400> 10

ctttatgttt ttggcgtctt ccatttctta cagttaagga gcaatatata attaag 56

<210> 11

<211> 18

<212> DNA

<213> Coxsackievirus

<400> 11

atggaagacg ccaaaaac 18

<210> 12

<211> 18

<212> DNA

<213> Coxsackievirus

<400> 12

caatttggac tttccgcc 18

<210> 13

<211> 40

<212> DNA

<213> Coxsackievirus

<400> 13

gggcggaaag tccaaattga agatcacaac attgggaaag 40

<210> 14

<211> 41

<212> DNA

<213> Coxsackievirus

<400> 14

catgagaatt gtcgactttt tttttttttt tttttttttt t 41

Claims (7)

1. for packing 6 type of the Coxsackie virus A group restructuring sub- plasmid of recombination expression of pseudovirus and the sub- plasmid of recombinant replication.It is special Sign is：The sub- plasmid of recombination expression is named as pEGFP-CV-A6-capsid, and the amino acid sequence of expression plasmid is SEQ ID No.1 or SEQ ID No.1 amino acid and/or c-terminus addition or lack obtain after several amino acid with SEQ ID No.1 has the sequence of same or similar function；The sub- plasmid of recombinant replication is named as pCV-A16-replicon, replicon The nucleotides sequence of plasmid is classified as SEQ ID NO：3 or in SEQ ID NO：It is obtained after several amino acid are added, lacked or be mutated on 3 Arrive with SEQ ID NO：3 have the sequence of same or similar function.

2. recombinant plasmid according to claim 1, which is characterized in that the sub- plasmid pEGFP-CV-A6- of recombination expression Capsid uses Green fluorescent protein fusion vector, and amino acid sequence is SEQ ID NO：Amino acid sequence shown in 4；It is described heavy The reporter gene of group replicon plasmid pCV-A16-replicon is firefly luciferase reporter gene.

3. recombinant plasmid according to claim 1, which is characterized in that the sub- plasmid pEGFP-CV-A6- of recombination expression capsid SEQ ID NO：2 the 1st to 717 encoding genes for green fluorescent protein；718th to 732 are enteron aisle disease The recognition site of the 2A protease of poison；733rd to 3339 encoding genes for all structural proteins of CV-A6；The restructuring Replicon plasmid pCV-A16-replicon SEQ ID NO：3 the 1st to 745 5 ' the UTR nucleotide sequences for CV-A16； 746th to 2395 nucleotide sequences for firefly luciferase gene；2396th to 2410 are 2A protease Recognition site；2411st to 6549 encoding genes for CV-A16 non-structural proteins.

A kind of 4. construction method for expressing recombinant plasmid described in claim 1, which is characterized in that the sub- plasmid of recombination expression PEGFP-CV-A6-capsid is comprised the steps of：1) by the gene order of green fluorescent protein and all structural proteins of CV-A6 Gene order splicing；2) and by the restriction enzyme site of 2A protease it is inserted into the C-terminal of green fluorescence protein gene；3) design is drawn Object；The primer sequence is：

IF-pcDNA6-GFP-F:

ACCCAAGCTGGCTAGCGCCACCATGGTGAGCAAGGGCG

IF-pcDNA6-CA6-VP1-R:

GGTGATGATGACCGGTTTAAGATGTTCTTTGTGGGCTTG

OL-GFP-AITTL-VP4-R:

CTTGGGCGCCAAGGGTAGTAATGGCCTTGTAC

OL-AITTL-CA6-VP4-F:

GGCCATTACTACCCTTGGCGCCCAAGTTTCAAC

The sub- plasmid pCV-A16-replicon of recombinant replication is comprised the steps of：1) the gene sequence of firefly luciferase is used Row replace the gene order of all structural proteins of CV-A16；2) and by the restriction enzyme site of 2A protease it is inserted into firefly luciferase The C-terminal of gene；3) T7promoter sequences are introduced to 5 ' UTR front ends；4) primer is designed；The primer sequence is：

IF-NotI-T7-CA16-F:

TCAAGAATTGCGGCCGCGTAATACGACTCACTATAGGTTAAAACAGCCTGTGGGTTG

OL-CA16-5’UTR-luc-R:

CTTTATGTTTTTGGCGTCTTCCATTTCTTACAGTTAAGGAGCAATATATAATTAAG

FL-luc-F：ATGGAAGACGCCAAAAAC

FL-luc-R：CAATTTGGACTTTCCGCC

OL-CA16-luc-KITTL-2A-F:

GGGCGGAAAGTCCAAATTGAAGATCACAACATTGGGAAAG

IF-SalI-EV-dT25-R:

CATGAGAATTGTCGACTTTTTTTTTTTTTTTTTTTTTTTTT

5. recombinant plasmid described in claim 1 or the restructuring pseudovirus thus prepared detect 6 type of Coxsackie virus A group in vitro The application of neutralizing antibody.

6. a kind of pseudovirus, which is characterized in that by the sub- plasmid pEGFP-CV-A6-capsid of recombination expression described in claim 1 The 6 type structural proteins of Coxsackie virus A group of expression and the sub- plasmid pCV-A16-replicon of recombinant replication described in claim 1 The coxsackievirus A16 subgenomic RNA obtained under T7 polymerization enzyme effects assembles.

7. a kind of detection method for detecting 6 type neutralizing antibody of Coxsackie virus A group, which is characterized in that comprise the steps of：

1) pseudovirus will be recombinated described in right 6 to mix with the sample to be tested being serially diluted, obtain mixture；

2) cell of 6 type sensitivity of Coxsackie virus A group is infected with the mixture, according to the table of reporter gene in sensitive cell The potency of 6 type specificity neutralizing antibody of Coxsackie virus A group in sample to be tested is qualitatively or quantitatively detected up to signal caused by object.