CN113817753B - Expression of SARS-CoV-2 fiber protein or its variant S Δ21 Construction and use of pseudotyped VSV viruses - Google Patents

Expression of SARS-CoV-2 fiber protein or its variant S Δ21 Construction and use of pseudotyped VSV viruses Download PDF

Info

Publication number
CN113817753B
CN113817753B CN202111044750.5A CN202111044750A CN113817753B CN 113817753 B CN113817753 B CN 113817753B CN 202111044750 A CN202111044750 A CN 202111044750A CN 113817753 B CN113817753 B CN 113817753B
Authority
CN
China
Prior art keywords
protein
vsv
virus
cov
sars
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202111044750.5A
Other languages
Chinese (zh)
Other versions
CN113817753A (en
Inventor
孙涛
张宝红
柯勇
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanghai Jiaotong University
Original Assignee
Shanghai Jiaotong University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Jiaotong University filed Critical Shanghai Jiaotong University
Priority to CN202111044750.5A priority Critical patent/CN113817753B/en
Publication of CN113817753A publication Critical patent/CN113817753A/en
Application granted granted Critical
Publication of CN113817753B publication Critical patent/CN113817753B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6854—Immunoglobulins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/20011—Rhabdoviridae
    • C12N2760/20211—Vesiculovirus, e.g. vesicular stomatitis Indiana virus
    • C12N2760/20221—Viruses as such, e.g. new isolates, mutants or their genomic sequences
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/20011—Rhabdoviridae
    • C12N2760/20211—Vesiculovirus, e.g. vesicular stomatitis Indiana virus
    • C12N2760/20234—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/20011—Rhabdoviridae
    • C12N2760/20211—Vesiculovirus, e.g. vesicular stomatitis Indiana virus
    • C12N2760/20241—Use of virus, viral particle or viral elements as a vector
    • C12N2760/20243—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/20011—Coronaviridae
    • C12N2770/20022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/20011—Coronaviridae
    • C12N2770/20034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Virology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Public Health (AREA)
  • Biophysics (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Mycology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Cell Biology (AREA)
  • Plant Pathology (AREA)
  • Epidemiology (AREA)
  • Food Science & Technology (AREA)
  • Analytical Chemistry (AREA)

Abstract

The present invention provides a method for expressing SARS-CoV-2 fiber protein or its variant S Δ21 Is constructed and applied by the pseudo VSV virus; the construction comprises the following steps: knocking out the G protein gene of VSV responsible for recognizing host cell receptor, and constructing pseudotyped VSV virus by S protein of SARS-CoV-2 or S delta 21 protein of variant thereof; sΔ21 is an S protein variant with a deletion of 21 amino acids in the intracellular region. The recombinant VSV virus constructed by the invention is an S protein variant obtained by corresponding deletion of S protein and S protein carboxyl terminal of SARS-CoV-2 virus, thus the recombinant VSV virus is not related to the live virus and will not generate biosafety problem; in the invention, besides constructing the VSV with wild type M protein as a framework, a brand new thought is provided, namely, the recombinant VSV virus constructed by using the M protein can be used for developing vaccines and detecting SARS-CoV-2 virus specific neutralizing antibodies in human and animal bodies.

Description

Expression of SARS-CoV-2 fiber protein or its variant S Δ21 Construction and use of pseudotyped VSV viruses
Technical Field
The invention relates to the technical field of novel coronavirus research, and relates to a pseudotyped VSV virus for expressing SARS-CoV-2 fiber protein (S) or variants thereof, and construction and application thereof; in particular to a recombinant Vesicular Stomatitis Virus (VSV) expressing a fiber protein (S) of SARS-CoV-2 or the deletion of the carboxyl terminal thereof, and construction and application thereof.
Background
The coronaviridae are divided into four genera, α, β, γ and δ, based on serotype and genomic characteristics. CoV-2 belongs to the genus beta coronavirus, and the genus coronavirus also comprises middle east respiratory syndrome related coronavirus (MERS-CoV) and severe respiratory syndrome related coronavirus (SARS-CoV), and the systematic evolution analysis of the full-length genome of CoV-2 shows that the similarity between the novel coronavirus and SARS virus is higher than that of MERS virus.
The CoV-2 genome is single-stranded positive strand RNA with the length of about 29.8Kb, the 5' end of the CoV-2 genome is an open reading frame (Open reading frame, ORF) 1ab for encoding replicase complex, and the CoV-2 genome occupies about 2/3 of the whole genome and encodes non-structural proteins such as polymerase; the latter 1/3 region encodes the fiber protein (Spike, S), the small Envelope protein (E), the Membrane protein (Membrane, M) and the Nucleocapsid protein (nucleoapsid, N). The fibrin (S) is embedded into the surface of the virion envelope in a trimer form, is responsible for the combination of virus and host cell surface receptor, is the most important neutralization protective antigen of coronavirus, and is also the most important target antigen for vaccine development. Recent studies have shown that the receptor for CoV-2 is the same as SARS-CoV and is angiotensin converting enzyme 2 (ACE 2), however, analysis of the amino acid sequence of the coronavirus S protein also shows that there are 4 changes in coronavirus CoV-2 at the 5 key amino acid sites of the interaction of the SARS virus S protein with ACE 2. This suggests that there may be significant changes in the immunogenicity of the virus between the two.
The most effective method of protecting against viral infection is the use of vaccines, but currently there is still a lack of effective vaccines and maturation techniques to control human coronavirus infection. Coronaviruses have high variability, on the one hand, because the viruses belong to RNA viruses, the RNA replicase has low error correction capability and is easy to cause gene mutation, and on the other hand, gene recombination can occur between coronavirus strains, so that the difficulty in developing vaccines is increased. Therefore, the method can be used for constructing a general technical platform for rapidly developing vaccines, and is helpful for coping with sudden epidemic situations. The current common vaccine development method comprises an inactivated vaccine and an attenuated vaccine, the inactivated vaccine is prepared by culturing a large amount of viruses and inactivating the viruses, and the method has extremely high production safety requirements on highly pathogenic viruses such as SARS and the like and is needed to be carried out in a biosafety 3-level laboratory. The virus is cultivated on a large scale, and once leaked, a huge disaster is generated; in addition, inactivated vaccines require multiple vaccinations, require long time to develop efficacy, and are ineffective in eliciting mucosal immunity. Although human novel coronavirus (CoV-2) has been successfully isolated and cultured in vitro on VeroE6 cells, high level production of the virus requires sufficient optimization of culture conditions, including suitable cell lines, etc. The method for obtaining attenuated live vaccine virus strains comprises a traditional cell passage method and a genetic engineering technology, wherein the attenuated live vaccine with lost pathogenicity is possibly reversed into a pathogenic strain, coronaviruses are easy to recombine in the wild, attenuated mutant strains can recombine with wild strains under natural conditions to regain toxicity, and the defects make it difficult to obtain a novel human coronavirus vaccine in a traditional sense in a short time, so that a new development method needs to be searched. Among these, efficient expression of the critical protective antigen of CoV-2 by means of a safe and technically mature viral vector is likely to be an effective solution. Currently, commonly used viral vectors include: DNA viral vectors (e.g., adenovirus, poxvirus); retrovirus vectors (e.g., lentiviruses), RNA virus vectors (e.g., vesicular stomatitis virus and measles virus), and the like.
In 1996, john Rose group established Vesicular Stomatitis Virus (VSV) Rescue (Rescus) technology, and VSV has become a safe and efficient vaccine vector through genetic engineering, and has been developed for in vitro culture-difficult and pathogenic pathogens such as HIV, HCV and the like. Advantages of VSV viral vectors mainly include: 1. the preparation is non-pathogenic to human and safer; as an RNA virus, does not cause transformation of the host cell; 2. can efficiently express macromolecular exogenous proteins; 3. the single inoculation can quickly excite the organism to generate comprehensive immune response including mucosal immunity, cell and humoral immunity response; 4. BHK21 cells used to amplify VSV can be cultured in high density suspension. This provides an extraordinary advantage for the industrial production of the VSV recombinant vaccine. In recent years, the recombinant VSV has made breakthroughs in the development and application of emergency immunity vaccines for human, the vaccine developed by expressing Ebola virus envelope Glycoprotein (GP) by taking the recombinant VSV as a vector has been put into clinical application, and effective immunity protection can be obtained after single vaccination of a primate for 5 days, and attack of a lethal dose of Ebola virus is resisted; in terms of coronavirus, the applicant has also developed a VSV live vector vaccine expressing porcine coronavirus, porcine Epidemic Diarrhea Virus (PEDV) fiber protein (S), and animal experiments show that it can elicit good immunoprotection in pigs. These successful experiences show that VSV viral vectors may be a good platform for developing CoV-2 coronavirus vaccines. Unlike adenovirus vectors, humans do not contact VSV in nature and there are no antibodies to VSV in the body, so the vaccinated vaccine is not disturbed.
VSV belongs to the rhabdovirus, whose genome is approximately 11kb, encoding 5 structural proteins including RNA replicase (L), phosphoprotein (P), nucleocapsid protein (N), envelope protein (G) and matrix protein (M). The G protein is responsible for recognizing viral receptors and mediating viral invasion into host cells, which determines the tropism of VSV viruses; the M protein can be distributed in the nucleus to block the transfer of host cell mRNA to cytoplasm, thus playing the role of inhibiting the expression of I-type interferon and the like, and being the most important virulence factor of virus. Safety is of greatest concern for viral vectors. Currently, applicants and others construct a series of highly attenuated VSV viral vectors around the M and G proteins, such as the subject applicants have previously successfully constructed two-site mutant recombinant VSV viruses (VSV ΔM51 -G Δ28 ) And a novel recombinant VSV virus (VSV) having a three-site amino acid mutation of M protein MT ). These VSV vectors are further enhanced in safety compared to wild-type VSV. Ebola virus vaccine development employs two other strategies, including: pseudotyping of VSV with the envelope Glycoprotein (GP) of Ebola virus, altering VSV tropism, a strategy used by Merck company to produce vaccines; another strategy is to replace the VSVN protein gene with Ebola virus GP protein gene and move the N gene to the VSVM gene to give the virus rvvgp 1N4, which not only improves the efficiency of GP protein integration into the VSV envelope, but also improves the safety of VSV.
The spike protein (S) of coronavirus is a type I transmembrane glycoprotein with a molecular weight of about 200kDa, the structure of which includes an N-terminal signal peptide, an extracellular domain (ET), a transmembrane domain (Transmembrane domain, TM) and an intracellular domain (cytoplasomic tail, CT). Studies show that the S protein induces neutralizing protective antibodies highly depend on the integrity of the spatial conformation of the antibodies, even the integrity of the trimer formed by embedding the proteins into the envelope, and that the single or tandem epitope and the S1 or S2 subunit have difficulty in playing an effective protective role, so how to prepare the S protein with the natural conformation in a large amount by utilizing the genetic engineering technology has been a problem which plagues the development of related vaccines. The applicant has shown that the full-length S gene of PEDV can not rescue virus after cloning into VSV genome, but can successfully embed VSV envelope when the S protein has been knocked out by 19 amino acids at the carboxyl terminal of intracellular segment. This is in combination with a conserved double basic motif (motif) structure at the carboxy terminus of the protein: kxHxx is related. This motif structure allows the localization of the S protein to the endoplasmic reticulum golgi compartment (ERGIC) rather than to the cell membrane surface, which can interfere with efficient insertion of the coronavirus S protein into the VSV' S envelope and ultimately rescue of recombinant VSV as VSV budding occurs at the cell membrane. Our studies also show that since PEDV S protein has only removed the carboxy-terminal amino acids, its extracellular and transmembrane domains remain intact, and thus it can be integrated into the VSV envelope, animal experiments also confirm that the immunogenicity of the S protein is unaffected. The CoV-2S protein contains 1273 amino acids, and protein structural analysis shows that a KxHxx motif structure (AA 1269-1273) also exists at the carboxyl terminal, which is very likely to interfere with the rescue of recombinant VSV, so how to optimize the intracellular segment length of the S protein of CoV-2 is one of the keys for constructing a VSV live vector vaccine.
In addition, in the absence of vaccines and effective drugs at present, accurate and rapid diagnosis of patients is a key to controlling epidemic situation. Common diagnostic methods for pathogen infection include: (1) detection of pathogen proteins, nucleic acids; (2) detection of specific antibodies in infected subjects, such as: ELISA, colloidal Jin Mingan test paper and detection of neutralizing antibodies. Currently, the definitive diagnosis of CoV-2 infected or suspected patients is essentially dependent on nucleic acid detection, but this method uses a number of biosafety class 3 laboratories (P3) that are subject to clinical testing and staff that are capable of performing skilled stabilization procedures; in addition, the type of sample, the method of collecting, transporting and storing the sample, the method of extracting nucleic acid (RNA), and the accuracy and stability of the detection device (PCR instrument or real-time PCR instrument) affect the detection effect.
In response to these problems, companies have begun to develop detection methods for specific antibodies in vivo, including sensitive test strips and ELISA kits. Unlike conventional ELISA, which detects total IgG or IgM antibodies in serum, the neutralizing antibody detection reflects the level of antibodies having protective effects in vivo, and thus has a clinically unique diagnostic meaning, and the method does not require judgment of the results for specific antibody types such as IgA, igG, igM, and the like. Thus, it is suitable for a wide variety of samples, including blood, respiratory mucus, lung lavage fluid, etc., that inactivate viruses. In addition, compared with nucleic acid detection, the neutralizing antibody detection has less interference caused by environmental and instrument pollution, has high specificity, can be used for screening asymptomatic or latent period patients which are difficult to confirm by a nucleic acid method, and the like, and is helpful for controlling the transmission of the novel coronavirus from the source. In the future, neutralizing antibody detection will also be useful for tracing the natural and intermediate hosts of COV-2 virus animals without having to develop a corresponding ELISA kit for each animal; the method has wide application prospect in clinical and scientific researches which rely on neutralizing antibodies for evaluation, such as antibody therapy, vaccine development and the like.
However, detection methods based on neutralizing antibodies also have some bottlenecks, including: (1) Neutralizing antibody detection typically requires the use of the original live virus, which means that for highly pathogenic viruses like CoV-2, relevant detection needs to be performed in the P3 laboratory; (2) The result judgment depends on the obvious lesion (CPE) of cells and has certain subjectivity; (3) Coronavirus replication is slow and CPE determination time is typically 72 hours. These problems have greatly limited the use and popularization of methods for detecting neutralizing antibodies.
Disclosure of Invention
In view of the shortcomings of the prior art, it is an object of the present invention to provide a recombinant VSV virus expressing SARS-CoV-2 fiber protein (S) or variants thereof, and construction and use thereof. The invention implements the whole gene synthesis of the S gene of the required SARS-CoV-2 virus according to the virus strain sequence (GenBank accession No. MN 908947) published on NCBI, the codon of the synthesized gene is optimized according to human cell codon, on the basis, the S protein is efficiently embedded into VSV envelope by optimizing the length of the intracellular section of the SARS-CoV-2S protein and removing the KxHxx motif structure activity of the carboxyl end, thus constructing recombinant VSV virus, constructing live vector vaccine, and establishing a detection method and product for high-flux and rapid detection of SARS-CoV-2 specific neutralizing antibody.
The invention aims at realizing the following technical scheme:
in a first aspect, the present invention provides a SARS-CoV-2 virus S gene for efficient expression and for construction of a novel coronavirus based on recombinant vesicular stomatitis virus, said SARS-CoV-2 virus S gene being synthesized by whole gene synthesis, the codons of the synthesized genes being optimized according to human cell codons. The sequence is shown as SEQ ID NO. 1.
In a second aspect, the present invention also provides a method for constructing a recombinant vesicular stomatitis virus VSV expressing a novel human coronavirus SARS-CoV-2 spike protein S, the method comprising: knocking out the G protein gene of VSV responsible for recognizing host cell receptor, and constructing pseudotyped VSV virus by S protein of SARS-CoV-2 or S delta 21 protein of variant thereof; sΔ21 is an S protein variant with a deletion of 21 amino acids in the intracellular region (CT).
As one embodiment of the present invention, the method comprises:
s1, constructing a pseudotyped VSV virus for expressing S protein of SARS-CoV-2 or a variant S delta 21 thereof by adopting a wild-type VSV virus as a vector; sΔ21 is an S protein variant with a deletion of 21 amino acids in the intracellular region (CT);
s2, constructing a pseudo VSV virus for expressing S protein of SARS-CoV-2 or a variant Sdelta 21 thereof by adopting a highly weakened and safe VSV virus with M three-site mutation as a vector; sΔ21 is an S protein variant with a deletion of 21 amino acids in the intracellular region (CT); the mutation of M protein results in high attenuation of VSV carrier, so that the prepared recombinant new crown vaccine is safer.
As one embodiment of the invention, the sequence of the S protein encoding SARS-CoV-2 is shown in SEQ ID NO. 1.
As one embodiment of the invention, the construction method of the recombinant vesicular stomatitis virus VSV for expressing the human novel coronavirus SARS-CoV-2 fiber protein S comprises the following specific steps:
a1, constructing recombinant plasmids:
a11, performing base knockout (and obtaining optimized length) on an S gene of SARS-CoV-2 virus to obtain an S protein mutant Sdelta 21;
a12, constructing plasmid pVSV of cloning VSV Indiana strain full-length genome sequence IND Or pVSV MT ；
a13, carrying out high-fidelity PCR amplification on the S or Sdelta 21 genes, wherein the 5 'and 3' ends of the genes respectively contain MluI and XhoI restriction enzyme sites, and cloning the genes to pVSV after double restriction enzyme IND 、pVSV MT In the plasmid, the S or S delta 21 gene is substituted for the G gene in the VSV to obtain recombinant plasmid pVSV ΔG -S、pVSV ΔG -SΔ21、pVSV MTΔG S or pVSV MTΔG -SΔ21；
A2, virus preparation:
a21, infecting BHK21 cells with poxvirus vTF 7-3 at MOI=5, and removing poxvirus after 1-1.5 hours;
a22 recombinant plasmid pVSV ΔG -S、pVSV ΔG -SΔ21、pVSV MTΔG S or pVSV MTΔG S.DELTA.21 was mixed with helper plasmid pBS-G, pBS-N, pBS-P, pBS-L, respectively, to prepare plasmid transfection mixture;
a23, co-transfecting the plasmid transfection mixture into BHK21 cells in the step a 21;
a24, transfecting fresh BHK21 cells with plasmid pVSV-G for expressing VSV G protein to obtain BHK-G cells;
a25, collecting the cell supernatant obtained in the step a23, filtering out vTF 7-3 virus, adding the obtained filtrate into BHK-G cells for amplification, and collecting the cell supernatant with lesions after 2-3 days;
a26, purifying the cell supernatant collected in the step a25 through plaques, and then amplifying and identifying the cell supernatant by using VeroE6 cells to obtain the pseudotyped VSV virus.
In a third aspect, the present invention also provides a recombinant VSV virus expressing the S protein of SARS-CoV-2 or a variant thereof constructed by the foregoing method.
In a fourth aspect, the invention also provides the use of a recombinant VSV virus expressing the S protein of SARS-CoV-2 or a variant thereof in the preparation of a novel coronavirus vaccine.
In a fifth aspect, the present invention also provides the use of a recombinant VSV virus expressing the S protein of SARS-CoV-2 or a variant thereof in the preparation of a novel coronavirus-specific neutralizing antibody diagnostic product.
As one embodiment of the present invention, the diagnostic product includes a diagnostic test paper, a diagnostic kit.
Compared with the prior art, the invention has the following beneficial effects:
1. the invention successfully constructs the recombinant VSV virus for expressing the SARS-CoV-2S protein or the mutant thereof, which is carried out aiming at the S protein of the SARS-CoV-2 virus, thus the invention does not relate to the SARS-CoV-2 live virus and does not cause the problem of biological safety.
2. The invention successfully develops the VSV live vector vaccine capable of rapidly exciting SARS-CoV2 specific immunity, especially mucosal immunity through the constructed recombinant VSV virus, and provides a rapid and efficient vaccine development platform for developing new coronaviruses in the future; and the VSV vector vaccine is easy to amplify in vitro, and BHK-21 cells used for amplifying the virus can be subjected to high-density suspension culture, so that great advantages are provided for future vaccine industrialization and large-scale production.
3. The invention establishes a corresponding new coronavirus specific neutralizing antibody detection method and a corresponding diagnostic product through the constructed recombinant VSV virus. The detection is not needed to be carried out in a P3 laboratory, and the result judgment is carried out through fluorescent signals, objectively and accurately; the VSV is infected in cells and has high replication speed, so that the whole detection process can obtain results within 16-24 hours and realize high throughput, and the method is suitable for large-scale screening and confirming whether asymptomatic or latent patients exist in the crowd; in addition, researchers can use this method to find evidence of once-infected human blood samples, helping to trace back the time and place of onset of new coronaries. The method is suitable for detecting different types of samples, such as neutralizing antibodies contained in serum, respiratory mucus and lung lavage fluid, is not specific to specific antibody types, is particularly suitable for detecting IgM and mucosal IgA antibodies in early infection, and is beneficial to improving the specificity and sensitivity of detection.
Drawings
Other features, objects and advantages of the present invention will become more apparent upon reading of the detailed description of non-limiting embodiments, given with reference to the accompanying drawings in which:
FIG. 1 is a diagram of the structure of the S protein of a novel coronavirus; wherein, SS is a signal peptide sequence; ectodomian: an extracellular region of a protein; TM: a protein transmembrane region; CT: a protein intracellular region;
FIG. 2 is a schematic diagram of the genomic structure of a recombinant VSV virus of the present invention; wherein, (a) is sΔ21 protein pseudotyped each recombinant VSV; (B) pseudoing each recombinant VSV for the S protein; n is nucleocapsid protein; p, phosphorylating protein; m: a matrix protein; g: a envelope protein; l: viral RNA replicase; s: coV-2S protein (codon optimization); sΔ21: novel coronavirus SARS-CoV 2S protein mutant (S protein intracellular region (CT) deletion 21 amino acid variant); m is M T : three site mutation (methionine at position 51 is knocked out, valine at position 221 is mutated to phenylalanine, glycine at position 226 is mutated to arginine);
FIG. 3 is a schematic representation of the identification of novel coronavirus fiber proteins expressed by recombinant VSV viral vectors of different mechanisms; different preparation mechanisms express recombinant VSV of the novel coronavirus S protein to infect VeroE6 cells, and after cell lysate is collected, western-blotting identification is carried out by using an antibody specific to the novel coronavirus fiber protein S1 subunit; lane1. Not inoculated with viral cell lysate (negative control); lane 2.VSV MTΔG -S Δ21 Infecting VeroE6 cell lysate; lane 3.VSV ΔG -S Δ21 ；Lane 4.VSV ΔG -S infection of VeroE6 cell lysate; s indicated by arrow represents SARS-SARS-CoV2 virus strain spike protein, S1 is S1 subunit of S protein;
FIG. 4 is a VSV ΔG -S S Δ21 Viral infection of Hela-ACE2 and Hela cytogram; wherein, A.VSV ΔG -S Δ21 Infection of Hela cells, B.VSV ΔG -S Δ21 Infection of Hela-ACE2 cells, arrow indicates the huge syncytia mediated by the S protein;
FIG. 5 is a VSV Δ VeroE6 profile of G-S-GFP virus infection; wherein, A. Observation of VSV by fluorescence microscope Δ VeroE6 cells infected with G-S-GFP, arrowThe head shows the huge syncytia mediated by the S protein; B. bright field view VSV Δ The G-S-GFP infection of VeroE6 cells, indicated by the arrows as syncytia.
Detailed Description
The present invention will be described in detail with reference to specific examples. The following examples will assist those skilled in the art in further understanding the present invention, but are not intended to limit the invention in any way. It should be noted that variations and modifications could be made by those skilled in the art without departing from the inventive concept. These are all within the scope of the present invention.
In the invention, the full-length sequence of the novel coronavirus fiber protein optimized according to human cell codons according to the virus strain sequence (GenBank accession No. MN 908947) is shown as SEQ ID No. 1. New coronavirus fiber protein mutant gene S optimized according to human cell codon based on virus strain sequence (GenBank accession No. MN 908947) Δ21 The carboxyl terminal of the polypeptide lacks 21 amino acids, and the sequence is shown as SEQ ID NO. 2.
The recombinant VSV virus construction of the invention includes any one of the following methods:
1. wild-type VSV viral genome is used as backbone (VSV) IND ) S protein or variant S of SARS-CoV-2 Δ21 Construction of a protein, i.e., S protein variant with 21 amino acids deleted from the carboxy terminus of the S protein, pseudotyped VSV virus (VSV) with the knocked-out VSV G protein gene ΔG -S、VSV ΔG -S Δ21 )；
2. Highly attenuated M three-site mutant VSV viral genomes (pVSV) MT ) S protein or variant S of SARS-CoV-2 Δ21 Protein construction of VSV A pseudotyped VSV virus (VSV) in which the VSV G protein gene was knocked out MTΔG -S、VSV MTΔG -S Δ21 ). The invention uses a new recombinant vesicular stomatitis virus which is successfully constructed at home and abroad for the first time as a carrier developed by a new coronavirus vaccine, three different amino acid sites of a Matrix protein (Matrix, M) of the virus are mutated (as shown in figure 2), and the recombinant vesicular stomatitis virus comprises the deletion of methionine at 51 st site, the mutation of valine at 221 st site into phenylalanine and the mutation of glycine at 226 th site of the Matrix proteinMutating to arginine; VSV (vertical seismic velocity) MT Vaccine vectors achieve a high degree of attenuation as compared to wild-type VSV vaccine vectors, with VSV MT The novel crown vaccine constructed for the vector is safer.
See the following examples for details:
preparation example 1: optimizing the length of the intracellular section (CT) of SARS-CoV-2S protein to make it be embedded into VSV capsule membrane
The SARS-CoV-2 virus S gene required in this example is synthesized by total gene according to the strain sequence published on NCBI (GenBank accession No. Mn 908947), the codon of synthesized gene is optimized according to human cell codon (SEQ ID NO. 1), the sequence is published for the first time, and experiments prove that the optimized sequence is compared with the fiber protein S gene sequence of original new coronavirus strain, the protein can be expressed at higher level, which is shown in that we successfully construct new coronavirus-based recombinant vesicular stomatitis virus new coronavirus vaccine by using the sequence. The coronavirus S protein structure is shown in FIG. 1, and is a type I transmembrane protein, comprising an N-terminal signal peptide, an extracellular region (ET), a transmembrane region (Transmembrane domain, TM) and an intracellular region (cytoplasomic tail, CT). The CoV-2S protein has a KxHxx motif structure at the carboxyl end (AA 1269-1273), and the example knocks out 21 amino acids of the intracellular segment of the S protein at the carboxyl end, so that the KxHxx motif structure is eliminated, and an S protein mutant named S delta 21 (SEQ ID NO. 2) is obtained. The S protein variant enables the efficient integration of the S protein into the intracellular segment of the VSV envelope, and thus is useful in subsequent recombinant VSV development.
Specifically, amplifying the codon-optimized S protein gene by using high-fidelity PCR enzyme to obtain a corresponding S protein gene;
primer design: underlined is the corresponding sequence of the S protein gene
An upstream primer: 5'CTAACAGATATCACG CTCGAGATGTTCGTTTTCCTTGTT3’(SEQ ID NO.3)
A downstream primer: 5'AACATGAAGAATCTG GCTAGCTCA TTATGTGTAATGCAGCTT 3’(SEQ ID NO.4)
Knocking out 21 amino acids of the intracellular segment of the S protein carboxyl terminal to obtain a corresponding S protein mutant Sdelta 21;
primer design: underlined is the corresponding sequence of the S protein gene
An upstream primer: 5'CTAACAGATATCACG CTCGAGATGTTCGTTTTCCTTGTT3’(SEQ ID NO.5)
A downstream primer:
5’AACATGAAGAATCTG GCTAGC TCA TTATGATCCGCAAGAGCAGCAT3’(SEQ ID NO.6)
preparation example 2: pVSV ΔG -S、pVSV ΔG -S Δ21 Recombinant plasmid construction
1. Construction of pVSV IND A plasmid cloned with the full-length genomic sequence of the VSV Indiana strain;
2. the S or Sdelta 21 gene is subjected to high-fidelity PCR amplification, the 5 'and 3' ends of the S or Sdelta 21 gene respectively contain MluI and XhoI restriction enzyme sites, and the S or Sdelta 21 gene is cloned to pVSV after double restriction enzyme IND In the plasmid, S Δ21 Gene replacement of the G gene in VSV to obtain recombinant plasmid pVSV ΔG S or pVSV ΔG SΔ21, as shown in fig. 2.
Preparation example 3: pVSV MTΔG -S、pVSV MTΔG Construction of S.DELTA.21 recombinant plasmids
1. Construction of pVSV MT A plasmid, wherein the plasmid is cloned with a genome sequence of VSV Indiana strain M after three-site mutation;
2. the S or Sdelta 21 gene is subjected to high-fidelity PCR amplification, the 5 'and 3' ends of the S or Sdelta 21 gene respectively contain MluI and XhoI restriction enzyme sites, and the S or Sdelta 21 gene is cloned to pVSV after double restriction enzyme MT In the plasmid, recombinant plasmid pVSV is obtained MTΔG S or pVSV MTΔG SΔ21, as shown in fig. 2.
Preparation example 4: recombinant VSV virus production
1. BHK21 cells were infected with poxvirus vTF 7-3 expressing the T7 RNA polymerase gene at a concentration moi=5, and poxvirus was removed after 1 hour;
2. preparing plasmid transfection mixture liquid when infecting viruses, and mixing the recombinant plasmids prepared in the examples 2 and 3 with helper plasmid pBS-G, pBS-N, pBS-P, pBS-L;
3. co-transfecting the particle transfection mixed solution with the vTF 7-3 in the step 1 to infect BHK21 cells, and replacing the cell culture solution about 4 hours after transfection;
4. transfecting fresh BHK21 with plasmid pVSV-G expressing VSV G protein to obtain cell called BHK-G cell;
5. collecting the cell supernatant obtained in the step 3, filtering the vTF 7-3 virus by using a filter membrane with the aperture of 0.2um, and adding the filtrate to the subsequent VeroE6 cells prepared in the step 4 to amplify the virus; observing cytopathy, and harvesting the supernatant of the diseased cells after 2-3 days to obtain corresponding recombinant VSV viruses, namely VSV ΔG -SΔ21、VSV ΔG -S、VSV MTΔG -S Δ21 And VSV MTΔG -S virus;
6. after plaque purification, the recombinant VSV virus was expanded with VeroE6 cells and frozen for later use after identification.
Authentication examples:
1. western-blotting identification of recombinant viral structural proteins by recombinant VSV MTΔG -S Δ21 、VSV ΔG -S Δ21 、VSV ΔG S is used for respectively infecting cells, and cell lysates are harvested and respectively subjected to Western-blotting identification by using a mouse anti-SARS-CoV 2 virus S protein specific antibody; the results are shown in FIG. 3.
2.VSV ΔG Identification of the tropism of S virus. A stable cell line expressing human ACE2 protein with a Hela cell line (Hela-ACE 2); with VSV ΔG S infects Hela-ACE2 and Hela cells, respectively, observes CPE and VSV antibody specificities to immunohistochemical staining of cells, and on pseudotyped virus VSV ΔG -determining the tropism of S; the results are shown in FIG. 4.
And (3) effect verification: detection of novel coronavirus vaccinated mice for immune efficacy
The 4 recombinant VSV viruses constructed in preparation examples 2-3 above were inoculated into human ACE2 gene C57 mice, and the immune efficacy evaluation criteria included: specific immunity (bronchoalveolar lavage sIgA antibody) protective antibodies were detected using S-protein pseudotyped lentiviruses for mucosal neutralisation antibody detection.
1. Grouping and immunization of animals
The experimental animals are human ACE2 gene-transferred C57 mice with the weight of about 20g, and are divided into 5 groups by drippingInoculation was performed nasally. As shown in Table 1, the experimental groups were four (groups 1 to 4), each group was immunized with the above recombinant virus, each group was 12 animals, and each group was inoculated with 10 animals 4 PFU/50 μl dose of virus; the control group was inoculated PBS mice for a total of 12.
2. Collection of laboratory animal samples
Collecting blood from eyesockets of mice of each group before immunization and on day 14 after immunization, and separating serum; animals were sacrificed and bronchoalveolar lavage fluid was collected for protective mucosal immune antibody detection and samples were stored at-70 ℃.
3. Specific mucosal immunoprotection antibody detection
(1) Centrifuging the collected sample at 2000r/min at 4deg.C to remove red blood cells and impurities;
(2) Correspondingly diluting a sample by using a DPBS buffer solution, adding an equal volume of novel coronavirus pseudotyped non-replicating slow virus containing 100IU of expressed GFP, mixing, placing in a 37 ℃ incubator for incubation for 1h, and adding 80-90% full 96-well 293T-ACE2 stable cells;
(3) Incubating at 37 ℃ for 1-2h; the incubation liquid is discarded, the DPBS is used for washing 1-2 times, fresh serum-free DMEM culture solution is added into each hole, the culture is carried out for 48 hours, a fluorescent microscope is used for observation, photographing is carried out, the result is recorded, green fluorescence is negative to the antibody, no green fluorescence is positive to the antibody, and the neutralizing antibody titer is calculated.
5. By analyzing the sample detection result, the result shows that VSV ΔG -SΔ21、VSV ΔG -S、VSV MTΔG -S Δ21 And VSV MTΔG The S virus is effective in eliciting specific neocrown antibodies in mice transformed with the human ACE2 gene C57 as shown in Table 1.
TABLE 1
And II, effect verification: detection of neutralizing antibody of domestic crown vaccine for human immunity
1. pVSV obtained in preparation examples 2 and 3 ΔG Cloning eGFP gene between G and L genes by using XhoI and NheI enzymes to obtain recombinant plasmid pVSV containing green fluorescent protein gene GFP ΔG -S-GFP; then recombinant virus VSV was obtained by the virus rescue method of preparation example 4 ΔG -S-GFP；
2. Collecting sample such as blood, respiratory mucus, etc., inactivating virus, centrifuging at 4deg.C at 2000r/min, and discarding red blood cells and impurities;
3. samples were diluted with DPBS buffer, and serum from whole blood collected was diluted in 1:5,1:10,1:20,1:40,1:80,1:160,1:320,1:640 in duplicate, with blood from healthy persons as a control, and an equal volume of VSV containing 100PFU was added ΔG -S-GFP, mixed and incubated in 37 ℃ incubator for 1h, added 80% -90% full 96 well VeroE6 cell culture plates and incubated in 37 ℃ for 1-1.5h; discarding the incubation liquid, washing 1-2 times with DPBS, adding fresh serum-free DMEM culture liquid into each hole,
culturing in a incubator at 4.37 ℃ for 24 hours, observing by a fluorescence microscope, photographing, recording the result (as shown in figure 5), wherein the result is that the antibody is negative, the result is that the antibody is positive, and the antibody titer is calculated;
5. by analyzing the results of the sample detection. The results of the detection of the titer of the neutralizing antibodies of the human serum inoculated with the domestic novel coronal vaccine are shown in Table 2, and indicate that the replication type pseudotype VSV expressing the green fluorescent protein GFP Δ The method for establishing the G-S-GFP can be used for detecting the titer of the neutralizing antibodies of the serum of the domestic new crown vaccine immune human, and has better application prospect for establishing more reliable and effective vaccine immune effect evaluation indexes in the future.
TABLE 2
There are many ways in which the invention may be practiced, and what has been described above is merely a preferred embodiment of the invention. It should be noted that the above examples are only for illustrating the present invention and are not intended to limit the scope of the present invention. It will be apparent to those skilled in the art that modifications may be made without departing from the principles of the invention, and such modifications are intended to be within the scope of the invention.
Sequence listing
<110> Shanghai university of transportation
<120> construction and use of pseudotyped VSV virus expressing SARS-CoV-2 fiber protein or its variant S.DELTA.21
<130> DD16269
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 3822
<212> DNA
<213> New coronavirus (SARS-CoV 2 Wuhan-Hu-1)
<400> 1
atgttcgttt tccttgttct gttgcctctc gttagtagcc aatgcgtcaa ccttactact 60
agaacccagc tccctccagc atataccaac tctttcacca ggggcgtata ttacccggac 120
aaagtgttcc gctcaagtgt gctgcattct acgcaggacc ttttcttgcc ctttttcagt 180
aatgttactt ggtttcatgc tatccatgtg tctggaacta acggaaccaa gcgctttgac 240
aaccccgtcc tccctttcaa cgatggcgtg tacttcgctt ccacggaaaa gtcaaacata 300
attcgcggct ggatctttgg tacaacactc gactcaaaga cgcagagcct gctgatcgtt 360
aataacgcta caaatgttgt gataaaggtg tgtgaatttc agttctgcaa tgatcccttc 420
ctgggtgtgt actaccataa gaataacaag agctggatgg aatccgaatt tagggtttac 480
agttccgcta acaactgcac attcgaatac gtaagccagc catttcttat ggatcttgag 540
ggcaagcaag gaaacttcaa gaacttgagg gagttcgtgt tcaaaaatat cgacggctat 600
tttaagatat atagcaagca cactccaata aacttggtgc gcgacctgcc ccagggattc 660
tctgctctgg agcccctggt ggatctgccc attggaataa acataactcg ctttcaaaca 720
ctgctcgccc tgcatcgcag ttacctcacc cctggtgata gtagttcagg atggacagca 780
ggagccgccg catactacgt cggctacctg cagcctagga ccttcttgct gaagtacaac 840
gagaacggta caataactga cgctgtggac tgcgctctgg accctctgtc cgagacgaag 900
tgcaccctga agagctttac tgttgaaaaa ggcatttacc aaaccagcaa cttccgcgtc 960
cagccaaccg agagcatcgt cagatttccc aacattacaa atctgtgtcc cttcggcgag 1020
gtgttcaacg ccacacgctt cgcttcagtg tacgcatgga accgcaagcg catatctaac 1080
tgcgtcgcgg attattctgt cctctacaac tccgcctctt tctccacctt caagtgctac 1140
ggagtgtcac cgactaagct gaacgatctc tgctttacca acgtctacgc ggactccttc 1200
gtgataagag gtgatgaagt gagacaaata gccccaggtc agactggtaa gatcgcagat 1260
tacaactaca aattgcctga tgatttcact ggttgcgtta tcgcgtggaa ctctaataac 1320
ctcgattcta aggtcggtgg taactacaat tacctgtacc gcttgtttag gaagtcaaac 1380
ctgaagcctt tcgagaggga tatttcaacc gaaatctatc aagcgggttc aacaccgtgt 1440
aacggtgtgg aaggatttaa ctgctacttc cccctgcagt cttacggatt ccagccaacc 1500
aatggcgtgg gttaccaacc ttatcgcgtg gtggttctga gtttcgaact gttgcacgct 1560
cccgccacgg tatgcggtcc caagaagagc actaacttgg tgaagaataa gtgcgtgaat 1620
ttcaatttca atggcctcac tggaactgga gtgctgaccg aatccaataa gaagttcttg 1680
cccttccagc agttcggaag agacattgct gacacaaccg acgcggtgcg cgatcctcag 1740
actctggaga tattggacat tacaccatgt tctttcggcg gtgtgtctgt cattactccg 1800
ggcacgaata ctagcaacca ggtagccgtg ctgtaccaag acgtgaattg cacagaggtt 1860
cccgtcgcaa ttcacgctga ccagctgacc cccacgtgga gggtttacag cactggtagt 1920
aacgtcttcc agacgagagc cggttgcttg atcggagcgg aacatgtgaa taactcctac 1980
gagtgcgaca tccccatcgg agccggtata tgcgcctctt atcagacaca aactaactca 2040
cccaggagag cccgcagtgt ggcttctcaa agcattatag catacactat gtctcttggt 2100
gccgaaaatt ccgtggccta ttctaacaat tcaatcgcca tcccaaccaa cttcacaatt 2160
agcgtgacta ccgaaatact gcctgtgagc atgacgaaaa ccagcgtaga ctgcactatg 2220
tatatctgtg gagactccac tgagtgctcc aaccttctcc tgcagtacgg tagcttctgt 2280
acccaattga accgcgccct tacaggcatc gctgttgagc aagataagaa tacccaggaa 2340
gtttttgccc aggttaagca gatatacaaa acaccgccca ttaaggactt cggaggcttc 2400
aacttctctc agatactgcc tgacccctcc aagccatcaa aacgcagctt cattgaggac 2460
ctcttgttca acaaagtgac tctggctgat gctggcttca ttaagcagta cggagattgc 2520
ctgggagata ttgctgccag ggacctcatc tgcgcccaga agtttaatgg cctgacagtc 2580
ttgcccccac ttctgacaga cgagatgatt gctcagtaca catctgccct cctcgctggc 2640
accataacat ccggatggac atttggtgct ggtgctgccc tccagattcc cttcgcaatg 2700
cagatggcgt atcgctttaa cggcatcggt gtcacacaaa acgtgttgta tgagaaccaa 2760
aagctcatcg ctaaccagtt taattctgct attggtaaga ttcaggacag cctgtcatca 2820
accgcgtctg cccttggtaa gttgcaggac gtggtgaacc agaatgctca ggctttgaat 2880
actctggtga agcaactctc ttcaaatttc ggcgctatct cttctgtgtt gaacgacatc 2940
ctgagtcgcc ttgataaggt ggaagctgaa gttcaaattg atagattgat tactggcagg 3000
ctccagtctt tgcagaccta cgttacacag cagctgatta gggcggctga aattagagct 3060
tccgccaatc tggctgcaac caagatgtcc gaatgcgtcc tgggtcagtc aaagcgcgtt 3120
gacttttgtg gtaaaggcta ccacctcatg tcatttcccc agtcagcacc tcacggagta 3180
gtgttcctcc acgtcaccta cgttccagca caggaaaaga attttaccac tgcgccggca 3240
atctgtcacg acggtaaggc acacttcccc cgcgagggcg tattcgtgtc taacggaact 3300
cattggttcg tcacacagag aaacttctat gagcctcaga tcattaccac cgacaataca 3360
tttgtgtccg gtaactgcga cgttgtgatt ggaatcgtca acaacactgt gtacgatcca 3420
cttcagccag aactggatag cttcaaggaa gaattggaca aatatttcaa aaatcacact 3480
tcacccgatg tggacctggg tgacattagt ggtatcaatg cgtccgtggt caatattcaa 3540
aaagagattg acaggctcaa cgaagtggcc aagaacctga acgaaagtct tatcgatctg 3600
caagaattgg gaaagtatga gcagtacatc aagtggccgt ggtacatttg gttgggtttt 3660
atcgccggtc tgatcgccat cgttatggtt accattatgc tttgctgcat gacgagctgt 3720
tgctcctgtc tgaagggatg ctgctcttgc ggatcatgtt gcaagttcga tgaagacgat 3780
agcgaaccag ttctgaaggg cgtcaagctg cattacacat aa 3822
<210> 2
<211> 3759
<212> DNA
<213> New coronavirus (SARS-CoV 2 Wuhan-Hu-1)
<400> 2
atgttcgttt tccttgttct gttgcctctc gttagtagcc aatgcgtcaa ccttactact 60
agaacccagc tccctccagc atataccaac tctttcacca ggggcgtata ttacccggac 120
aaagtgttcc gctcaagtgt gctgcattct acgcaggacc ttttcttgcc ctttttcagt 180
aatgttactt ggtttcatgc tatccatgtg tctggaacta acggaaccaa gcgctttgac 240
aaccccgtcc tccctttcaa cgatggcgtg tacttcgctt ccacggaaaa gtcaaacata 300
attcgcggct ggatctttgg tacaacactc gactcaaaga cgcagagcct gctgatcgtt 360
aataacgcta caaatgttgt gataaaggtg tgtgaatttc agttctgcaa tgatcccttc 420
ctgggtgtgt actaccataa gaataacaag agctggatgg aatccgaatt tagggtttac 480
agttccgcta acaactgcac attcgaatac gtaagccagc catttcttat ggatcttgag 540
ggcaagcaag gaaacttcaa gaacttgagg gagttcgtgt tcaaaaatat cgacggctat 600
tttaagatat atagcaagca cactccaata aacttggtgc gcgacctgcc ccagggattc 660
tctgctctgg agcccctggt ggatctgccc attggaataa acataactcg ctttcaaaca 720
ctgctcgccc tgcatcgcag ttacctcacc cctggtgata gtagttcagg atggacagca 780
ggagccgccg catactacgt cggctacctg cagcctagga ccttcttgct gaagtacaac 840
gagaacggta caataactga cgctgtggac tgcgctctgg accctctgtc cgagacgaag 900
tgcaccctga agagctttac tgttgaaaaa ggcatttacc aaaccagcaa cttccgcgtc 960
cagccaaccg agagcatcgt cagatttccc aacattacaa atctgtgtcc cttcggcgag 1020
gtgttcaacg ccacacgctt cgcttcagtg tacgcatgga accgcaagcg catatctaac 1080
tgcgtcgcgg attattctgt cctctacaac tccgcctctt tctccacctt caagtgctac 1140
ggagtgtcac cgactaagct gaacgatctc tgctttacca acgtctacgc ggactccttc 1200
gtgataagag gtgatgaagt gagacaaata gccccaggtc agactggtaa gatcgcagat 1260
tacaactaca aattgcctga tgatttcact ggttgcgtta tcgcgtggaa ctctaataac 1320
ctcgattcta aggtcggtgg taactacaat tacctgtacc gcttgtttag gaagtcaaac 1380
ctgaagcctt tcgagaggga tatttcaacc gaaatctatc aagcgggttc aacaccgtgt 1440
aacggtgtgg aaggatttaa ctgctacttc cccctgcagt cttacggatt ccagccaacc 1500
aatggcgtgg gttaccaacc ttatcgcgtg gtggttctga gtttcgaact gttgcacgct 1560
cccgccacgg tatgcggtcc caagaagagc actaacttgg tgaagaataa gtgcgtgaat 1620
ttcaatttca atggcctcac tggaactgga gtgctgaccg aatccaataa gaagttcttg 1680
cccttccagc agttcggaag agacattgct gacacaaccg acgcggtgcg cgatcctcag 1740
actctggaga tattggacat tacaccatgt tctttcggcg gtgtgtctgt cattactccg 1800
ggcacgaata ctagcaacca ggtagccgtg ctgtaccaag acgtgaattg cacagaggtt 1860
cccgtcgcaa ttcacgctga ccagctgacc cccacgtgga gggtttacag cactggtagt 1920
aacgtcttcc agacgagagc cggttgcttg atcggagcgg aacatgtgaa taactcctac 1980
gagtgcgaca tccccatcgg agccggtata tgcgcctctt atcagacaca aactaactca 2040
cccaggagag cccgcagtgt ggcttctcaa agcattatag catacactat gtctcttggt 2100
gccgaaaatt ccgtggccta ttctaacaat tcaatcgcca tcccaaccaa cttcacaatt 2160
agcgtgacta ccgaaatact gcctgtgagc atgacgaaaa ccagcgtaga ctgcactatg 2220
tatatctgtg gagactccac tgagtgctcc aaccttctcc tgcagtacgg tagcttctgt 2280
acccaattga accgcgccct tacaggcatc gctgttgagc aagataagaa tacccaggaa 2340
gtttttgccc aggttaagca gatatacaaa acaccgccca ttaaggactt cggaggcttc 2400
aacttctctc agatactgcc tgacccctcc aagccatcaa aacgcagctt cattgaggac 2460
ctcttgttca acaaagtgac tctggctgat gctggcttca ttaagcagta cggagattgc 2520
ctgggagata ttgctgccag ggacctcatc tgcgcccaga agtttaatgg cctgacagtc 2580
ttgcccccac ttctgacaga cgagatgatt gctcagtaca catctgccct cctcgctggc 2640
accataacat ccggatggac atttggtgct ggtgctgccc tccagattcc cttcgcaatg 2700
cagatggcgt atcgctttaa cggcatcggt gtcacacaaa acgtgttgta tgagaaccaa 2760
aagctcatcg ctaaccagtt taattctgct attggtaaga ttcaggacag cctgtcatca 2820
accgcgtctg cccttggtaa gttgcaggac gtggtgaacc agaatgctca ggctttgaat 2880
actctggtga agcaactctc ttcaaatttc ggcgctatct cttctgtgtt gaacgacatc 2940
ctgagtcgcc ttgataaggt ggaagctgaa gttcaaattg atagattgat tactggcagg 3000
ctccagtctt tgcagaccta cgttacacag cagctgatta gggcggctga aattagagct 3060
tccgccaatc tggctgcaac caagatgtcc gaatgcgtcc tgggtcagtc aaagcgcgtt 3120
gacttttgtg gtaaaggcta ccacctcatg tcatttcccc agtcagcacc tcacggagta 3180
gtgttcctcc acgtcaccta cgttccagca caggaaaaga attttaccac tgcgccggca 3240
atctgtcacg acggtaaggc acacttcccc cgcgagggcg tattcgtgtc taacggaact 3300
cattggttcg tcacacagag aaacttctat gagcctcaga tcattaccac cgacaataca 3360
tttgtgtccg gtaactgcga cgttgtgatt ggaatcgtca acaacactgt gtacgatcca 3420
cttcagccag aactggatag cttcaaggaa gaattggaca aatatttcaa aaatcacact 3480
tcacccgatg tggacctggg tgacattagt ggtatcaatg cgtccgtggt caatattcaa 3540
aaagagattg acaggctcaa cgaagtggcc aagaacctga acgaaagtct tatcgatctg 3600
caagaattgg gaaagtatga gcagtacatc aagtggccgt ggtacatttg gttgggtttt 3660
atcgccggtc tgatcgccat cgttatggtt accattatgc tttgctgcat gacgagctgt 3720
tgctcctgtc tgaagggatg ctgctcttgc ggatcataa 3759
<210> 3
<211> 39
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
ctaacagata tcacgctcga gatgttcgtt ttccttgtt 39
<210> 4
<211> 42
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
aacatgaaga atctggctag ctcattatgt gtaatgcagc tt 42
<210> 5
<211> 39
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
ctaacagata tcacgctcga gatgttcgtt ttccttgtt 39
<210> 6
<211> 46
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
aacatgaaga atctggctag ctcattatga tccgcaagag cagcat 46

Claims (4)

1. A method for constructing recombinant vesicular stomatitis virus VSV expressing human novel coronavirus SARS-CoV-2 spike protein S, the method comprising: knocking out the G protein gene of VSV responsible for recognizing host cell receptor, and constructing pseudo VSV virus by SARS-CoV-2 variant S delta 21 protein; sΔ21 is an S protein variant with a deletion of 21 amino acids in the intracellular region; the sequence of the S protein of the SARS-CoV-2 is shown as SEQ ID NO. 1; the method comprises the following specific steps:
a1, constructing recombinant plasmids:
a11, against SARS-CoV-2 VirusSPerforming base knockout on the gene and obtaining the optimized length to obtain an S protein mutant Sdelta 21; the S protein mutant S.DELTA.21 has a sequence such as SEQ ID No. 2;
a12, constructing plasmid pVSV of genome sequence of cloned VSV Indiana strain M after three-site mutation MT The method comprises the steps of carrying out a first treatment on the surface of the Specifically, a VSV virus plasmid with three different amino acid sites of a matrix protein M mutated is constructed, wherein the VSV virus plasmid comprises the 51 st methionine of the matrix protein which is knocked out, the 221 st valine which is mutated into phenylalanine and the 226 th glycine which is mutated into arginine, and the plasmid pVSV is obtained MT ；
a13, willS Δ21 The gene is amplified by high-fidelity PCR, the 5 'and 3' ends of the gene respectively contain MluI and XhoI restriction enzyme sites, and the gene is cloned to pVSV after double restriction enzyme MT In the plasmid, makeS Δ21 Gene replacement of G gene in VSV to obtain recombinant plasmid pVSV MT∆G - SΔ21；
A2, virus preparation:
a21, infecting BHK21 cells with poxvirus vTF 7-3 at MOI=5, and removing poxvirus after 1-1.5 hours;
a22 recombinant plasmid pVSV MT∆G S.DELTA.21 was mixed with helper plasmid pBS-G, pBS-N, pBS-P, pBS-L, respectively, to prepare plasmid transfection mixture;
a23, co-transfecting the plasmid transfection mixture into BHK21 cells in the step a 21;
a24, transfecting fresh BHK21 cells with plasmid pVSV-G for expressing VSV G protein to obtain BHK-G cells;
a25, collecting the cell supernatant obtained in the step a23, filtering out vTF 7-3 virus, adding the obtained filtrate into BHK-G cells for amplification, and collecting the cell supernatant with lesions after 2-3 days;
a26, purifying the cell supernatant collected in the step a25 through plaques, and then amplifying and identifying the cell supernatant by using VeroE6 cells to obtain the pseudotyped VSV virus.
2. A recombinant VSV virus expressing a SARS-CoV-2 variant constructed according to the method of claim 1.
3. Use of a recombinant VSV virus expressing a SARS-CoV-2 variant according to claim 2 in the preparation of a novel coronavirus vaccine.
4. Use of a recombinant VSV virus expressing a SARS-CoV-2 variant according to claim 2 for the preparation of a novel coronavirus-specific neutralizing antibody diagnostic product.
CN202111044750.5A 2021-09-07 2021-09-07 Expression of SARS-CoV-2 fiber protein or its variant S Δ21 Construction and use of pseudotyped VSV viruses Active CN113817753B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202111044750.5A CN113817753B (en) 2021-09-07 2021-09-07 Expression of SARS-CoV-2 fiber protein or its variant S Δ21 Construction and use of pseudotyped VSV viruses

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111044750.5A CN113817753B (en) 2021-09-07 2021-09-07 Expression of SARS-CoV-2 fiber protein or its variant S Δ21 Construction and use of pseudotyped VSV viruses

Publications (2)

Publication Number Publication Date
CN113817753A CN113817753A (en) 2021-12-21
CN113817753B true CN113817753B (en) 2024-04-09

Family

ID=78922178

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111044750.5A Active CN113817753B (en) 2021-09-07 2021-09-07 Expression of SARS-CoV-2 fiber protein or its variant S Δ21 Construction and use of pseudotyped VSV viruses

Country Status (1)

Country Link
CN (1) CN113817753B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115287271B (en) * 2022-06-30 2024-04-09 中国食品药品检定研究院 Method for detecting neutralizing activity of SARS-CoV-2 antibody
CN116785422B (en) * 2023-06-25 2024-05-28 中国医学科学院病原生物学研究所 Measles attenuated vaccine containing novel coronavirus combined antigen and rescue method thereof

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105087645A (en) * 2015-08-04 2015-11-25 上海交通大学 Building and application of M protein three-amino acid site-mutated vesicular stomatitis virus (VSV) carrier for pigs
CN111603557A (en) * 2020-06-15 2020-09-01 苏州奥特铭医药科技有限公司 Envelope-substituted virus vector vaccine and construction method thereof
CN112375768A (en) * 2020-11-16 2021-02-19 同济大学 Pseudo-virus of COVID-19 coronavirus, preparation method and application thereof
CN112375748A (en) * 2021-01-11 2021-02-19 中国科学院动物研究所 Novel coronavirus chimeric recombinant vaccine based on vesicular stomatitis virus vector, and preparation method and application thereof
CN112724209A (en) * 2021-01-18 2021-04-30 广东华南疫苗股份有限公司 Coronavirus recombinant protein capable of forming nano-particles and carrier and application thereof
CN113185613A (en) * 2021-04-13 2021-07-30 武汉大学 Novel coronavirus S protein and subunit vaccine thereof

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105087645A (en) * 2015-08-04 2015-11-25 上海交通大学 Building and application of M protein three-amino acid site-mutated vesicular stomatitis virus (VSV) carrier for pigs
CN111603557A (en) * 2020-06-15 2020-09-01 苏州奥特铭医药科技有限公司 Envelope-substituted virus vector vaccine and construction method thereof
CN112375768A (en) * 2020-11-16 2021-02-19 同济大学 Pseudo-virus of COVID-19 coronavirus, preparation method and application thereof
CN112375748A (en) * 2021-01-11 2021-02-19 中国科学院动物研究所 Novel coronavirus chimeric recombinant vaccine based on vesicular stomatitis virus vector, and preparation method and application thereof
CN112724209A (en) * 2021-01-18 2021-04-30 广东华南疫苗股份有限公司 Coronavirus recombinant protein capable of forming nano-particles and carrier and application thereof
CN113185613A (en) * 2021-04-13 2021-07-30 武汉大学 Novel coronavirus S protein and subunit vaccine thereof

Also Published As

Publication number Publication date
CN113817753A (en) 2021-12-21

Similar Documents

Publication Publication Date Title
CN111218459B (en) Recombinant novel coronavirus vaccine taking human replication-defective adenovirus as vector
WO2021254327A1 (en) Envelope replacement-type viral vector vaccine and construction method therefor
CN111560354B (en) Recombinant novel coronavirus, preparation method and application thereof
WO2022218325A1 (en) Gene-deleted attenuated african swine fever virus strain, and construction method therefor and use thereof
CN104962581B (en) A kind of recombinant viral vaccine strain for expressing African swine fever virus p72 albumen
US20090010955A1 (en) Vaccines Containing Canine Parvovirus Genetic Variants
CN113817753B (en) Expression of SARS-CoV-2 fiber protein or its variant S Δ21 Construction and use of pseudotyped VSV viruses
CN110951699B (en) Recombinant rabies virus for expressing canine distemper virus structural protein and application thereof
CN112011521A (en) Novel recombinant newcastle disease virus vector coronavirus vaccine candidate strain as well as construction method and application thereof
CN113373179A (en) Recombinant VSV virus expressing SARS-CoV-2 spike protein (S) or its variant and its construction and application
CN110951778B (en) CDV-3 strain infectious cDNA clone of canine distemper virus, construction method and application thereof
CN112852758B (en) Recombinant Newcastle disease virus for expressing avian infectious bronchitis virus S protein and preparation method and application thereof
CN114292823A (en) Recombinant LaSota vaccine strain carrying genes VII type Newcastle disease virus F and HN genes and construction method and application thereof
CN118531067A (en) Novel chimpanzee adenovirus vector and construction method and application thereof
CN102816741A (en) Preparation method and application of newcastle disease virus living-vector vaccine through gene recombination of canine distemper attenuated vaccine strains F and H
CN115948343A (en) Steady transfer cell strain for expressing rabies virus glycoprotein and construction method and application thereof
CN106119207B (en) IBV Vero cell adapted strain constructed based on reverse genetic technology
CN114410593A (en) Large-scale production process of recombinant novel coronavirus vaccine with measles virus as vector
CN114381437A (en) Method for producing rabies virus pseudovirus system by using stable cell line capable of inducing expression of rabies virus protein
CN114213547A (en) Fusion protein for displaying new crown S protein, recombinant virus particle and application thereof
McClenahan et al. Expression and self-assembly of virus-like particles from two genotypes of marine vesiviruses and development of an ELISA for the detection of antibodies
CN113416714A (en) Recombinant virus for expressing Ebola GP protein and preparation method and application thereof
CN116410991B (en) Recombinant nucleic acid molecules, recombinant vectors and recombinant viruses of vesicular stomatitis virus and novel coronavirus and application of recombinant nucleic acid molecules, recombinant vectors and recombinant viruses
CN116478939B (en) Recombinant avian poxvirus for expressing avian encephalomyelitis virus P1 and 3C genes and construction method thereof
CN108642019A (en) A kind of recombinant rabies oral vaccine strain and preparation method thereof of resistance to gastrointestinal tract degradation

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant