WO2021253962A1

WO2021253962A1 - Novel coronavirus vaccine candidate strain using recombinant newcastle disease virus as vector, construction method therefor, and application thereof

Info

Publication number: WO2021253962A1
Application number: PCT/CN2021/087976
Authority: WO
Inventors: 宋家升; 余飞; 毛水花; 周孟云
Original assignee: 浙江迪福润丝生物科技有限公司
Priority date: 2020-06-15
Filing date: 2021-04-19
Publication date: 2021-12-23
Also published as: ZA202101324B; CN112011521A

Abstract

Provided are a novel coronavirus vaccine candidate strain using a recombinant Newcastle disease virus as a vector, a construction method therefor, and an application thereof, pertaining to the technical field of genetically-engineered vaccines. The vaccine candidate strain uses a Newcastle disease virus LaSota strain as a vector. A novel coronavirus S gene with a mutation (C3756T, BamHI site removed) is inserted between the P gene and the M gene of the Newcastle disease virus LaSota strain. The nucleotide sequence of the mutant novel coronavirus S gene is as shown in SEQ ID NO. 1.

Description

A recombinant newcastle disease virus vector novel coronavirus vaccine candidate strain and its construction method and application

This application requires that it be submitted to the Chinese Patent Office on June 15, 2020. The application number is CN202110073720.0 and the invention title is "A recombinant Newcastle Disease Virus Vector Novel Coronavirus Vaccine Candidate Strain and Its Construction Method and Application". The priority of, the entire content of which is incorporated in this application by reference.

Technical field

The invention relates to the technical field of genetic engineering vaccines, in particular to a recombinant Newcastle disease virus vector novel coronavirus vaccine candidate strain and its construction method and application.

Background technique

The new coronavirus, also known as SARS-CoV-2, hereinafter referred to as the new coronavirus, is a virus that can cause respiratory diseases. This virus can cause inflammation and accumulation of mucus and body fluids in the airways of the lungs (pneumonia). Fully universal vaccination of the new crown vaccine may be the only feasible way to end the epidemic. Natural Medicine, MIT and Harvard teams have all reported that the nose may be the first stop and virus bank for new coronavirus infections. Nasal goblet cells and ciliated cells can highly express two key proteins required for new coronavirus infection, and spread the virus through the continuous secretion of goblet cells. The development of vaccines and drugs for nasal inoculation is essential to prevent viral infections.

At present, the new coronavirus vaccines under development are mainly divided into the following categories: mRNAs, whole virus inactivated vaccines and adenovirus vector vaccines. On the one hand, most of these vaccines focus on stimulating the body to produce high levels of circulating antibodies (blood antibodies), so that immunized persons can be protected to a large extent even if they are exposed to the virus. However, these vaccines are weak in stimulating the body to produce local mucosal immunity, so that the virus may still replicate at the initial infection site (such as the upper respiratory tract, etc.) to cause local infection, and there is a risk of continuous detoxification to the external environment. On the other hand, these vaccines also have their own advantages and disadvantages. There are currently no approved products for mRNA vaccines, and the effects of immunization and industrialization processes have yet to be verified; inactivated vaccines require P3 safety level factories to cultivate live viruses, and production risks, capacity, and costs may be obstacles to large-scale popularization. ; Adenovirus vector vaccines may need to consider the carrier’s antibody interference and strong carrier effects. Therefore, considering the effectiveness, safety, mature technology, and controllable cost of vaccines, new vaccines suitable for mass popularization are still urgently needed.

Summary of the invention

The purpose of the present invention is to provide a recombinant Newcastle Disease Virus (NDV) vector novel coronavirus vaccine candidate strain and its construction method and application. The invention provides a recombinant Newcastle disease virus vector novel coronavirus vaccine candidate strain which is safe and effective, has low production cost and can stimulate the body to produce mucosal immunity through nasal vaccination, and has important application value and outstanding public health safety significance.

The present invention provides a recombinant Newcastle disease virus vector novel coronavirus vaccine candidate strain. The vaccine candidate strain uses the Newcastle disease virus LaSota strain as a vector, and a mutation is inserted between the P gene and the M gene of the Newcastle disease virus LaSota strain Novel coronavirus S gene: The mutated novel coronavirus S gene contains the silent mutation C3756T, with the BamHI site removed, and the nucleotide sequence is shown in SEQ ID NO.1.

The present invention also provides a method for constructing a recombinant Newcastle disease virus vector novel coronavirus vaccine candidate strain according to the above technical scheme, which includes the following steps:

1) Cloning the mutated new coronavirus S gene by homologous recombination between the P gene and M gene of the Newcastle disease virus LaSota strain to obtain a vector containing the S gene;

2) Co-transfect BHK21-T7 cells with the vector containing the S gene obtained in step 1) and the virus rescue helper plasmids pCI-NP, pCI-P and pCI-L to rescue the recombinant Newcastle disease virus vector new coronavirus vaccine candidate strain .

The present invention also provides the recombinant Newcastle disease virus vector novel coronavirus vaccine candidate strain described in the above technical solution or the recombinant Newcastle disease virus vector novel coronavirus vaccine candidate strain obtained by the construction method described in the above technical solution. Application of reagents for infectious diseases.

The present invention also provides a recombinant Newcastle disease virus vector novel coronavirus vaccine candidate strain obtained by using the recombinant Newcastle disease virus vector novel coronavirus vaccine candidate strain of the above technical solution or the construction method of the above technical solution to induce a specific protective immune response The method includes the following steps: inoculating the recombinant newcastle disease virus vector novel coronavirus vaccine candidate strain.

Preferably, the method of vaccination is nasal vaccination.

The invention provides a recombinant newcastle disease virus vector novel coronavirus vaccine candidate strain. The present invention provides a recombinant NDV live vector neocorona vaccine candidate strain expressing neocorona S antigen, which has good growth characteristics and immune effects. Using the attenuated NDV strain LaSota strain as the vector background, insert the S gene (complete ORF) of SARS-CoV-2 virus into the P gene and M gene, and introduce the silent mutation of C3756T into the conserved region of the S gene, thereby removing the BamHI site. Form specific markers. The test results show that the vaccine candidate strain of the present invention (NDV_SARS-CoV-2_S) can express the complete S protein in infected cells and display it on the cell membrane; the NDV_SARS-CoV-2_S vaccine candidate strain has good growth characteristics on chicken embryos, and its hemagglutination The potency can reach 8-11log2; mouse experiments have proved that NDV_SARS-CoV-2_S vaccine candidate strain can stimulate mice to produce a characteristic immune response against S protein. The vaccine candidate strain provided by the present invention is safe and effective, has low production cost and can be inoculated through the nasal cavity to stimulate the body to produce mucosal immunity, and has important application value and outstanding public health safety significance.

Attached drawings

Figure 1 is a schematic diagram of inserting a complete ORF of the SARS-COV-2S gene into the genome of the Newcastle disease virus provided by the present invention;

Figure 2 is a gene identification diagram of the NDV_SARS-COV-2_S recombinant vaccine candidate strain provided by the present invention;

Figure 3 shows the expression of NDV_SARS-COV-2_S infecting cell BHK21 provided by the present invention, and detecting the expression of neocorona S protein and NDV carrier protein 24 hours later;

Figure 4 shows the changes in serum specific IgG antibodies of 4-week-old BALB/c mice nasally immunized with NDV_SARS-COV-2_S new crown vaccine candidate strain provided by the present invention.

detailed description

The present invention provides a recombinant Newcastle disease virus vector novel coronavirus vaccine candidate strain. The vaccine candidate strain uses the Newcastle disease virus LaSota strain as a vector, and a mutation is inserted between the P gene and the M gene of the Newcastle disease virus LaSota strain Novel coronavirus S gene; the mutated novel coronavirus S gene is a novel coronavirus S gene with C3756T silent mutation introduced in the conserved region, and the mutated novel coronavirus S gene contains the silent mutation C3756T, which removes the BamHI site, The nucleotide sequence is shown in SEQ ID NO.1 (atgtttgtttttcttgttttattgccactagtctctagtcagtgtgttaatcttacaaccagaactcaattaccccctgcatacactaattctttcacTcgtggtgtttattaccctgacaaagttttcagatcctcagttttacattcaactcagga cttcaacctaggacttttctattaaaatataatgaaaatggaaccattacagatgctgtagactgtgcacttgaccctctctcagaaacaaagtgtacgttgaaatccttcactgtagaaaaaggaatctatcaaacttctaactttagagtccaaccaacagaatctattgttagatttcctaatattacaaacttgtgcccttttggtgaagtttttaacgccaccagatttgcatctgtttatgcttggaacaggaagagaatcagcaactgtgttgctgattattctgtcctatataattccgcatcattttccacttttaagtgttatggagtgtctcctactaaattaaatgatctctgctttactaatgtctatgcagattcatttgtaattagaggtgatgaagtcagacaaatcgctccagggcaaactggaaagattgctgattataattataaattaccagatgattttacaggctgcgttatagcttggaattctaacaatcttgattctaaggttggtggtaattataattacctgtatagattgtttaggaagtctaatctcaaaccttttgagagagatatttcaactgaaatctatcaggccggtagcacaccttgtaatggtgttgaaggttttaattgttactttcctttacaatcatatggtttccaacccactaatggtgttggttaccaaccatacagagtagtagtactttcttttgaacttctacatgcaccagcaactgtttgtggacctaaaaagtctactaatttggttaaaaacaaatgtgtcaatttcaacttcaatggtttaacaggcacaggtgttcttactgagtctaacaaaaagtttctgcctttccaacaatttggcagagacattgctgacactactgatgctgtccgtgatccacagacacttgagattcttgacattacaccatgttcttttggtggtgtcagtgttataacaccaggaacaa atacttctaaccaggttgctgttctttatcaggatgttaactgcacagaagtccctgttgctattcatgcagatcaacttactcctacttggcgtgtttattctacaggttctaatgtttttcaaacCcgtgcaggctgtttaataggggctgaacatgtcaacaactcatatgagtgtgacatacccattggtgcaggtatatgcgctagttatcagactcagactaattctcctcggcgggcacgtagtgtagctagtcaatccatcattgcctacactatgtcacttggtgcagaaaattcagttgcttactctaataactctattgccatacccacaaattttactattagtgttaccacagaaattctaccagtgtctatgaccaagacatcagtagattgtacaatgtacatttgtggtgattcaactgaatgcagcaatcttttgttgcaatatggcagtttttgtacacaattaaaccgtgctttaactggaatagctgttgaacaagacaaaaacacccaagaagtttttgcacaagtcaaacaaattta caaaacaccaccaattaaagattttggtggttttaatttttcacaaatattaccagatccatcaaaaccaagcaagaggtcatttattgaagatctacttttcaacaaagtgacacttgcagatgctggcttcatcaaacaatatggtgattgccttggtgatattgctgctagagacctcatttgtgcacaaaagtttaacggccttactgttttgccacctttgctcacagatgaaatgattgctcaatacacttctgcactgttagcgggtacaatcacttctggttggacctttggtgcaggtgctgcattacaaataccatttgctatgcaaatggcttataggtttaatggtattggagttacacagaatgttctctatgagaaccaaaaattgattgccaaccaatttaatagtgctattggcaaaattcaag actcactttcttccacagcaagtgcacttggaaaacttcaagatgtggtcaaccaaaatgcacaagctttaaacacgcttgttaaacaacttagctccaattttggtgcaatttcaagtgttttaaatgatatcctttcacgtcttgacaaagttgaggctgaagtgcaaattgataggttgatcacaggcagacttcaaagtttgcagacatatgtgactcaacaattaattagagctgcagaaatcagagcttctgctaatcttgctgctactaaaatgtcagagtgtgtacttggacaatcaaaaagagttgatttttgtggaaagggctatcatcttatgtccttccctcagtcagcacctcatggtgtagtcttcttgcatgtgacttatgtccctgcacaagaaaagaacttcacaactgctcctgccatttgtcatgatggaaaagcacactttcctcgtgaaggtgtctttgtttcaaatggcacacactggtttgtaacacaaaggaatttttatgaaccacaaatcattactacagacaacacatttgtgtctggtaactgtgatgttgtaataggaattgtcaacaacacagtttatgatcctttgcaacctgaattagactcattcaaggaggagttagataaatattttaagaatcatacatcaccagatgttgatttaggtgacatctctggcattaatgcttcagttgtaaacattcaaaaagaaattgaccgcctcaatgaggttgccaagaatttaaatgaatctctcatcgatctccaagaacttggaaagtatgagcagtatataaaatggccatggtacatttggctaggttttatagctggcttgattgccatagtaatggtgacaattatgctttgctgtatgaccagttgctgtagttgtctcaagggctgttgttcttgtggatcTtgctgcaaatttgatgaagacgactctgagccagtgctcaaaggagtcaa attacattacacataa).

The new coronavirus S gene of the present invention is derived from the complete gene sequence of Wuhan-Hu-1 strain (MN908947) published by Genebank. The present invention introduces the C3756T silent mutation in the conserved region to remove the BamHI site in the conserved region at the end of the S gene, and generate a special gene marker. The present invention does not specifically limit the method for synthesizing the gene, and it is sufficient to use a gene synthesis company well-known to those skilled in the art for artificial synthesis. The mutated novel coronavirus S gene of the present invention is a novel coronavirus S gene with C3756T silent mutation introduced in the conserved region. The present invention has no special limitation on the silent mutation method, and conventional point mutation methods well known to those skilled in the art are used. That's it.

The present invention uses Newcastle disease virus vector new coronavirus vaccine candidate strains for new coronavirus vaccines. There are many advantages. The nasal vaccination method is very advantageous for the prevention and control of respiratory viruses. The vaccine candidate strains of the present invention are vaccinated through the nasal cavity, which is not only convenient for immunization , And can stimulate the mucosa to produce secreted IgA, prevent the initial site of virus infection, prevent the invasion of new coronavirus, and build the first line of defense of the respiratory tract. In addition, the vaccination method without injection is conducive to the widespread popularization of vaccines. In mammals, the Newcastle disease virus vector will only replicate itself in the respiratory tract and will not spread to other organs. The safety of the vaccine is guaranteed. The recombinant Newcastle disease virus vector novel coronavirus vaccine candidate strain can be amplified in a variety of cells, with low production cost, mature and stable technology, and suitable for large-scale popularization and industrial production. It can be used in combination with other existing related vaccines to achieve the best immune effect.

In the present invention, the mutant new coronavirus S gene is cloned between the P gene and the M gene of the LaSota strain of Newcastle disease virus in the manner of homologous recombination to obtain a vector containing the S gene. The mutant new coronavirus S gene of the present invention is a new coronavirus S gene with C3756T silent mutation introduced in the conserved region. The present invention does not specifically limit the method of silent mutation, and conventional point mutation methods well known to those skilled in the art may be used. The present invention has no special restrictions on the method of homologous recombination, and conventional homologous recombination methods well known to those skilled in the art can be used, such as using a commercial kit:

HD Cloning Kit (Clontech) for operation.

After obtaining the vector containing the S gene, the present invention co-transfects the vector containing the S gene and the virus rescue helper plasmids pCI-NP, pCI-P and pCI-L into BHK21-T7 cells to rescue the recombinant Newcastle disease virus vector new coronavirus Vaccine candidate strain. The present invention does not specifically limit the transfection and rescue methods, as long as the conventional transfection and rescue methods well known to those skilled in the art can be used.

The present invention also provides a recombinant Newcastle disease virus vector novel coronavirus vaccine candidate strain obtained by using the recombinant Newcastle disease virus vector novel coronavirus vaccine candidate strain of the above technical solution or the construction method of the above technical solution to induce a specific protective immune response The method includes the following steps: inoculating the recombinant newcastle disease virus vector novel coronavirus vaccine candidate strain. In the present invention, the method of vaccination is nasal vaccination. The number of times of nasal cavity inoculation of the present invention is preferably two. The nasal vaccination process is preferably: the experimental animal is a 4-week-old BALB/c mouse, the nasal cavity is immunized with the candidate strain of NDV_SARS-COV-2_S new crown vaccine, and the first immunization and booster immunization are performed 10 days after the first immunization. The toxic dose is 10 ^5.0 EID ₅₀ .

In the following, the recombinant Newcastle disease virus vector novel coronavirus vaccine candidate strain of the present invention and its construction method and application will be further introduced in detail with reference to specific examples. The technical scheme of the present invention includes but is not limited to the following examples.

Example 1

1. Synthesize the full-length S gene of the new coronavirus

According to the complete gene sequence of Wuhan-Hu-1 strain (MN908947) published by Genebank, the C3756T silent mutation was introduced in the reading frame (ORF) of the S gene. The complete S gene ORF of the new coronavirus was synthesized by Nanjing Kinco Biotechnology Co., Ltd. The synthetic gene sequence is shown in SEQ ID NO.1.

2. Insert the new crown S gene into the NDV genome

Using an artificial chromosome-based viral reverse genetic vector that can express NDV-LaSota full-length RNA (A in Figure 1), the S gene of the new coronavirus is cloned into the PM of the Newcastle disease virus genome by conventional homologous recombination. , Successfully constructed a recombinant Newcastle disease virus vector containing the new coronavirus S gene (B in Figure 1). Homologous recombination uses commercially available kits:

HD Cloning Kit (Clontech).

Figure 1 is a schematic diagram of inserting the complete ORF of the SARS-COV-2S gene into the genome of the Newcastle disease virus. Among them, (A) is a reverse genetic virus vector expressing the full-length NDV-LaSota strain; (B) is a schematic diagram of the inserted gene cassette (SEQ ID NO. 2); GE, IG, and GS (underlined) are respectively: NDV transcription termination Sequence, spacer sequence, transcription initiation sequence; Kozak (italics): eukaryotic expression enhancement sequence; S-ORF (bold): S gene complete ORF; PmeI site.

3. Rescue of New Coronavirus Vaccine Candidate Strains of Recombinant NDV Vector

The recombinant Newcastle disease virus vector containing the new coronavirus S gene and the plasmids of pCI-NP, pCI-P and pCI-L for virus rescue were extracted, and the plasmid concentration was determined by Nanodrop, and then transfected into BHK21-T7 cells.

1. Transfection method:

(1) Culture BHK21-T7 cells in a 6-well plate, and wash 3 times with sterile PBS when the cells grow to 80%-90%;

(2) Take 500μL of Opti-MEM in a 1.5mL centrifuge tube, and then add the recombinant Newcastle disease virus vector containing the new coronavirus S gene, pCI-NP, pCI-P and pCI- at a ratio of 1:1:1:1. L plasmid, the total amount of plasmid in each tube is 4μg, for 1 well;

(3) Add 3μL Plus reagent to the above solution and let it act for 5 minutes at room temperature;

(4) Add 9μL Lipofectamine LTX and mix gently; let it act at room temperature for 30 minutes;

(5) Add the transfection complex obtained in step (4) to the cells cultured in step (1), and then add 2 mL of Opti-MEM culture solution, and incubate in a carbon dioxide incubator at 37°C for 18 to 48 hours.

2. After 24h of transfection, add TPCK trypsin at a final concentration of 0.5μg/μL so that the attenuated strain can be successfully rescued. After 72 hours of transfection, the cells were repeatedly frozen and thawed three times, and the mixture was inoculated with 9-day-old SPF chicken embryos, 0.5 mL/embryo. The dead embryos within 24 hours were discarded, and all the allantoic fluid of all dead and surviving chicken embryos within 24 to 120 hours was harvested, and the hemagglutination titer was determined one by one. For the obtained embryo fluid with HA activity, the S gene sequence of each aliquot was determined separately to determine whether the molecular tag C3756T exists. The rescued virus obtained was named NDV_SARS-COV-2_S.

4. In vitro experimental evaluation of recombinant NDV vector new crown vaccine candidate strain

1. Virus growth characteristics

The chicken erythrocyte hemagglutination (HA) test was carried out according to the conventional micro-method to determine the growth titer of the virus. The HA titer of the initial rescue virus is 5-6log2. After passage and adaptation, the virus titer can be significantly increased, and its titer can reach 8-11log2.

2. Recombinant virus PCR identification and sequencing analysis

The rescued recombinant NDV_SARS-COV-2_S was identified by RT-PCR and sequencing, indicating that the complete S gene was successfully inserted into the NDV genome and contained the artificially introduced gene marker C3756T silent mutation (Figure 2, NDV_SARS-COV-2_S recombinant vaccine The gene identification diagram of the candidate strains; (A) is to divide the S gene and part of the NDV gene into three gene fragments, which are specifically amplified by RT-PCR; (B) is the specific amplified fragment for further sequencing and identification; (C ) Means that the recombinant vaccine strain contains a specific gene marker (S gene silent mutation C3756T, BamHI site removed)).

3. In vitro expression of recombinant virus neocorona S antigen

The indirect immunofluorescence method is used to detect whether the recombinant NDV vector neocorona vaccine candidate strain expresses neocorona S antigen in the infected cells. NDV empty vector was used as a control. The results show that the full-length S protein can be expressed in large amounts on the BHK21 cell membrane, which is consistent with the S protein being the envelope protein of the virus. In addition, the present invention uses a human monoclonal antibody against the receptor binding region, which can specifically bind to the S protein, suggesting that the S protein expressed on the cell membrane surface exhibits its natural conformation. This feature lays a solid foundation for the vaccine strain to successfully induce a specific protective immune response.

The immunofluorescence operation method is as follows:

(1) The 12-well plate BHK21 was inoculated at a density of about 85%, washed once with PBS, and 500 microliters of opti-MEM culture medium containing 0.5μg/μL TPCK pancreatin was added to each well. Add 100 microliters of 10-fold diluted virus solution to the poison hole.

(2) 24 hours after infection, the cell supernatant was discarded, the cells were fixed with 4% paraformaldehyde, placed at room temperature for 20 minutes, washed with PBS 3 times, 3 minutes each time, and the liquid was sucked up the last time.

(3) Add 100 microliters of 0.2% Triton, place at room temperature for 10 minutes, and wash with PBS 3 times, 3 minutes each time.

(4) Add 5% BSA, incubate at 37°C for 1 h, wash with PBS 3 times, 3 min each time.

(5) Add the primary antibody diluted 1:100. The primary antibody contains two antibodies, one is NDV chicken serum, and the other is human monoclonal antibody (0.5 mg/mL). After adding the primary antibody, incubate at 37°C for 1h, wash with PBS 3 times, 3min each time.

(6) Add the diluted secondary antibody. The secondary antibody contains two antibodies, one is a red-labeled donkey anti-chicken IgY diluted 1:1000, and the other is a 1:500 diluted green-labeled goat anti-mouse IgG (Jackson ImmunoResearch Inc). After adding the secondary antibody, incubate at 37°C for 0.5h, wash with PBS 3 times, 3min each time.

(7) Add 1:100 diluted DAPI (5mg/mL) dye to stain the nucleus, wash 3 times with PBS, 3min each time.

(8) Finally, add an appropriate amount of PBS, and observe the results under a fluorescence microscope.

The results are shown in Figure 3. Figure 3 shows NDV_SARS-COV-2_S infected cells BHK21. Immunofluorescence staining with human monoclonal antibody against the RBD region shows that in the cells transfected with the recombinant NDV vector from the S protein column, the S protein is clearly expressed on the cell membrane (green fluorescence), while the NDV empty vector and blank control are observed No fluorescence.

V. Preliminary evaluation of recombinant NDV vector neocorona vaccine in mice

Figure 4 shows the changes in serum-specific IgG antibodies of 4-week-old BALB/c mice nasally immunized with NDV_SARS-COV-2_S new crown vaccine candidate strain; (A) is the schematic diagram of the immunization procedure and serum collection time; (B) is the serum Dynamic changes of IgG antibody (against S1 protein) at 14, 21, 28 days. Five 4-week-old BALB/c were vaccinated twice with 10 ^5.0 EID _{50 in the} nasal cavity as shown in A in Figure 4 (experimental animals were 4-week-old BALB/c mice, nasally immunized with NDV_SARS-COV-2_S new crown vaccine For candidate strains, the first immunization and booster immunization 10 days after the first immunization, the dose of each immunization is 10 ^5.0 EID ₅₀ ). The specific IgG antibody against S1 protein in the serum was detected 14, 21, and 28 days after immunization. After 20-fold dilution of serum collected from mice, an indirect ELISA kit (Mouse Novel Coronavirus Antibody Detection Kit, Beijing Paidichang Technology Development Co., Ltd.) was used to detect IgG antibodies against S1. The results showed that the OD450 value was higher than the basic background value before immunization 14 days after immunization, indicating that specific IgG antibodies began to be produced after 14 days of immunization; antibodies increased significantly at 21 days, but the antibody titer dispersion was large, indicating the immune response of different animals It is not synchronized; 28 days after immunization, the antibody titer further increased, and the antibody titer was neat, indicating that the specific immune response has been gradually established and perfected (Figure 4, B).

The above are only the preferred embodiments of the present invention. It should be pointed out that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and modifications can be made, and these improvements and modifications are also It should be regarded as the protection scope of the present invention.

Claims

A recombinant Newcastle disease virus vector novel coronavirus vaccine candidate strain, the vaccine candidate strain uses the Newcastle disease virus LaSota strain as a vector, and a mutant novel coronavirus S is inserted between the P gene and the M gene of the Newcastle disease virus LaSota strain Gene; The mutated new coronavirus S gene contains silent mutation C3756T, which removes the BamHI site, and the nucleotide sequence is shown in SEQ ID NO.1.
The method for constructing the recombinant Newcastle disease virus vector novel coronavirus vaccine candidate strain of claim 1, comprising the following steps:

1) Cloning the mutant new coronavirus S gene by homologous recombination between the P gene and the M gene of the Newcastle disease virus LaSota strain to obtain a vector containing the S gene;

2) Co-transfect BHK21-T7 cells with the vector containing the S gene obtained in step 1) and the virus rescue helper plasmids pCI-NP, pCI-P and pCI-L to rescue the recombinant Newcastle disease virus vector new coronavirus vaccine candidate strain .
The recombinant Newcastle disease virus vector novel coronavirus vaccine candidate strain according to claim 1 or the recombinant Newcastle disease virus vector novel coronavirus vaccine candidate strain obtained by the construction method according to claim 2 is used in the preparation of reagents for the prevention or treatment of novel coronavirus infection diseases Applications.
The method for inducing a specific protective immune response by using the recombinant Newcastle disease virus vector novel coronavirus vaccine candidate strain according to claim 1 or the recombinant Newcastle disease virus vector novel coronavirus vaccine candidate strain obtained by the construction method according to claim 2 includes the following Step: inoculate the recombinant Newcastle disease virus vector novel coronavirus vaccine candidate strain.
The method according to claim 4, wherein the method of vaccination is nasal vaccination.