CN113817753A - Expression of SARS-CoV-2 spike protein or its variant SΔ21Construction and application of pseudotyped VSV (VSV virus) - Google Patents

Expression of SARS-CoV-2 spike protein or its variant SΔ21Construction and application of pseudotyped VSV (VSV virus) Download PDF

Info

Publication number
CN113817753A
CN113817753A CN202111044750.5A CN202111044750A CN113817753A CN 113817753 A CN113817753 A CN 113817753A CN 202111044750 A CN202111044750 A CN 202111044750A CN 113817753 A CN113817753 A CN 113817753A
Authority
CN
China
Prior art keywords
protein
vsv
virus
cov
sars
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202111044750.5A
Other languages
Chinese (zh)
Other versions
CN113817753B (en
Inventor
孙涛
张宝红
柯勇
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanghai Jiaotong University
Original Assignee
Shanghai Jiaotong University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Jiaotong University filed Critical Shanghai Jiaotong University
Priority to CN202111044750.5A priority Critical patent/CN113817753B/en
Publication of CN113817753A publication Critical patent/CN113817753A/en
Application granted granted Critical
Publication of CN113817753B publication Critical patent/CN113817753B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6854—Immunoglobulins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/20011—Rhabdoviridae
    • C12N2760/20211—Vesiculovirus, e.g. vesicular stomatitis Indiana virus
    • C12N2760/20221—Viruses as such, e.g. new isolates, mutants or their genomic sequences
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/20011—Rhabdoviridae
    • C12N2760/20211—Vesiculovirus, e.g. vesicular stomatitis Indiana virus
    • C12N2760/20234—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/20011—Rhabdoviridae
    • C12N2760/20211—Vesiculovirus, e.g. vesicular stomatitis Indiana virus
    • C12N2760/20241—Use of virus, viral particle or viral elements as a vector
    • C12N2760/20243—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/20011—Coronaviridae
    • C12N2770/20022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/20011—Coronaviridae
    • C12N2770/20034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host

Abstract

The present invention provides a method for expressing SARS-CoV-2 spike protein or its variant SΔ21Constructing and applying the pseudotyped VSV virus; the construction comprises the following steps: knocking out a G protein gene of VSV responsible for recognizing a host cell receptor, and constructing a pseudotyped VSV virus through an S protein of SARS-CoV-2 or a variant S delta 21 protein thereof; S.DELTA.21 is cellS protein variants with 21 amino acids deleted from the inner region. The recombinant VSV constructed by the invention is an S protein variant obtained by correspondingly deleting S protein of SARS-CoV-2 virus and the carboxyl terminal of the S protein, so that the virus does not involve live virus and the biological safety problem cannot be caused; in the invention, besides constructing VSV with wild M protein as framework, a new idea is provided, namely, the recombinant VSV virus constructed by using M protein can be used for developing vaccines and detecting SARS-CoV-2 virus specific neutralizing antibodies in human and animal bodies.

Description

Expression of SARS-CoV-2 spike protein or its variant SΔ21Construction and application of pseudotyped VSV (VSV virus)
Technical Field
The invention relates to the technical field of research on novel coronavirus, in particular to a pseudotyped VSV for expressing SARS-CoV-2 spike protein (S) or a variant thereof and construction and application thereof; in particular to a recombinant Vesicular Stomatitis Virus (VSV) which expresses the fiber protein (S) of SARS-CoV-2 or the carboxyl terminal of the fiber protein (S) is deleted, and the construction and the application thereof.
Background
The family coronaviridae is divided into four genera, alpha, beta, gamma and delta, depending on the serotype and genomic characteristics. CoV-2 belongs to the genus beta coronavirus, which also comprises middle east respiratory syndrome associated coronavirus (MERS-CoV) and severe respiratory syndrome associated coronavirus (SARS-CoV), and the systematic evolution analysis of CoV-2 full-length genome shows that the similarity of the novel coronavirus and SARS virus is higher than that of MERS virus.
The CoV-2 genome is single-strand positive-strand RNA, is about 29.8Kb in length, has an Open Reading Frame (ORF) 1ab encoding a replicase complex at the 5' end, occupies about 2/3 of the whole genome, and encodes non-structural proteins such as polymerase; the post 1/3 region encodes Spike protein (S), vesicle Membrane protein (E), Membrane protein (M) and Nucleocapsid protein (N). The spike protein (S) is embedded into the surface of the envelope of the virion in the form of trimer, is responsible for the binding of the virus with host cell surface receptors, is the most important neutralizing protective antigen of coronavirus, and is the most main target antigen for vaccine development. Recent studies have shown that the receptors for CoV-2 are the same as SARS-CoV and are angiotensin converting enzyme 2(ACE2), however, amino acid sequence analysis of the S protein of coronavirus also shows that the 5 key amino acid sites where the SARS S protein interacts with ACE2 are changed in 4 of CoV-2 coronavirus. This suggests that there may be significant changes in the immunogenicity of the virus between the two.
The most effective method for preventing viral infection is to use vaccines, but effective vaccines and mature techniques for controlling human coronavirus infection are still lacking. Coronaviruses have high variability, on one hand, the coronaviruses belong to RNA viruses, the RNA replicase error correction capability of the coronaviruses is low, and gene mutation is easy to cause, and on the other hand, gene recombination can occur among coronavirus strains, so that the difficulty of vaccine development is increased. Therefore, if a general technical platform for rapidly developing vaccines can be constructed, the method is helpful for dealing with the outbreak of epidemic situations. The current commonly used vaccine development method comprises inactivated vaccine and attenuated vaccine, the preparation of the inactivated vaccine needs to culture a large amount of virus and uses the inactivated vaccine after inactivation, and the method has extremely high production safety requirements on highly pathogenic virus such as SARS and the like and needs to be carried out in a biosafety level 3 laboratory. The virus is cultured on a large scale, and a huge disaster is generated once the virus leaks; in addition, inactivated vaccines require multiple vaccinations, take a long time to produce efficacy, and do not efficiently elicit mucosal immunity. Although the human novel coronavirus (CoV-2) has been successfully isolated and cultured in vitro by VeroE6 cells, the high-level production of the virus still needs to fully optimize culture conditions, including a proper cell line and the like. The method for obtaining attenuated live vaccine virus strain includes traditional cell passage method and gene engineering technology to make virus virulence gene be deleted, but the attenuated live vaccine with lost virulence may be reversed into pathogenic strain, the coronavirus is easy to be recombined in field, the attenuated mutant strain can be recombined with wild strain under natural condition to obtain virulence again. Among these, efficient expression of the key protective antigens of CoV-2 by means of safe and technically mature viral vectors may be an effective solution. Currently, commonly used viral vectors include: DNA viral vectors (e.g., adenovirus, poxvirus); retroviral vectors (e.g., lentiviruses) and RNA viral vectors (e.g., vesicular stomatitis virus and measles virus).
In 1996, the John Rose topic group established Vesicular Stomatitis Virus (VSV) Rescue (Rescue) technology, and through genetic engineering transformation, VSV has become a safe and efficient vaccine vector at present and is used for the development of vaccines for pathogens which are difficult to culture in vitro and have strong pathogenicity, such as HIV, HCV and the like. Advantages of VSV viral vectors include, among others: 1. the medicine is non-pathogenic to human and is safe; as an RNA virus, does not cause transformation of host cells; 2, the macromolecular foreign protein can be efficiently expressed; 3. the organism can be quickly stimulated to generate comprehensive immune response including mucosal immune, cellular and humoral immune response by single inoculation; 4. BHK21 cells used to expand VSV can be cultured in high density suspension. This provides an advantage of unique value for commercial production of VSV recombinant vaccines. In recent years, the recombinant VSV has made a breakthrough in the development and application of human emergency immunity vaccines, and the vaccines developed by using the recombinant VSV as a vector to express Ebola virus envelope Glycoprotein (GP) are put into clinical application, so that effective immunity protection can be obtained after a primate is inoculated with the vaccines for 5 days once, and the primate can withstand the attack of lethal dose of Ebola virus; in the aspect of coronavirus, the applicant also previously developed a VSV live vector vaccine expressing porcine coronavirus, namely Porcine Epidemic Diarrhea Virus (PEDV) spike protein (S), and animal experiments show that the vaccine can stimulate good immunoprotection in pigs. These successful experiences show that VSV viral vectors may be a good platform for the development of CoV-2 coronavirus vaccines. Unlike adenovirus vectors, human nature does not contact VSV, and there are no antibodies to VSV in vivo, and therefore, the vaccine administered is not disturbed.
VSV belongs to rhabdovirus, has a genome of approximately 11kb, and encodes 5 structural proteins including RNA replicase (L), phosphorylated protein (P), nucleocapsid protein (N), envelope protein (G), and matrix protein (M). The G protein is responsible for recognizing viral receptors and mediating viral entry into host cells, which determines the tropism of VSV; the M protein can be distributed in cell nucleus to block the transport of host cell mRNA to cytoplasm, thereby playing the role of inhibiting the expression of I-type interferon and the like, and being the most important virulence factor of the virus. For viral vectors, safety is of the greatest concern. At present, applicants and others have constructed a series of highly attenuated VSV viral vectors around the M and G proteins, e.g., the subject applicants have previously successfully constructed a double site mutant recombinant VSV virus (VSV) in which both the M and G proteins are presentΔM51-GΔ28) And a novel recombinant VSV virus (VSV) with M protein three-site amino acid mutationMT). These VSV vectors have further improved safety compared to wild-type VSV. Ebola virus vaccineTwo other strategies were adopted in development, including: pseudotyping VSV with the capsular Glycoprotein (GP) of Ebola virus, a strategy used by Merck for vaccine production, to alter VSV tropism; another strategy is to replace VSV N protein gene with Ebola virus GP protein gene and transfer the N gene to VSV M gene to obtain rVSVGP1N4 virus, which not only improves the integration efficiency of GP protein into VSV cyst membrane, but also improves the safety of VSV.
The spike protein (S) of coronavirus is a type I Transmembrane glycoprotein with a molecular weight of about 200kDa, and its structure includes a signal peptide at the N-terminus, an extracellular segment (Ectodomain, ET), a Transmembrane segment (TM), and an intracellular segment (cytoplasmic tail, CT). Research shows that the S protein induces neutralizing protective antibody is highly dependent on the integrity of spatial conformation, even the protein is embedded into the envelope to form trimer, and single or tandem epitope and S1 or S2 subunit are difficult to exert effective protective effect, so that how to prepare the S protein with natural conformation in large quantity by using genetic engineering technology is always a difficult problem for related vaccine development. The applicant of the subject application has shown that after cloning the full-length S gene of PEDV into VSV genome, virus could not be rescued, but when the carboxyl terminal 19 amino acids of the intracellular segment of the S protein were knocked out, the S protein could be successfully embedded into VSV envelope. This is in contrast to the carboxyl-terminal conserved double base motif (motif) structure on proteins: KxHxx. This motif structure allows the S protein to be localized to the Endoplasmic Reticulum Golgi Intermediate Compartment (ERGIC), rather than to the cell membrane surface, which would affect efficient insertion of the coronavirus S protein into the envelope of VSV and ultimately interfere with the rescue of recombinant VSV, since budding of VSV occurs at the cell membrane. Our studies also show that since the PEDV S protein is only deprived of the carboxy-terminal amino acids, its extracellular and transmembrane domains remain intact and can be integrated into the VSV envelope, and animal experiments also demonstrate that S protein immunogenicity is unaffected. The CoV-2S protein contains 1273 amino acids, and protein structure analysis shows that a KxHxx motif structure (AA1269-1273) is also present at the carboxyl terminal, which is very likely to interfere with the rescue of recombinant VSV, so how to optimize the length of the intracellular segment of the S protein of CoV-2 is one of the keys for constructing a VSV live vector vaccine.
In addition, accurate and rapid diagnosis of patients is critical to controlling epidemic in the current absence of vaccines and effective drugs. Common diagnostic methods for pathogen infection include: (1) detection of pathogen proteins, nucleic acids; (2) specific antibody detection in infected persons, such as: ELISA, colloidal gold sensitive test paper and detection of neutralizing antibody. Currently, the diagnosis of CoV-2 infected or suspected patients relies primarily on nucleic acid detection, but the method uses personnel who are limited by the number of biosafety class 3 laboratories (P3) capable of supporting clinical testing and the ability to perform skilled and robust procedures; in addition, the type of sample, the method of collection, transportation and storage of the sample, the method of nucleic acid (RNA) extraction, the accuracy and stability of the detection equipment (PCR instrument or real-time PCR instrument) can affect the detection.
In response to these problems, companies have developed methods for detecting specific antibodies in vivo, including sensitive test strips and ELISA kits. Unlike conventional ELISA which detects total IgG or IgM antibodies in serum, the detection of neutralizing antibodies reflects the level of antibodies having protective effects in vivo, and thus has a unique diagnostic significance clinically. Therefore, the method is suitable for a wide variety of samples, including virus-inactivated blood, respiratory mucus, lung lavage fluid and the like. In addition, compared with nucleic acid detection, the detection of the neutralizing antibody is less interfered by environmental and instrument pollution, has high specificity, can be used for screening patients which are asymptomatic or have latent period and the like and are difficult to confirm by a nucleic acid method, and can help to control the spread of new coronavirus from a source. In the future, the detection of neutralizing antibodies will also be able to be used for tracing the animal natural host and the intermediate host of the COV-2 virus without developing a corresponding ELISA kit for each animal; the method also has wide application prospect for clinical and scientific researches depending on neutralizing antibodies for evaluation, such as antibody therapy, vaccine development and the like.
However, detection methods based on neutralizing antibodies also present some bottleneck problems, including: (1) neutralizing antibody detection usually requires the use of the original live virus, for highly pathogenic viruses like CoV-2, which means that the relevant detection needs to be performed at the P3 laboratory; (2) the result judgment depends on the obvious lesion (CPE) of the cells and has certain subjectivity; (3) coronavirus replicates at a slower rate and CPE determination time is typically 72 hours. These problems have all greatly limited the use and spread of detection methods for neutralizing antibodies.
Disclosure of Invention
Aiming at the defects of the prior art, the invention aims to provide a recombinant VSV virus for expressing SARS-CoV-2 spike protein (S) or a variant thereof, and construction and application thereof. The invention implements the required SARS-CoV-2 virus S gene to carry out whole gene synthesis according to the virus strain sequence (GenBank accession No. MN908947) published on NCBI, the codon of the synthesized gene is optimized according to the codon of human cells, on this basis, the length of the intracellular region segment of SARS-CoV-2S protein is optimized, the structural activity of KxHxx motif at the carboxyl end is removed, the S protein is efficiently embedded into VSV cyst membrane, recombinant VSV virus is constructed, live vector vaccine is constructed according to the constructed, and the detection method and the product for quickly detecting SARS-CoV-2 specific neutralizing antibody with high flux are established.
The purpose of the invention is realized by the following technical scheme:
in a first aspect, the present invention provides a SARS-CoV-2 virus S gene for high expression and for construction of a novel corona vaccine based on a recombinant vesicular stomatitis virus, the SARS-CoV-2 virus S gene is artificially synthesized from the whole gene, and the codon of the synthesized gene is optimized according to the codon of human cells. The sequence is shown as SEQ ID NO. 1.
In a second aspect, the present invention also provides a method for constructing a recombinant vesicular stomatitis virus VSV expressing a novel human coronavirus SARS-CoV-2 spike protein S, the method comprising: knocking out a G protein gene of VSV responsible for recognizing a host cell receptor, and constructing a pseudotyped VSV virus through an S protein of SARS-CoV-2 or a variant S delta 21 protein thereof; S.DELTA.21 is an S protein variant lacking 21 amino acids in the intracellular domain (CT).
As an embodiment of the present invention, the method comprises:
s1, constructing a pseudotyped VSV for expressing S protein of SARS-CoV-2 or a variant S delta 21 thereof by using wild type VSV as a vector; S.DELTA.21 is an S protein variant with 21 amino acids deleted from the intracellular region (CT);
s2, adopting the highly weakened and safe VSV virus with M three-site mutation as a vector to construct a pseudotyped VSV virus expressing S protein of SARS-CoV-2 or a variant S delta 21 thereof; S.DELTA.21 is an S protein variant with 21 amino acids missing from the intracellular region (CT); because the mutation of the M protein causes the high attenuation of the VSV vector, the prepared recombinant new corona vaccine is safer.
As one embodiment of the present invention, the sequence of the S protein encoding SARS-CoV-2 is shown in SEQ ID NO. 1.
As an embodiment of the invention, the construction method of the recombinant vesicular stomatitis virus VSV for expressing the novel human coronavirus SARS-CoV-2 spike protein S of the invention comprises the following specific steps:
a1, construction of recombinant plasmid:
a11, performing base knockout on SARS-CoV-2 virus S gene (and obtaining optimized length) to obtain S protein mutant S delta 21;
a12 construction of plasmid pVSV for cloning the full-length genome sequence of VSV Indiana strainINDOr pVSVMT；
a13, carrying out high fidelity PCR amplification on the S or S delta 21 gene, respectively carrying out MluI and XhoI enzyme cutting sites at the 5 'end and the 3' end, respectively cloning to pVSV after double enzyme cuttingIND、pVSVMTIn the plasmid, the G gene in VSV was replaced with the S or S.DELTA.21 gene to obtain recombinant plasmid pVSVΔG-S、pVSVΔG-SΔ21、pVSVMTΔG-S or pVSVMTΔG-SΔ21；
A2, virus preparation:
a21, infecting BHK21 cells by poxvirus vTF 7-3 at an MOI of 5, and removing poxvirus after 1-1.5 hours;
a22, transforming the recombinant plasmid pVSVΔG-S、pVSVΔG-SΔ21、pVSVMTΔG-S or pVSVMTΔG-S.DELTA.21 is in turn linked to the helper plasmid pBS-G,pBS-N, pBS-P, pBS-L is mixed to prepare plasmid transfection mixed liquor;
a23, co-transfecting the plasmid transfection mixture into the BHK21 cells in the step a 21;
a24, transfecting a fresh BHK21 cell by using a plasmid pVSV-G expressing VSV G protein to obtain the BHK-G cell;
a25, collecting the cell supernatant obtained in the step a23, filtering vTF 7-3 virus, adding the obtained filtrate into BHK-G cells for amplification, and collecting the cell supernatant with pathological changes after 2-3 days;
a26, purifying cell supernatant collected in the step a25 by plaque, and then amplifying and identifying by VeroE6 cells to obtain the pseudotyped VSV virus.
In a third aspect, the present invention also provides a recombinant VSV virus expressing the S protein of SARS-CoV-2 or a variant thereof, constructed by the aforementioned method.
In a fourth aspect, the invention also provides an application of the recombinant VSV virus expressing the S protein of SARS-CoV-2 or the variant thereof in preparing a novel coronavirus vaccine.
In the fifth aspect, the invention also provides the application of the recombinant VSV virus expressing the S protein of SARS-CoV-2 or the variant thereof in preparing a novel coronavirus specific neutralizing antibody diagnostic product.
As an embodiment of the invention, the diagnostic product comprises a diagnostic test strip and a diagnostic kit.
Compared with the prior art, the invention has the following beneficial effects:
1. the present invention successfully constructs recombinant VSV virus expressing SARS-CoV-2S protein or its mutant, and aims at SARS-CoV-2 virus S protein, so that it does not relate to SARS-CoV-2 live virus and will not produce biological safety problem.
2. The invention successfully develops the VSV live vector vaccine which can quickly stimulate the specific immunity of SARS-CoV2, in particular the mucosal immunity, through the constructed recombinant VSV virus, and provides a platform for quickly and efficiently developing the vaccine for developing new coronavirus in the future; moreover, the VSV vector vaccine is easy to amplify in vitro, and BHK-21 cells used for amplifying the virus can be subjected to high-density suspension culture, so that great advantages are provided for the industrial and large-scale production of the vaccine in the future.
3. The invention establishes a corresponding detection method of the specific neutralizing antibody of the new coronavirus and a corresponding diagnostic product through the constructed recombinant VSV. The detection is not required to be carried out in a P3 laboratory, and the result judgment is carried out through a fluorescence signal, so that the detection is objective and accurate; VSV infects in cells, replication speed is fast, therefore, the whole detection process can obtain results within 16-24 hours and realize high-throughput quantification, and is suitable for large-scale screening and confirming whether asymptomatic or latent patients exist in the population; in addition, researchers can use this method to look for evidence of infection in stored human blood samples, which helps to trace back the time and place of outbreak of new coronary pneumonia. Moreover, the method is suitable for detecting different types of samples, such as neutralizing antibodies contained in serum, respiratory mucus and lung lavage fluid, is particularly suitable for detecting IgM and mucosal IgA antibodies in early infection because the method is not specific to the type of the specific antibodies, and is beneficial to improving the specificity and sensitivity of detection.
Drawings
Other features, objects and advantages of the present invention will become more apparent upon reading of the detailed description of the non-limiting embodiments with reference to the following drawings:
FIG. 1 is a structural diagram of the S protein of a novel coronavirus; wherein SS is a signal peptide sequence; ectodomian: an extracellular domain of a protein; TM: a protein transmembrane region; CT: an intracellular domain of a protein;
FIG. 2 is a schematic diagram of the genomic structure of a recombinant VSV virus of the present invention; wherein (A) is S delta 21 protein pseudotyping each recombinant VSV; (B) pseudotyping each recombinant VSV for the S protein; n is nucleocapsid protein; p is phosphorylated protein; m: a matrix protein; g: a capsular protein; l: a viral RNA replicase; s: CoV-2S protein (codon optimized); s Δ 21: a new coronavirus SARS-CoV 2S protein mutant (a mutant with 21 amino acids deleted from the intracellular region (CT) of the S protein); mT: m protein with three-site mutation (51 th methionine is knocked out, 221 th valine is mutated into phenylalanine, and 226 th glycine is mutated into arginine);
FIG. 3 is a schematic diagram of the differenceSchematic diagram for identifying the mechanism that the recombinant VSV viral vector expresses the fiber protein of the new coronavirus; expressing new coronavirus S protein recombinant VSV to infect VeroE6 cell in different preparation mechanisms, collecting cell lysate, and performing Western-blotting identification with antibody specific to new coronavirus spike protein S1 subunit; wherein, lane1. no virus cell lysate was inoculated (negative control); lane 2.VSVMTΔG-SΔ21Infecting VeroE6 cell lysate; lane 3.VSVΔG-SΔ21； Lane 4.VSVΔG-S infection of VeroE6 cell lysates; the arrow indicates S for fiber protein of SARS-SARS-CoV2 virus strain, S1 is S1 subunit of S protein;
FIG. 4 shows VSVΔG-S SΔ21Viral infection of Hela-ACE2 and Hela cell profile; wherein, A. VSVΔG-SΔ21Infection of Hela cells, B.VSVΔG-SΔ21Infection of Hela-ACE2 cells, large syncytia mediated by the S protein as indicated by the arrow;
FIG. 5 shows VSVΔG-S-GFP virus infects VeroE6 cell map; wherein, A. fluorescent microscope observation VSVΔG-S-GFP infects VeroE6 cells, and the arrow indicates the huge syncytia mediated by the S protein; B. bright field visual field observation VSVΔG-S-GFP infected VeroE6 cells, and the arrow indicates syncytia.
Detailed Description
The present invention will be described in detail with reference to specific examples. The following examples will assist those skilled in the art in further understanding the invention, but are not intended to limit the invention in any way. It should be noted that it would be obvious to those skilled in the art that various changes and modifications can be made without departing from the spirit of the invention. All falling within the scope of the present invention.
In the invention, the full-length sequence of the fiber protein of the new coronavirus optimized according to the sequence of the virus strain (GenBank access No. MN908947) and the codon of a human cell is shown as SEQ ID No. 1. New coronavirus spike protein mutant gene S optimized according to virus strain sequence (GenBank accession No. MN908947) and human cell codonΔ21The carboxyl terminal of the amino acid has 21 amino acids deleted, and the sequence is shown as SEQ ID NO. 2.
The construction of the recombinant VSV virus of the invention comprises any one of the following methods:
1. with wild type VSV viral genome as backbone (VSV)IND) S protein by SARS-CoV-2 or its variant SΔ21Construction of a pseudotyped VSV Virus (VSV) in which the VSV G protein Gene is deleted, i.e., a S protein variant in which the carboxy terminus of the S protein is deleted by 21 amino acidsΔG-S、VSVΔG-SΔ21)；
2. With highly attenuated M three-site mutant VSV viral genome as backbone (pVSV)MT) S protein by SARS-CoV-2 or its variant SΔ21Protein construction of VSV pseudo-type VSV Virus (VSV) in which VSV G protein Gene was knocked outMTΔG-S、VSVMTΔG-SΔ21). The invention successfully constructs a novel recombined vesicular stomatitis virus at home and abroad for the first time to be used as a carrier for developing a novel coronavirus vaccine, three different amino acid sites of Matrix protein (Matrix, M) of the virus are mutated (as shown in figure 2), wherein the mutation comprises that 51 th methionine of the Matrix protein is knocked out, 221 th valine is mutated into phenylalanine, and 226 th glycine is mutated into arginine; VSVMTThe vaccine vectors achieve a high attenuation compared to wild-type VSV vaccine vectors, with VSVMTThe novel corona vaccine constructed for the vector is safer.
See the following examples for details:
preparation example 1: optimizing the length of SARS-CoV-2S protein intracellular section (CT) to make it embed into VSV cyst membrane efficiently
The SARS-CoV-2 virus S gene required by this embodiment is synthesized as a whole gene according to the virus strain sequence published on NCBI (GenBank accession No. MN908947), the codon of the synthesized gene is optimized according to the human cell codon (SEQ ID NO.1), the sequence is published for the first time, and experiments prove that the optimized sequence can be expressed at a higher level compared with the spike protein S gene sequence of the original new corona virus strain, which shows that we successfully use the sequence to construct a novel new corona vaccine based on the recombinant vesicular stomatitis virus. The coronavirus S protein structure is shown in FIG. 1, and it is a type I Transmembrane protein, which comprises four parts of a signal peptide at the N-terminal, an extracellular region (Ecotdomain, ET), a Transmembrane region (TM), and an intracellular region (cytoplasmic tail, CT). A KxHxx motif structure exists at the carboxyl terminal (AA1269-1273) of the CoV-2S protein, 21 amino acids of an intracellular segment of the S protein are knocked out at the carboxyl terminal of the S protein in the embodiment, so that the KxHxx motif structure is eliminated, and an S protein mutant is obtained and is named as S delta 21(SEQ ID NO. 2). The S protein variants enable efficient integration of the S protein into the intracellular segment of the VSV envelope and are therefore useful for subsequent recombinant VSV development.
Specifically, amplifying the codon-optimized S protein gene by using high-fidelity PCR enzyme to obtain a corresponding S protein gene;
designing a primer: underlined are the corresponding sequences of the S protein gene
An upstream primer: 5' CTAACAGATATCACG CTCGAGATGTTCGTTTTCCTTGTT 3’(SEQ ID NO.3)
A downstream primer: 5' AACATGAAGAATCTG GCTAGCTCA TTATGTGTAATGCAGCTT 3’(SEQ ID NO.4)
Knocking out 21 amino acids of the intracellular segment of the S protein from the carboxyl terminal of the S protein to obtain a corresponding S protein mutant S delta 21;
designing a primer: underlined are the corresponding sequences of the S protein gene
An upstream primer: 5' CTAACAGATATCACG CTCGAGATGTTCGTTTTCCTTGTT 3’(SEQ ID NO.5)
A downstream primer:
5’AACATGAAGAATCTG GCTAGC TCA TTATGATCCGCAAGAGCAGCAT3’ (SEQ ID NO.6)
preparation example 2: pVSVΔG-S、pVSVΔG-SΔ21Construction of recombinant plasmids
1. Construction of pVSVINDA plasmid cloned with the full-length genome sequence of a VSV Indiana strain;
2. performing high-fidelity PCR amplification on the S or S delta 21 gene, wherein the 5 'end and the 3' end respectively contain MluI and XhoI enzyme cutting sites, and cloning the gene to pVSV after double enzyme cuttingINDIn the plasmid, SΔ21Replacing G gene in VSV with gene to obtain recombinant plasmid pVSVΔG-S or pVSVΔGS.DELTA.21, e.g.As shown in fig. 2.
Preparation example 3: pVSVMTΔG-S、pVSVMTΔGConstruction of-S.DELTA.21 recombinant plasmid
1. Construction of pVSVMTPlasmid, wherein the plasmid clones a genome sequence of VSV Indiana strain after M three-site mutation;
2. performing high-fidelity PCR amplification on the S or S delta 21 gene, wherein the 5 'end and the 3' end respectively contain MluI and XhoI enzyme cutting sites, and cloning the gene to pVSV after double enzyme cuttingMTObtaining a recombinant plasmid pVSV in the plasmidMTΔG-S or pVSVMTΔGS Δ 21, as shown in FIG. 2.
Preparation example 4: recombinant VSV virus preparation
1. Infecting BHK21 cells with poxvirus vTF 7-3 expressing the T7 RNA polymerase gene at an MOI of 5, and removing the poxvirus after 1 hour;
2. plasmid transfection mixed solution is prepared while infecting virus, and is obtained by mixing the recombinant plasmid prepared in the embodiment 2 and 3 and the auxiliary plasmid pBS-G, pBS-N, pBS-P, pBS-L;
3. co-transfecting the vTF 7-3 of the step 1 with the grain transfection mixed solution to infect the BHK21 cells, and replacing the cell culture solution about 4 hours after transfection;
4. transfecting fresh BHK21 with plasmid pVSV-G expressing VSV G protein to obtain BHK-G cells;
5. collecting the cell supernatant obtained in the step 3, filtering out vTF 7-3 virus by using a filter membrane with the aperture of 0.2um, and adding the filtrate to the VeroE6 cells prepared in the step 4 for subsequent virus amplification; observing cytopathic effect, and collecting diseased cell supernatant after 2-3 days to obtain corresponding recombinant VSV virusesΔG-SΔ21、VSVΔG-S、VSVMTΔG-SΔ21And VSVMTΔG-S virus;
6. the recombinant VSV virus is plaque purified, amplified by VeroE6 cell, identified and frozen for use.
The identification examples:
1. western-blotting identification of recombinant virus structural protein by using VSV recombinant virus VSVMTΔG-SΔ21、 VSVΔG-SΔ21、VSVΔGS infects the cell, the cell lysate is collected and Western-blotting identification is carried out by using the specific antibody of the S protein of the mouse anti-SARS-CoV 2 virus; the results are shown in FIG. 3.
2.VSVΔG-tropism identification of S virus. A stable cell line expressing human ACE2 protein (Hela-ACE 2) using Hela cell line; with VSVΔG-S infection of Hela-ACE2 and Hela cells, respectively, immunohistochemical staining of cells for CPE and VSV antibody specificity, pseudotyped virus VSVΔG-determining tropism for S; the results are shown in FIG. 4.
First effect verification: detection of the immunopotency of novel coronavirus vaccinated mice
4 recombinant VSV viruses constructed in the above preparation examples 2 to 3 were inoculated into human ACE2 gene C57 mice, and the evaluation of the immunological potency included: specific immune (bronchoalveolar lavage fluid sIgA antibody) protective antibody, and mucosal neutralizing antibody detection is performed by adopting S protein pseudotyped lentivirus.
1. Grouping and immunization of animals
The experimental animals are mice transformed with human ACE2 gene C57, the weight of which is about 20g, and the experimental animals are divided into 5 groups and inoculated in a nasal drip mode. As shown in Table 1, the experimental groups were divided into four groups (group 1 to group 4) and immunized with the recombinant viruses described above, 12 animals per group were inoculated with 10 animals4PFU/50. mu.l dose of virus; the control group consisted of 12 vaccinated PBS mice.
2. Collection of Experimental animal samples
Collecting blood from eye orbit of each group of mice before and 14 days after immunization, and separating serum; animals were sacrificed and bronchoalveolar lavage fluid was collected for protective mucosal immune antibody detection and samples were stored at-70 ℃.
3. Specific mucosal immunoprotective antibody detection
(1) Centrifuging the collected sample at 4 ℃ at 2000r/min to remove red blood cells and impurities;
(2) correspondingly diluting a sample by using a DPBS buffer solution, adding isovolumetric new coronavirus pseudotyped non-replicative lentivirus containing 100IU of expressed GFP, mixing, placing in an incubator at 37 ℃ for incubation for 1h, and adding 80-90% of full 96-hole 293T-ACE2 stable cells;
(3) incubating at 37 deg.C for 1-2 h; discarding the incubation liquid, washing with DPBS for 1-2 times, adding fresh serum-free DMEM culture liquid into each well, culturing for 48 hours, observing by a fluorescence microscope, photographing, recording results, determining that the antibody is negative when green fluorescence exists and the antibody is positive when the antibody is not positive when the green fluorescence exists, and calculating the titer of the neutralizing antibody.
5. The result of analyzing the detection result of the sample shows that the VSVΔG-SΔ21、VSVΔG-S、VSVMTΔG-SΔ21And VSVMTΔGThe S virus can effectively stimulate mice transformed with human ACE2 gene C57 to produce specific new crown antibodies, as shown in Table 1.
TABLE 1
Figure BDA0003250755580000111
And (5) effect verification: human body immunity domestic new corona vaccine neutralizing antibody detection
1. pVSV obtained in preparation examples 2 and 3ΔGThe eGFP gene is cloned between G and L genes by using XhoI and NheI enzymes to obtain a recombinant plasmid pVSV containing green fluorescent protein gene GFPΔG-S-GFP; then, the recombinant virus VSV was obtained by the virus rescue method of preparation example 4ΔG-S-GFP；
2. Collecting samples such as blood and respiratory mucus, inactivating viruses, and centrifuging at 4 deg.C at 2000r/min to remove erythrocytes and impurities;
3. samples were diluted accordingly with DPBS buffer, collected whole blood serum was diluted by 1:5, 1:10, 1:20, 1:40, 1:80, 1:160, 1:320,1:640 in multiples, and an equal volume of VSV containing 100 PFU was added, using blood from a healthy human as controlΔGMixing S-GFP, incubating in a 37 ℃ incubator for 1h, adding a 96-well VeroE6 cell culture plate which is 80-90% full, and incubating at 37 ℃ for 1-1.5 h; discarding the incubation liquid, washing with DPBS for 1-2 times, adding fresh serum-free DMEM culture liquid into each hole,
culturing in an incubator at 4.37 ℃ for 24 hours, observing by a fluorescence microscope, photographing, recording results (as shown in figure 5), determining that the antibody is negative when the green fluorescence exists, determining that the antibody is positive when the green fluorescence does not exist, and calculating the titer of the antibody;
5. analyzing the detection result of the sample. The results of the detection of the neutralizing antibody titer of human serum inoculated with the domestic new corona vaccine are shown in Table 2, and the results show that the replication type pseudotyped VSV expressing green fluorescent protein GFP is usedΔThe method for establishing the G-S-GFP can be used for detecting the neutralizing antibody titer of the immune human serum of the domestic new crown vaccine, and has a good application prospect for establishing a more reliable and effective vaccine immune effect evaluation index in the future.
TABLE 2
Figure BDA0003250755580000112
Figure BDA0003250755580000121
The invention has many applications, and the above description is only a preferred embodiment of the invention. It should be noted that the above examples are only for illustrating the present invention, and are not intended to limit the scope of the present invention. It will be apparent to those skilled in the art that various modifications can be made without departing from the principles of the invention and these modifications are to be considered within the scope of the invention.
Sequence listing
<110> Shanghai university of transportation
<120> construction and application of pseudotyped VSV virus expressing SARS-CoV-2 spike protein or its variant S delta 21
<130> DD16269
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 3822
<212> DNA
<213> New coronaviruses (SARS-CoV2 Wuhan-Hu-1)
<400> 1
atgttcgttt tccttgttct gttgcctctc gttagtagcc aatgcgtcaa ccttactact 60
agaacccagc tccctccagc atataccaac tctttcacca ggggcgtata ttacccggac 120
aaagtgttcc gctcaagtgt gctgcattct acgcaggacc ttttcttgcc ctttttcagt 180
aatgttactt ggtttcatgc tatccatgtg tctggaacta acggaaccaa gcgctttgac 240
aaccccgtcc tccctttcaa cgatggcgtg tacttcgctt ccacggaaaa gtcaaacata 300
attcgcggct ggatctttgg tacaacactc gactcaaaga cgcagagcct gctgatcgtt 360
aataacgcta caaatgttgt gataaaggtg tgtgaatttc agttctgcaa tgatcccttc 420
ctgggtgtgt actaccataa gaataacaag agctggatgg aatccgaatt tagggtttac 480
agttccgcta acaactgcac attcgaatac gtaagccagc catttcttat ggatcttgag 540
ggcaagcaag gaaacttcaa gaacttgagg gagttcgtgt tcaaaaatat cgacggctat 600
tttaagatat atagcaagca cactccaata aacttggtgc gcgacctgcc ccagggattc 660
tctgctctgg agcccctggt ggatctgccc attggaataa acataactcg ctttcaaaca 720
ctgctcgccc tgcatcgcag ttacctcacc cctggtgata gtagttcagg atggacagca 780
ggagccgccg catactacgt cggctacctg cagcctagga ccttcttgct gaagtacaac 840
gagaacggta caataactga cgctgtggac tgcgctctgg accctctgtc cgagacgaag 900
tgcaccctga agagctttac tgttgaaaaa ggcatttacc aaaccagcaa cttccgcgtc 960
cagccaaccg agagcatcgt cagatttccc aacattacaa atctgtgtcc cttcggcgag 1020
gtgttcaacg ccacacgctt cgcttcagtg tacgcatgga accgcaagcg catatctaac 1080
tgcgtcgcgg attattctgt cctctacaac tccgcctctt tctccacctt caagtgctac 1140
ggagtgtcac cgactaagct gaacgatctc tgctttacca acgtctacgc ggactccttc 1200
gtgataagag gtgatgaagt gagacaaata gccccaggtc agactggtaa gatcgcagat 1260
tacaactaca aattgcctga tgatttcact ggttgcgtta tcgcgtggaa ctctaataac 1320
ctcgattcta aggtcggtgg taactacaat tacctgtacc gcttgtttag gaagtcaaac 1380
ctgaagcctt tcgagaggga tatttcaacc gaaatctatc aagcgggttc aacaccgtgt 1440
aacggtgtgg aaggatttaa ctgctacttc cccctgcagt cttacggatt ccagccaacc 1500
aatggcgtgg gttaccaacc ttatcgcgtg gtggttctga gtttcgaact gttgcacgct 1560
cccgccacgg tatgcggtcc caagaagagc actaacttgg tgaagaataa gtgcgtgaat 1620
ttcaatttca atggcctcac tggaactgga gtgctgaccg aatccaataa gaagttcttg 1680
cccttccagc agttcggaag agacattgct gacacaaccg acgcggtgcg cgatcctcag 1740
actctggaga tattggacat tacaccatgt tctttcggcg gtgtgtctgt cattactccg 1800
ggcacgaata ctagcaacca ggtagccgtg ctgtaccaag acgtgaattg cacagaggtt 1860
cccgtcgcaa ttcacgctga ccagctgacc cccacgtgga gggtttacag cactggtagt 1920
aacgtcttcc agacgagagc cggttgcttg atcggagcgg aacatgtgaa taactcctac 1980
gagtgcgaca tccccatcgg agccggtata tgcgcctctt atcagacaca aactaactca 2040
cccaggagag cccgcagtgt ggcttctcaa agcattatag catacactat gtctcttggt 2100
gccgaaaatt ccgtggccta ttctaacaat tcaatcgcca tcccaaccaa cttcacaatt 2160
agcgtgacta ccgaaatact gcctgtgagc atgacgaaaa ccagcgtaga ctgcactatg 2220
tatatctgtg gagactccac tgagtgctcc aaccttctcc tgcagtacgg tagcttctgt 2280
acccaattga accgcgccct tacaggcatc gctgttgagc aagataagaa tacccaggaa 2340
gtttttgccc aggttaagca gatatacaaa acaccgccca ttaaggactt cggaggcttc 2400
aacttctctc agatactgcc tgacccctcc aagccatcaa aacgcagctt cattgaggac 2460
ctcttgttca acaaagtgac tctggctgat gctggcttca ttaagcagta cggagattgc 2520
ctgggagata ttgctgccag ggacctcatc tgcgcccaga agtttaatgg cctgacagtc 2580
ttgcccccac ttctgacaga cgagatgatt gctcagtaca catctgccct cctcgctggc 2640
accataacat ccggatggac atttggtgct ggtgctgccc tccagattcc cttcgcaatg 2700
cagatggcgt atcgctttaa cggcatcggt gtcacacaaa acgtgttgta tgagaaccaa 2760
aagctcatcg ctaaccagtt taattctgct attggtaaga ttcaggacag cctgtcatca 2820
accgcgtctg cccttggtaa gttgcaggac gtggtgaacc agaatgctca ggctttgaat 2880
actctggtga agcaactctc ttcaaatttc ggcgctatct cttctgtgtt gaacgacatc 2940
ctgagtcgcc ttgataaggt ggaagctgaa gttcaaattg atagattgat tactggcagg 3000
ctccagtctt tgcagaccta cgttacacag cagctgatta gggcggctga aattagagct 3060
tccgccaatc tggctgcaac caagatgtcc gaatgcgtcc tgggtcagtc aaagcgcgtt 3120
gacttttgtg gtaaaggcta ccacctcatg tcatttcccc agtcagcacc tcacggagta 3180
gtgttcctcc acgtcaccta cgttccagca caggaaaaga attttaccac tgcgccggca 3240
atctgtcacg acggtaaggc acacttcccc cgcgagggcg tattcgtgtc taacggaact 3300
cattggttcg tcacacagag aaacttctat gagcctcaga tcattaccac cgacaataca 3360
tttgtgtccg gtaactgcga cgttgtgatt ggaatcgtca acaacactgt gtacgatcca 3420
cttcagccag aactggatag cttcaaggaa gaattggaca aatatttcaa aaatcacact 3480
tcacccgatg tggacctggg tgacattagt ggtatcaatg cgtccgtggt caatattcaa 3540
aaagagattg acaggctcaa cgaagtggcc aagaacctga acgaaagtct tatcgatctg 3600
caagaattgg gaaagtatga gcagtacatc aagtggccgt ggtacatttg gttgggtttt 3660
atcgccggtc tgatcgccat cgttatggtt accattatgc tttgctgcat gacgagctgt 3720
tgctcctgtc tgaagggatg ctgctcttgc ggatcatgtt gcaagttcga tgaagacgat 3780
agcgaaccag ttctgaaggg cgtcaagctg cattacacat aa 3822
<210> 2
<211> 3759
<212> DNA
<213> New coronaviruses (SARS-CoV2 Wuhan-Hu-1)
<400> 2
atgttcgttt tccttgttct gttgcctctc gttagtagcc aatgcgtcaa ccttactact 60
agaacccagc tccctccagc atataccaac tctttcacca ggggcgtata ttacccggac 120
aaagtgttcc gctcaagtgt gctgcattct acgcaggacc ttttcttgcc ctttttcagt 180
aatgttactt ggtttcatgc tatccatgtg tctggaacta acggaaccaa gcgctttgac 240
aaccccgtcc tccctttcaa cgatggcgtg tacttcgctt ccacggaaaa gtcaaacata 300
attcgcggct ggatctttgg tacaacactc gactcaaaga cgcagagcct gctgatcgtt 360
aataacgcta caaatgttgt gataaaggtg tgtgaatttc agttctgcaa tgatcccttc 420
ctgggtgtgt actaccataa gaataacaag agctggatgg aatccgaatt tagggtttac 480
agttccgcta acaactgcac attcgaatac gtaagccagc catttcttat ggatcttgag 540
ggcaagcaag gaaacttcaa gaacttgagg gagttcgtgt tcaaaaatat cgacggctat 600
tttaagatat atagcaagca cactccaata aacttggtgc gcgacctgcc ccagggattc 660
tctgctctgg agcccctggt ggatctgccc attggaataa acataactcg ctttcaaaca 720
ctgctcgccc tgcatcgcag ttacctcacc cctggtgata gtagttcagg atggacagca 780
ggagccgccg catactacgt cggctacctg cagcctagga ccttcttgct gaagtacaac 840
gagaacggta caataactga cgctgtggac tgcgctctgg accctctgtc cgagacgaag 900
tgcaccctga agagctttac tgttgaaaaa ggcatttacc aaaccagcaa cttccgcgtc 960
cagccaaccg agagcatcgt cagatttccc aacattacaa atctgtgtcc cttcggcgag 1020
gtgttcaacg ccacacgctt cgcttcagtg tacgcatgga accgcaagcg catatctaac 1080
tgcgtcgcgg attattctgt cctctacaac tccgcctctt tctccacctt caagtgctac 1140
ggagtgtcac cgactaagct gaacgatctc tgctttacca acgtctacgc ggactccttc 1200
gtgataagag gtgatgaagt gagacaaata gccccaggtc agactggtaa gatcgcagat 1260
tacaactaca aattgcctga tgatttcact ggttgcgtta tcgcgtggaa ctctaataac 1320
ctcgattcta aggtcggtgg taactacaat tacctgtacc gcttgtttag gaagtcaaac 1380
ctgaagcctt tcgagaggga tatttcaacc gaaatctatc aagcgggttc aacaccgtgt 1440
aacggtgtgg aaggatttaa ctgctacttc cccctgcagt cttacggatt ccagccaacc 1500
aatggcgtgg gttaccaacc ttatcgcgtg gtggttctga gtttcgaact gttgcacgct 1560
cccgccacgg tatgcggtcc caagaagagc actaacttgg tgaagaataa gtgcgtgaat 1620
ttcaatttca atggcctcac tggaactgga gtgctgaccg aatccaataa gaagttcttg 1680
cccttccagc agttcggaag agacattgct gacacaaccg acgcggtgcg cgatcctcag 1740
actctggaga tattggacat tacaccatgt tctttcggcg gtgtgtctgt cattactccg 1800
ggcacgaata ctagcaacca ggtagccgtg ctgtaccaag acgtgaattg cacagaggtt 1860
cccgtcgcaa ttcacgctga ccagctgacc cccacgtgga gggtttacag cactggtagt 1920
aacgtcttcc agacgagagc cggttgcttg atcggagcgg aacatgtgaa taactcctac 1980
gagtgcgaca tccccatcgg agccggtata tgcgcctctt atcagacaca aactaactca 2040
cccaggagag cccgcagtgt ggcttctcaa agcattatag catacactat gtctcttggt 2100
gccgaaaatt ccgtggccta ttctaacaat tcaatcgcca tcccaaccaa cttcacaatt 2160
agcgtgacta ccgaaatact gcctgtgagc atgacgaaaa ccagcgtaga ctgcactatg 2220
tatatctgtg gagactccac tgagtgctcc aaccttctcc tgcagtacgg tagcttctgt 2280
acccaattga accgcgccct tacaggcatc gctgttgagc aagataagaa tacccaggaa 2340
gtttttgccc aggttaagca gatatacaaa acaccgccca ttaaggactt cggaggcttc 2400
aacttctctc agatactgcc tgacccctcc aagccatcaa aacgcagctt cattgaggac 2460
ctcttgttca acaaagtgac tctggctgat gctggcttca ttaagcagta cggagattgc 2520
ctgggagata ttgctgccag ggacctcatc tgcgcccaga agtttaatgg cctgacagtc 2580
ttgcccccac ttctgacaga cgagatgatt gctcagtaca catctgccct cctcgctggc 2640
accataacat ccggatggac atttggtgct ggtgctgccc tccagattcc cttcgcaatg 2700
cagatggcgt atcgctttaa cggcatcggt gtcacacaaa acgtgttgta tgagaaccaa 2760
aagctcatcg ctaaccagtt taattctgct attggtaaga ttcaggacag cctgtcatca 2820
accgcgtctg cccttggtaa gttgcaggac gtggtgaacc agaatgctca ggctttgaat 2880
actctggtga agcaactctc ttcaaatttc ggcgctatct cttctgtgtt gaacgacatc 2940
ctgagtcgcc ttgataaggt ggaagctgaa gttcaaattg atagattgat tactggcagg 3000
ctccagtctt tgcagaccta cgttacacag cagctgatta gggcggctga aattagagct 3060
tccgccaatc tggctgcaac caagatgtcc gaatgcgtcc tgggtcagtc aaagcgcgtt 3120
gacttttgtg gtaaaggcta ccacctcatg tcatttcccc agtcagcacc tcacggagta 3180
gtgttcctcc acgtcaccta cgttccagca caggaaaaga attttaccac tgcgccggca 3240
atctgtcacg acggtaaggc acacttcccc cgcgagggcg tattcgtgtc taacggaact 3300
cattggttcg tcacacagag aaacttctat gagcctcaga tcattaccac cgacaataca 3360
tttgtgtccg gtaactgcga cgttgtgatt ggaatcgtca acaacactgt gtacgatcca 3420
cttcagccag aactggatag cttcaaggaa gaattggaca aatatttcaa aaatcacact 3480
tcacccgatg tggacctggg tgacattagt ggtatcaatg cgtccgtggt caatattcaa 3540
aaagagattg acaggctcaa cgaagtggcc aagaacctga acgaaagtct tatcgatctg 3600
caagaattgg gaaagtatga gcagtacatc aagtggccgt ggtacatttg gttgggtttt 3660
atcgccggtc tgatcgccat cgttatggtt accattatgc tttgctgcat gacgagctgt 3720
tgctcctgtc tgaagggatg ctgctcttgc ggatcataa 3759
<210> 3
<211> 39
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ctaacagata tcacgctcga gatgttcgtt ttccttgtt 39
<210> 4
<211> 42
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
aacatgaaga atctggctag ctcattatgt gtaatgcagc tt 42
<210> 5
<211> 39
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
ctaacagata tcacgctcga gatgttcgtt ttccttgtt 39
<210> 6
<211> 46
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
aacatgaaga atctggctag ctcattatga tccgcaagag cagcat 46

Claims (10)

1. A SARS-CoV-2 virus S gene used for high-efficiency expression and for construction of novel corona vaccine based on recombined vesicular stomatitis virus is characterized in that the SARS-CoV-2 virus S gene is artificially synthesized by whole gene, the codon of the synthesized gene is optimized according to the codon of human cell, and the sequence is shown as SEQ ID NO. 1.
2. A method for constructing a recombinant Vesicular Stomatitis Virus (VSV) expressing a novel human coronavirus SARS-CoV-2 spike protein S, the method comprising: knocking out a G protein gene of VSV responsible for recognizing a host cell receptor, and constructing a pseudotyped VSV virus through an S protein of SARS-CoV-2 or a variant S delta 21 protein thereof; S.DELTA.21 is a variant of the S protein in which 21 amino acids are deleted from the intracellular domain.
3. The method of claim 2, wherein the wild-type VSV virus or the VSV virus with M three-site mutation is used as a vector to construct a pseudotyped VSV virus expressing the S protein of SARS-CoV-2 or its variant SA 21.
4. The method for constructing a recombinant Vesicular Stomatitis Virus (VSV) expressing S, a novel human coronavirus SARS-CoV-2 spike protein, according to claim 2, wherein the sequence encoding the S protein of SARS-CoV-2 is as shown in SEQ ID NO. 1.
5. The method for constructing the recombinant vesicular stomatitis virus VSV expressing the human novel coronavirus SARS-CoV-2 spike protein S according to claim 2, comprising the steps of:
a1, construction of recombinant plasmid:
a11, performing base knockout on SARS-CoV-2 virus S gene and obtaining optimized length to obtain S protein mutant S delta 21;
a12 construction of plasmid pVSV for cloning the full-length genome sequence of VSV Indiana strainINDOr pVSVMT；
a13, S or SΔ21The gene is subjected to high fidelity PCR amplification, the 5 'end and the 3' end of the gene respectively contain MluI restriction enzyme site and XhoI restriction enzyme site, and the gene is respectively cloned to pVSV after double restriction enzymeIND、pVSVMTIn the plasmid, S or SΔ21The G gene in VSV is replaced by the gene to obtain recombinant plasmids pVSVΔG-S、pVSVΔG-SΔ21、pVSVMTΔG-S or pVSVMTΔG-SΔ21；
A2, virus preparation:
a21, infecting BHK21 cells by poxvirus vTF 7-3 at an MOI of 5, and removing poxvirus after 1-1.5 hours;
a22, transforming the recombinant plasmid pVSVΔG-S、pVSVΔG-SΔ21、pVSVMTΔG-S or pVSVMTΔGRespectively mixing the-S delta 21 with the helper plasmids pBS-G, pBS-N, pBS-P, pBS-L to prepare plasmid transfection mixed liquor;
a23, co-transfecting the plasmid transfection mixture into the BHK21 cells in the step a 21;
a24, transfecting a fresh BHK21 cell by using a plasmid pVSV-G expressing VSV G protein to obtain the BHK-G cell;
a25, collecting the cell supernatant obtained in the step a23, filtering vTF 7-3 virus, adding the obtained filtrate into BHK-G cells for amplification, and collecting the cell supernatant with pathological changes after 2-3 days;
a26, purifying cell supernatant collected in the step a25 by plaque, and then amplifying and identifying by VeroE6 cells to obtain the pseudotyped VSV virus.
6. The method for constructing recombinant vesicular stomatitis virus VSV that expresses human novel coronavirus SARS-CoV-2 spike protein S of claim 5, wherein in step a11, the sequence of S protein mutant S Δ 21 is shown in SEQ ID NO. 2.
7. According to claimThe method of constructing recombinant VSV for expressing the human novel coronavirus SARS-CoV-2 spike protein S as described in claim 5, wherein the VSV plasmid in which three different amino acid sites of the Matrix protein (Matrix, M) are mutated is constructed, and the plasmid comprises that the 51 th methionine of the Matrix protein is knocked out, the 221 th valine is mutated into phenylalanine, the 226 th glycine is mutated into arginine, and the plasmid is called pVSVMTA plasmid.
8. A recombinant VSV virus expressing the S protein of SARS-CoV-2 or a variant thereof constructed according to the method of claim 2.
9. Use of a recombinant VSV virus according to claim 8 expressing the S protein of SARS-CoV-2 or a variant thereof in the preparation of a novel coronavirus vaccine.
10. Use of a recombinant VSV virus according to claim 8 expressing the S protein of SARS-CoV-2 or a variant thereof for the preparation of a novel coronavirus specific neutralizing antibody diagnostic product.
CN202111044750.5A 2021-09-07 2021-09-07 Expression of SARS-CoV-2 fiber protein or its variant S Δ21 Construction and use of pseudotyped VSV viruses Active CN113817753B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202111044750.5A CN113817753B (en) 2021-09-07 2021-09-07 Expression of SARS-CoV-2 fiber protein or its variant S Δ21 Construction and use of pseudotyped VSV viruses

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111044750.5A CN113817753B (en) 2021-09-07 2021-09-07 Expression of SARS-CoV-2 fiber protein or its variant S Δ21 Construction and use of pseudotyped VSV viruses

Publications (2)

Publication Number Publication Date
CN113817753A true CN113817753A (en) 2021-12-21
CN113817753B CN113817753B (en) 2024-04-09

Family

ID=78922178

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111044750.5A Active CN113817753B (en) 2021-09-07 2021-09-07 Expression of SARS-CoV-2 fiber protein or its variant S Δ21 Construction and use of pseudotyped VSV viruses

Country Status (1)

Country Link
CN (1) CN113817753B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115287271A (en) * 2022-06-30 2022-11-04 中国食品药品检定研究院 Method for detecting SARS-CoV-2 antibody neutralization activity

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105087645A (en) * 2015-08-04 2015-11-25 上海交通大学 Building and application of M protein three-amino acid site-mutated vesicular stomatitis virus (VSV) carrier for pigs
CN111603557A (en) * 2020-06-15 2020-09-01 苏州奥特铭医药科技有限公司 Envelope-substituted virus vector vaccine and construction method thereof
CN112375748A (en) * 2021-01-11 2021-02-19 中国科学院动物研究所 Novel coronavirus chimeric recombinant vaccine based on vesicular stomatitis virus vector, and preparation method and application thereof
CN112375768A (en) * 2020-11-16 2021-02-19 同济大学 Pseudo-virus of COVID-19 coronavirus, preparation method and application thereof
CN112724209A (en) * 2021-01-18 2021-04-30 广东华南疫苗股份有限公司 Coronavirus recombinant protein capable of forming nano-particles and carrier and application thereof
CN113185613A (en) * 2021-04-13 2021-07-30 武汉大学 Novel coronavirus S protein and subunit vaccine thereof

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105087645A (en) * 2015-08-04 2015-11-25 上海交通大学 Building and application of M protein three-amino acid site-mutated vesicular stomatitis virus (VSV) carrier for pigs
CN111603557A (en) * 2020-06-15 2020-09-01 苏州奥特铭医药科技有限公司 Envelope-substituted virus vector vaccine and construction method thereof
CN112375768A (en) * 2020-11-16 2021-02-19 同济大学 Pseudo-virus of COVID-19 coronavirus, preparation method and application thereof
CN112375748A (en) * 2021-01-11 2021-02-19 中国科学院动物研究所 Novel coronavirus chimeric recombinant vaccine based on vesicular stomatitis virus vector, and preparation method and application thereof
CN112724209A (en) * 2021-01-18 2021-04-30 广东华南疫苗股份有限公司 Coronavirus recombinant protein capable of forming nano-particles and carrier and application thereof
CN113185613A (en) * 2021-04-13 2021-07-30 武汉大学 Novel coronavirus S protein and subunit vaccine thereof

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115287271A (en) * 2022-06-30 2022-11-04 中国食品药品检定研究院 Method for detecting SARS-CoV-2 antibody neutralization activity
CN115287271B (en) * 2022-06-30 2024-04-09 中国食品药品检定研究院 Method for detecting neutralizing activity of SARS-CoV-2 antibody

Also Published As

Publication number Publication date
CN113817753B (en) 2024-04-09

Similar Documents

Publication Publication Date Title
WO2021254327A1 (en) Envelope replacement-type viral vector vaccine and construction method therefor
CN111218459B (en) Recombinant novel coronavirus vaccine taking human replication-defective adenovirus as vector
CN111560354B (en) Recombinant novel coronavirus, preparation method and application thereof
Narayanan et al. SARS coronavirus accessory proteins
Mebatsion et al. Newcastle disease virus (NDV) marker vaccine: an immunodominant epitope on the nucleoprotein gene of NDV can be deleted or replaced by a foreign epitope
Kazi et al. Expression of hemagglutinin esterase protein from recombinant mouse hepatitis virus enhances neurovirulence
CN110759973B (en) Cell strain for expressing African swine fever virus CD2v protein and application thereof
CN104962581B (en) A kind of recombinant viral vaccine strain for expressing African swine fever virus p72 albumen
WO2021253962A1 (en) Novel coronavirus vaccine candidate strain using recombinant newcastle disease virus as vector, construction method therefor, and application thereof
CN110951699B (en) Recombinant rabies virus for expressing canine distemper virus structural protein and application thereof
EP2170383A1 (en) Vaccines containing canine parvovirus genetic variants
CN112375768A (en) Pseudo-virus of COVID-19 coronavirus, preparation method and application thereof
CN113293145B (en) New measles virus live vector corona vaccine
WO2021184884A1 (en) Replication type recombinant novel coronavirus based on vesicular stomatitis virus vector, and preparation method therefor and application thereof
CN113373179A (en) Recombinant VSV virus expressing SARS-CoV-2 spike protein (S) or its variant and its construction and application
CN113817753B (en) Expression of SARS-CoV-2 fiber protein or its variant S Δ21 Construction and use of pseudotyped VSV viruses
CN112852758B (en) Recombinant Newcastle disease virus for expressing avian infectious bronchitis virus S protein and preparation method and application thereof
Escoffier et al. Infection of chicken embryonic fibroblasts by measles virus: adaptation at the virus entry level
CN110951778B (en) CDV-3 strain infectious cDNA clone of canine distemper virus, construction method and application thereof
Wang et al. A novel viral vaccine platform based on engineered transfer RNA
CN115948343A (en) Steady transfer cell strain for expressing rabies virus glycoprotein and construction method and application thereof
CN106119207B (en) IBV Vero cell adapted strain constructed based on reverse genetic technology
CN117247463A (en) Fusion protein and recombinant virus particle for displaying novel coronavirus S protein and application thereof
CN106397546A (en) O type foot-and-mouth disease virus artificial recombinant antigen and preparation and application thereof
Liu et al. Rescue and characterization of a recombinant HY12 bovine enterovirus carrying a foreign HA epitope in the 3A nonstructural protein

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant