CN114457109B - Bitter gourd transcription factor for regulating fruit and vegetable fruit ripening and application thereof - Google Patents

Bitter gourd transcription factor for regulating fruit and vegetable fruit ripening and application thereof Download PDF

Info

Publication number
CN114457109B
CN114457109B CN202210029975.1A CN202210029975A CN114457109B CN 114457109 B CN114457109 B CN 114457109B CN 202210029975 A CN202210029975 A CN 202210029975A CN 114457109 B CN114457109 B CN 114457109B
Authority
CN
China
Prior art keywords
transcription factor
mcrpf
fruit
seq
momordica charantia
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202210029975.1A
Other languages
Chinese (zh)
Other versions
CN114457109A (en
Inventor
郭金菊
张长远
吴廷全
谭德龙
王茹芳
曹海顺
王瑞
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Facility Agriculture Guangdong Academy of Agricultural Science
Original Assignee
Institute of Facility Agriculture Guangdong Academy of Agricultural Science
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Facility Agriculture Guangdong Academy of Agricultural Science filed Critical Institute of Facility Agriculture Guangdong Academy of Agricultural Science
Priority to CN202210029975.1A priority Critical patent/CN114457109B/en
Publication of CN114457109A publication Critical patent/CN114457109A/en
Application granted granted Critical
Publication of CN114457109B publication Critical patent/CN114457109B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8249—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving ethylene biosynthesis, senescence or fruit development, e.g. modified tomato ripening, cut flower shelf-life
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N47/00—Biocides, pest repellants or attractants, or plant growth regulators containing organic compounds containing a carbon atom not being member of a ring and having no bond to a carbon or hydrogen atom, e.g. derivatives of carbonic acid
    • A01N47/40—Biocides, pest repellants or attractants, or plant growth regulators containing organic compounds containing a carbon atom not being member of a ring and having no bond to a carbon or hydrogen atom, e.g. derivatives of carbonic acid the carbon atom having a double or triple bond to nitrogen, e.g. cyanates, cyanamides
    • A01N47/42—Biocides, pest repellants or attractants, or plant growth regulators containing organic compounds containing a carbon atom not being member of a ring and having no bond to a carbon or hydrogen atom, e.g. derivatives of carbonic acid the carbon atom having a double or triple bond to nitrogen, e.g. cyanates, cyanamides containing —N=CX2 groups, e.g. isothiourea
    • A01N47/44—Guanidine; Derivatives thereof
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Plant Pathology (AREA)
  • General Engineering & Computer Science (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • Nutrition Science (AREA)
  • Botany (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Agronomy & Crop Science (AREA)
  • Pest Control & Pesticides (AREA)
  • Dentistry (AREA)
  • Environmental Sciences (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a bitter gourd transcription factor for regulating fruit and vegetable fruit ripening and application thereof, wherein the amino acid sequence of the bitter gourd transcription factor is shown as SEQ ID NO.2, and the nucleotide sequence is shown as SEQ ID NO. 1. The invention discovers that the over-expression of the bitter gourd transcription factor can obviously improve the maturity of bitter gourds and heterologous fruits, vegetables and tomatoes, shorten the maturation period and accelerate the fruit maturation, so that a new product which can be effectively used for regulating the maturity or the maturation period of fruits and vegetables can be developed on the basis of the over-expression of the bitter gourd transcription factor, and the over-expression of the bitter gourd transcription factor has important significance for regulating the fruit maturation by utilizing a molecular means.

Description

Bitter gourd transcription factor for regulating fruit and vegetable fruit ripening and application thereof
Technical Field
The invention belongs to the field of plant molecular biology and plant genetic engineering, and particularly relates to a bitter gourd transcription factor for regulating fruit and vegetable fruit ripening and application thereof.
Background
The balsam pear is one of characteristic melon vegetable crops in Lingnan with the largest cultivation area, mainly takes the green fruits in the middle and later expansion period as edible organs, is used as medicated food, has rich nutrition, and also has the biological functions of reducing blood sugar, reducing blood fat, resisting cancer, preventing aging and the like. With the understanding of people on the nutritional value and the medicinal value, the market demand and the cultivation area of the plant are continuously expanded, and the plant is generally cultivated all over the country at present and has higher economic and social values.
The bitter gourd generally needs about 25 days from flowering and pollination to physiological maturity, and effectively shortening the maturation period of the bitter gourd has very important significance for shortening the breeding time of the bitter gourd and improving the breeding efficiency of the bitter gourd.
Therefore, the key factors for regulating and controlling the ripening of the fruits and vegetables are excavated, and the corresponding molecular means is developed based on the key factors for carrying out genetic improvement on the bitter gourds or other fruits and vegetables, so that the method has an extremely important significance for solving the problem of long fruit ripening period of the bitter gourds or other fruits and vegetables and improving the fruit breeding efficiency of the fruits and vegetables.
Disclosure of Invention
The present invention has been made to solve at least one of the above-mentioned problems occurring in the prior art. Therefore, the bitter gourd transcription factor for regulating and controlling fruit ripening of fruits and vegetables and the application thereof are provided, the fruit ripening can be remarkably promoted by over-expressing the bitter gourd transcription factor in fruits and vegetables, the bitter gourd transcription factor can be applied to bitter gourd and heterologous fruits and vegetables, and the discovery has important significance for regulating and controlling fruit ripening of fruits and vegetables by utilizing a molecular means.
The invention provides an application of a Momordica Charantia McRPF transcription factor in regulating and controlling the fruit ripening period of fruits and vegetables.
According to a first aspect of the invention, in some embodiments of the invention, the amino acid sequence of said Momordica Charantia McRPF transcription factor is set forth in SEQ ID NO. 2.
The amino acid sequence of the Momordica Charantia McRPF transcription factor is MGLRDIGATLPPGFRFYPSDEELVCHYLYKKITNEEALRGTLVEINLHTCEPWQLPEVAKLNRNEWYFFSFQDRKYATGVRANRATIGGYWKATGKDRTVMNPKTSEVMGMRKTLVFYRKRAPNGIKTGWIMHEFRIQTPHMSPKADWVLCRVFPQSKRDEITTQTATHIYRPITFDAATPAPSSFYSLPSHVQFPPAADVNMLPFNNVNLEVEAEAGGLISNGVDDSTTQQRKFESEDCIQNGFFHFDYFVA (SEQ ID NO. 2).
According to a first aspect of the present invention, in some embodiments of the present invention, the sequence of the nucleic acid molecule encoding said Momordica Charantia McRPF transcription factor is set forth in SEQ ID NO. 1.
The sequence shown in SEQ ID NO.1 is a CDS sequence (database number LOC 111022222) of the Momordica charantia McRPF transcription factor gene, and the specific sequence is as follows: 5'-ATGGGTCTACGAGACATCGGAGCAACTCTTCCTCCCGGGTTTAGGTTTTATCCGAGCGATGAGGAATTGGTGTGCCATTATTTGTACAAAAAGATCACAAATGAAGAGGCTTTGAGGGGGACGTTGGTCGAGATTAACTTGCATACTTGTGAGCCATGGCAGCTTCCTGAGGTGGCTAAATTGAACAGAAACGAGTGGTACTTCTTCAGTTTTCAAGATCGAAAATACGCAACGGGAGTGAGGGCGAACCGTGCAACAATCGGTGGATACTGGAAAGCGACCGGAAAAGATCGGACAGTGATGAATCCAAAGACAAGTGAGGTGATGGGGATGAGAAAGACTTTGGTATTTTACAGAAAAAGGGCTCCTAATGGGATCAAAACTGGTTGGATTATGCATGAATTTCGCATTCAGACTCCGCATATGTCCCCAAAGGCGGACTGGGTTCTCTGCAGAGTTTTTCCCCAGAGCAAGCGAGACGAGATCACCACACAAACAGCTACACATATCTATCGGCCGATTACATTCGATGCAGCCACCCCCGCTCCATCGTCTTTCTATTCACTCCCGAGCCACGTCCAGTTTCCGCCTGCAGCGGACGTCAATATGCTGCCATTTAACAACGTCAACTTGGAAGTAGAAGCTGAAGCTGGAGGCTTGATATCAAATGGAGTTGATGATTCAACTACACAGCAAAGGAAGTTTGAGTCTGAAGATTGCATCCAAAATGGCTTCTTCCATTTTGACTATTTTGTTGCTTGA-3' (SEQ ID NO. 1).
According to a first aspect of the invention, in some embodiments of the invention, the fruit or vegetable comprises momordica charantia and tomato.
The inventor finds that the Momordica Charantia McRPF transcription factor can generate the effect of promoting fruit ripening by over-expressing the Momordica Charantia McRPF transcription factor in the Momordica Charantia and the heterologous fruits and vegetables and tomatoes thereof, so that the Momordica Charantia McRPF transcription factor can have a certain ripening accelerating effect on the Momordica Charantia and the heterologous fruits and vegetables.
In some preferred embodiments of the invention, the tomato is a Micro-Tom tomato.
According to the first aspect of the present invention, in some embodiments of the present invention, the controlling the mature period of the fruit and vegetable is accelerating the mature of the fruit and vegetable.
The second aspect of the invention provides application of a reagent for regulating the expression level of the Momordica Charantia McRPF transcription factor in regulating the fruit and vegetable fruit ripening period.
According to a second aspect of the invention, in some embodiments of the invention, the Momordica Charantia McRPF transcription factor is a nucleic acid molecule as set forth in SEQ ID No. 1.
According to a second aspect of the invention, in some embodiments of the invention, the fruits and vegetables comprise momordica charantia and tomato.
In some preferred embodiments of the invention, the tomato is a Micro-Tom tomato.
According to a second aspect of the present invention, in some embodiments of the present invention, the reagent includes at least one of the following (1) to (6):
(1) A recombinant vector containing a nucleic acid molecule shown in SEQ ID NO. 1;
(2) Nucleic acid molecules comprising the nucleic acid sequence shown in SEQ ID NO. 1;
(3) A recombinant bacterium containing the recombinant vector of (1);
(4) Recombinant cells containing nucleic acid molecules shown in SEQ ID NO. 1;
(5) A recombinant cell comprising the recombinant vector of (1);
(6) A recombinant cell comprising the recombinant bacterium of (2).
According to a second aspect of the invention, in some embodiments of the invention, the agent promotes the expression of a momordica charantia McRPF transcription factor.
In a third aspect of the invention, the application of the Momordica Charantia McRPF transcription factor in preparing the fruit and vegetable ripener is provided.
According to a third aspect of the present invention, in some embodiments of the present invention, the amino acid sequence of said momordica charantia McRPF transcription factor is set forth in SEQ ID No. 2.
In some preferred embodiments of the invention, the nucleic acid molecule encoding said Momordica Charantia McRPF transcription factor has the sequence shown in SEQ ID NO. 1.
According to a third aspect of the invention, in some embodiments of the invention, the fruit or vegetable comprises momordica charantia and tomato.
In some preferred embodiments of the invention, the tomato is a Micro-Tom tomato.
According to a third aspect of the present invention, in some embodiments of the present invention, the fruit and vegetable ripening agent further comprises a reagent comprising at least one of the following (1) to (6):
(1) A recombinant vector containing a nucleic acid molecule shown in SEQ ID NO. 1;
(2) Nucleic acid molecules as shown in SEQ ID NO. 1;
(3) A recombinant bacterium containing the recombinant vector in (1);
(4) Recombinant cells containing nucleic acid molecules shown in SEQ ID NO. 1;
(5) A recombinant cell comprising the recombinant vector of (1);
(6) A recombinant cell comprising the recombinant bacterium of (2).
The invention has the beneficial effects that:
the invention discloses application of the Momordica Charantia McRPF transcription factor in regulating fruit and vegetable fruit ripening for the first time. The invention discovers that the instantaneous overexpression of the McRPF gene in the balsam pear fruit can obviously promote the ripening of the balsam pear fruit, and the heterologous overexpression in the tomato can also obviously promote the ripening of the tomato fruit. Therefore, the novel product which can be effectively used for regulating and controlling the fruit maturity or the maturation cycle of the fruits and the vegetables based on the development has important significance for regulating and controlling the fruit maturation by utilizing a molecular means.
Drawings
FIG. 1 is a map of recombinant overexpression vector pSuper1300-McRPF obtained in the example of the present invention.
Fig. 2 shows the phenotype change (a) of momordica charantia on day 3 and the expression (B) of McRPF gene in transiently overexpressed momordica charantia flesh tissue, which are injected with recombinant bacterial suspension, in the example of the present invention, wherein pSuper1300-McRPF is an overexpression vector treatment group, and pSuper1300 is an empty vector control group.
FIG. 3 shows the heterologous overexpression of the Momordica Charantia McRPF transcription factor in tomato fruits according to an embodiment of the present invention; wherein A is the plant phenotype of the McRPF overexpression transgenic tomato, WT is a wild type, and OE-7 and OE-24 are 2 McRPF overexpression transgenic lines; b is a semi-quantitative RT-PCR detection result; c is the mature phenotype of wild type and transgenic tomato fruits.
Detailed Description
In order to make the objects, technical solutions and technical effects of the present invention more apparent, the present invention will be described in further detail with reference to specific embodiments. It should be understood that the detailed description and specific examples, while indicating the preferred embodiment of the invention, are intended for purposes of illustration only and are not intended to limit the scope of the invention.
The experimental materials and reagents used are, unless otherwise specified, all consumables and reagents which are conventionally available from commercial sources.
Construction of Momordica charantia McRPF transcription factor gene overexpression vector
In this example, the CDS sequence of the transcription factor gene of Momordica Charantia McRPF (accession number: LOC 111022222) is: 5'-ATGGGTCTACGAGACATCGGAGCAACTCTTCCTCCCGGGTTTAGGTTTTATCCGAGCGATGAGGAATTGGTGTGCCATTATTTGTACAAAAAGATCACAAATGAAGAGGCTTTGAGGGGGACGTTGGTCGAGATTAACTTGCATACTTGTGAGCCATGGCAGCTTCCTGAGGTGGCTAAATTGAACAGAAACGAGTGGTACTTCTTCAGTTTTCAAGATCGAAAATACGCAACGGGAGTGAGGGCGAACCGTGCAACAATCGGTGGATACTGGAAAGCGACCGGAAAAGATCGGACAGTGATGAATCCAAAGACAAGTGAGGTGATGGGGATGAGAAAGACTTTGGTATTTTACAGAAAAAGGGCTCCTAATGGGATCAAAACTGGTTGGATTATGCATGAATTTCGCATTCAGACTCCGCATATGTCCCCAAAGGCGGACTGGGTTCTCTGCAGAGTTTTTCCCCAGAGCAAGCGAGACGAGATCACCACACAAACAGCTACACATATCTATCGGCCGATTACATTCGATGCAGCCACCCCCGCTCCATCGTCTTTCTATTCACTCCCGAGCCACGTCCAGTTTCCGCCTGCAGCGGACGTCAATATGCTGCCATTTAACAACGTCAACTTGGAAGTAGAAGCTGAAGCTGGAGGCTTGATATCAAATGGAGTTGATGATTCAACTACACAGCAAAGGAAGTTTGAGTCTGAAGATTGCATCCAAAATGGCTTCTTCCATTTTGACTATTTTGTTGCTTGA-3' (SEQ ID NO. 1).
The corresponding amino acid sequence is: MGLRDIGATLPPGFRFYPSDEELVCHYLYKKITNEEALRGTLVEINLHTCEPWQLPEVAKLNRNEWYFFSFQDRKYATGVRANRATIGGYWKATGKDRTVMNPKTSEVMGMRKTLVFYRKRAPNGIKTGWIMHEFRIQTPHMSPKADWVLCRVFPQSKRDEITTQTATHIYRPITFDAATPAPSSFYSLPSHVQFPPAADVNMLPFNNVNLEVEAEAGGLISNGVDDSTTQQRKFESEDCIQNGFFHFDYFVA (SEQ ID NO. 2).
The CDS sequence is recombined into a plant over-expression vector pCAMBIA-Super1300-GFP (purchased from Beinoco Biotechnology Co., ltd., shanghai, hereinafter abbreviated as pSuper 1300) through gene recombination to obtain a recombinant over-expression vector pSuper1300-Mc RPF.
The specific construction method comprises the following steps:
designing primers at two ends of ORF of the McRPF gene, respectively adding two enzyme cutting sites Xba I and Hind III on a vector at the 5' end of a forward primer and a reverse primer, amplifying a target fragment with the two enzyme cutting sites by PCR, purifying and recovering, connecting the enzyme-cut target band with an expression vector, transforming escherichia coli, and obtaining a positive clone which is the recombinant over-expression vector pSuper1300-McRPF after PCR identification and sequencing.
Wherein, the forward and reverse primers are designed as follows (wherein, the underlined part is the restriction enzyme site):
a forward primer: 5' -GCTCTAGAATGGGTCTACGAGACATCGG-3’(SEQ ID NO.3)；
Reverse primer: 5' -CCCAAGCTTTCAAGCAACAAAATAGTCAAAAT-3’(SEQ ID NO.4)。
The map of the obtained recombinant overexpression vector pSuper1300-McRPF is shown in FIG. 1.
Transient overexpression of Momordica Charantia McRPF transcription factor in Momordica Charantia fruit
The recombinant overexpression vectors pSuper1300-McRPF and empty vector (pSuper 1300) constructed in the above examples were respectively and electrically transformed into Agrobacterium GV3101 (purchased from North Jing Huayuyo Biotech Co., ltd.), and then the successfully transformed recombinant bacteria were spread on a solid LB medium (Tryptone 10g/L, yeast extract 5g/L, sodium chloride (NaCl) 10g/L, pH = 7.4) containing kanamycin and rifampicin, and cultured upside down for 2-3 days. After the culture, the recombinant bacteria were selected and incubated in 10mL of liquid LB medium containing kanamycin and rifampicin at 28 ℃ for 24h with shaking at 200 rpm. Fresh liquid LB medium (500 mL) containing kanamycin and rifampicin was added in the volume ratio of original medium 1 600 The bacterial cells are collected by centrifugation at 5000rpm for 5min at 0.6-0.8, and then washed 2-3 times by using 1/2MS liquid culture medium (i.e. the macroelement of the MS culture medium is halved). Using infection liquid (the infection liquid is prepared by respectively adding MgCl with final concentration of 10mmol/L into MS liquid culture medium 2 10mmol/L MES (morpholine ethanesulfonic acid) and 100. Mu. Mol/L AS (acetosyringone)) were resuspended, and OD was adjusted 600 To 0.5-0.6 to obtain the bacterial suspension.
Wherein, the components of the MS liquid culture medium are shown in Table 1.
TABLE 1 MS liquid media component content
Figure BDA0003466043090000061
Wiping the surface of Momordica charantia with 75% ethanol, pricking a small hole (about 0.5cm in depth) on the fruit tumor of Momordica charantia with a syringe needle, and slowly injecting 300 μ L of the bacterial suspension into the pulp tissue of Momordica charantia from the small hole with the syringe needle removed. The treated fruits were allowed to stand at room temperature for 2-3 days, and the phenotypic change was observed.
The change in phenotype of Momordica charantia injected with the recombinant bacterial suspension is shown in FIG. 2A.
To further confirm that the phenotype of Momordica charantia is changed by injection of the recombinant bacterial suspension, the inventors excised the pulp tissue around the injection site, extracted the Momordica charantia Total RNA using SV Total RNA Isolation System Kit (Promega, USA), and utilized PrimeScript TM Synthesizing a cDNA first chain by using a RT reagent Kit (Takara, japan) reverse transcription Kit, detecting the expression quantity of the Momordica charantia McRPF transcription factor in the cDNA first chain by using qRT-PCR, wherein the Kit is TB Green TM Premix Ex Taq TM II (Tli RNaseH Plus) (Takara, japan). Balsam pear injected with recombinant bacterial suspension transformed by empty vector was used as a control.
Wherein, the primers for qRT-PCR detection are as follows:
a forward primer: 5'-ACGAGACATCGGAGCAACT-3' (SEQ ID NO. 5);
reverse primer: 5'-CCCTCAAAGCCTCTTCATT-3' (SEQ ID NO. 6);
the qRT-PCR reaction system is as follows:
Figure BDA0003466043090000062
Figure BDA0003466043090000071
reaction conditions are as follows: 30sec at 95 ℃;95 ℃ 3sec,60 ℃ 30sec,40 cycles.
The results are shown in FIG. 2B.
The result shows that the transient overexpression of the Momordica Charantia McRPF transcription factor can obviously promote the maturation of Momordica Charantia fruits, and the expression quantity of the Momordica Charantia McRPF transcription factor in the transient overexpression Momordica Charantia flesh tissues is extremely higher than that of the unloaded control. The expression quantity of the Momordica Charantia McRPF transcription factor in the pulp tissue of Momordica Charantia can be improved by the recombinant strain transformed by the recombinant overexpression vector pSuper1300-McRPF, so that the phenotype of Momordica Charantia is changed.
Heterologous overexpression of Momordica Charantia McRPF transcription factor in tomato fruit
In this example, the tomatoes used in the experiment were Micro-Tom tomatoes.
The recombinant overexpression vector pSuper1300-McRPF and the empty vector constructed in the above example were respectively and electrically transformed into Agrobacterium tumefaciens C58 (purchased from Biotech, inc., wash, beijing), and then the successfully transformed recombinant bacteria were spread on a solid LB medium (Tryptone (10 g/L), yeast extract (Yeast extract) (5 g/L), sodium chloride (NaCl) (pH = 7.4)) containing kanamycin and rifampicin, and cultured for 2-3 days in an inverted manner. After the culture, the recombinant bacteria were picked up and incubated in 10mL of liquid LB medium containing kanamycin and rifampicin at 28 ℃ for 24h with shaking at 200 rpm. Fresh liquid LB medium (500 mL) containing kanamycin and rifampicin was added in the volume ratio of original medium 1 600 0.6 to 0.8. After mixing, the mixture is centrifuged at 5000rpm for 5min to collect the thalli, and then the thalli are cleaned for 2-3 times by 1/2MS liquid culture medium (namely MS macroelement is halved). Resuspending thallus with infection solution (prepared by adding Myo-Inositol, thiamine HCl (vitamin B1), MES (morpholine ethanesulfonic acid) and AS (acetosyringone) to MS liquid culture medium to final concentration of 100mg, 0.4mg/L, 10mmol/L, and adjusting OD 600 To about 0.5, to obtain the transformation Buffer. Taking tomato aseptic seedlings growing for about 15 days, cutting true leaves, cotyledons and hypocotyls as explants, horizontally placing on a pre-culture medium (MS culture medium +2.0mg/L ZT +0.2mg/L IAA), illuminating for 1600-1800lx, 169/8 h (light/dark),preculture at 25 ℃ for 1 day. Taking out the explant, transforming in the transformation Buffer for 30min, taking out, sucking water with sterile filter paper, and re-culturing in the pre-culture medium for 1-2 days. The explants were transferred into selection medium (MS medium +2.0mg/L ZT +0.2mg/L IAA +10mg/L Hyg +500mg/L Cb (carbenicillin)) for selection culture to form callus and adventitious buds, which were subcultured every two weeks. When the adventitious bud grows to about 1cm, cutting off and transferring the adventitious bud to a rooting culture medium (1/2 MS culture medium +0.1mg/L IAA +5mg/L Hyg +300mg/L Cb (carbenicillin)) to form a complete plant, and obtaining transgenic plants (OE-7 and OE-24) through seedling exercising, transplanting and identifying.
The tomato flower on the day of flowering is listed, and the flowering time is recorded.
The function of Momordica Charantia McRPF transcription factor in regulating fruit ripening is judged by comparing the time taken by Momordica Charantia McRPF transgenic tomato and Wild Type (WT) tomato from the day of flowering to the time of color breaking, and the results are shown in FIG. 3.
As can be seen in FIG. 3C, tomato fruits of the Momordica Charantia McRPF gene-overexpressing transgenic line are about 10 days earlier from flowering pollination to color breaking than Wild Type (WT).
To further confirm that the fruit ripening of Lycopersicon esculentum is promoted by the Momordica charantia McRPF transcription factor, the present inventors extracted Momordica charantia Total RNA using SV Total RNA Isolation System Kit (Promega, USA) from leaf tissue of Momordica charantia McRPF transgenic Lycopersicon esculentum, and used PrimeScript TM Synthesizing a cDNA first chain by using an RT reagent Kit (Takara, japan) reverse transcription Kit, and detecting the expression quantity of the Momordica charantia McRPF transcription factor in the cDNA first chain by using semi-quantitative RT-PCR, wherein SAND is an internal reference gene. Wild Type (WT) tomatoes were used as controls.
Wherein, the primers for RT-PCR detection are as follows:
a forward primer: 5'-ATGGGTCTACGAGACATCGG-3' (SEQ ID NO 7);
reverse primer: 5'-TCAAGCAACAAAATAGTCAAAAT-3' (SEQ ID NO 8).
The reaction system was the same as in the above examples.
The result shows that the transient overexpression of the Momordica Charantia McRPF transcription factor can obviously promote the fruit ripening of the tomato, and the expression quantity of the Momordica Charantia McRPF transcription factor in the transiently overexpressed tomato leaf tissue is extremely higher than that of the wild tomato. The expression level of the Momordica Charantia McRPF transcription factor in tomato leaf tissue can be improved by the recombinant strain transformed by the recombinant overexpression vector pSuper1300-McRPF, so that tomato maturation is accelerated.
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such modifications are intended to be included in the scope of the present invention.
SEQUENCE LISTING
<110> institute of agriculture and facility agriculture of academy of agricultural sciences of Guangdong province
<120> bitter gourd transcription factor for regulating fruit and vegetable fruit ripening and application thereof
<130>
<160> 8
<170> PatentIn version 3.5
<210> 1
<211> 762
<212> DNA
<213> McRPF
<400> 1
atgggtctac gagacatcgg agcaactctt cctcccgggt ttaggtttta tccgagcgat 60
gaggaattgg tgtgccatta tttgtacaaa aagatcacaa atgaagaggc tttgaggggg 120
acgttggtcg agattaactt gcatacttgt gagccatggc agcttcctga ggtggctaaa 180
ttgaacagaa acgagtggta cttcttcagt tttcaagatc gaaaatacgc aacgggagtg 240
agggcgaacc gtgcaacaat cggtggatac tggaaagcga ccggaaaaga tcggacagtg 300
atgaatccaa agacaagtga ggtgatgggg atgagaaaga ctttggtatt ttacagaaaa 360
agggctccta atgggatcaa aactggttgg attatgcatg aatttcgcat tcagactccg 420
catatgtccc caaaggcgga ctgggttctc tgcagagttt ttccccagag caagcgagac 480
gagatcacca cacaaacagc tacacatatc tatcggccga ttacattcga tgcagccacc 540
cccgctccat cgtctttcta ttcactcccg agccacgtcc agtttccgcc tgcagcggac 600
gtcaatatgc tgccatttaa caacgtcaac ttggaagtag aagctgaagc tggaggcttg 660
atatcaaatg gagttgatga ttcaactaca cagcaaagga agtttgagtc tgaagattgc 720
atccaaaatg gcttcttcca ttttgactat tttgttgctt ga 762
<210> 2
<211> 253
<212> PRT
<213> McRPF
<400> 2
Met Gly Leu Arg Asp Ile Gly Ala Thr Leu Pro Pro Gly Phe Arg Phe
1 5 10 15
Tyr Pro Ser Asp Glu Glu Leu Val Cys His Tyr Leu Tyr Lys Lys Ile
20 25 30
Thr Asn Glu Glu Ala Leu Arg Gly Thr Leu Val Glu Ile Asn Leu His
35 40 45
Thr Cys Glu Pro Trp Gln Leu Pro Glu Val Ala Lys Leu Asn Arg Asn
50 55 60
Glu Trp Tyr Phe Phe Ser Phe Gln Asp Arg Lys Tyr Ala Thr Gly Val
65 70 75 80
Arg Ala Asn Arg Ala Thr Ile Gly Gly Tyr Trp Lys Ala Thr Gly Lys
85 90 95
Asp Arg Thr Val Met Asn Pro Lys Thr Ser Glu Val Met Gly Met Arg
100 105 110
Lys Thr Leu Val Phe Tyr Arg Lys Arg Ala Pro Asn Gly Ile Lys Thr
115 120 125
Gly Trp Ile Met His Glu Phe Arg Ile Gln Thr Pro His Met Ser Pro
130 135 140
Lys Ala Asp Trp Val Leu Cys Arg Val Phe Pro Gln Ser Lys Arg Asp
145 150 155 160
Glu Ile Thr Thr Gln Thr Ala Thr His Ile Tyr Arg Pro Ile Thr Phe
165 170 175
Asp Ala Ala Thr Pro Ala Pro Ser Ser Phe Tyr Ser Leu Pro Ser His
180 185 190
Val Gln Phe Pro Pro Ala Ala Asp Val Asn Met Leu Pro Phe Asn Asn
195 200 205
Val Asn Leu Glu Val Glu Ala Glu Ala Gly Gly Leu Ile Ser Asn Gly
210 215 220
Val Asp Asp Ser Thr Thr Gln Gln Arg Lys Phe Glu Ser Glu Asp Cys
225 230 235 240
Ile Gln Asn Gly Phe Phe His Phe Asp Tyr Phe Val Ala
245 250
<210> 3
<211> 28
<212> DNA
<213> Artificial sequence
<400> 3
gctctagaat gggtctacga gacatcgg 28
<210> 4
<211> 32
<212> DNA
<213> Artificial sequence
<400> 4
cccaagcttt caagcaacaa aatagtcaaa at 32
<210> 5
<211> 19
<212> DNA
<213> Artificial sequence
<400> 5
acgagacatc ggagcaact 19
<210> 6
<211> 19
<212> DNA
<213> Artificial sequence
<400> 6
ccctcaaagc ctcttcatt 19
<210> 7
<211> 20
<212> DNA
<213> Artificial sequence
<400> 7
atgggtctac gagacatcgg 20
<210> 8
<211> 23
<212> DNA
<213> Artificial sequence
<400> 8
tcaagcaaca aaatagtcaa aat 23

Claims (5)

1. The application of the overexpression Momordica Charantia McRPF transcription factor in accelerating fruit and vegetable fruit ripening;
wherein the amino acid sequence of the Momordica Charantia McRPF transcription factor is shown in SEQ ID NO. 2;
the fruits and vegetables are bitter gourds and tomatoes.
2. Use according to claim 1, wherein the nucleic acid molecule encoding the Momordica Charantia McRPF transcription factor has the sequence shown in SEQ ID No. 1.
3. The application of the reagent for promoting the expression of the Momordica Charantia McRPF transcription factor in accelerating the fruit ripening of fruits and vegetables;
the Momordica Charantia McRPF transcription factor is a nucleic acid molecule shown as SEQ ID NO. 1;
the fruits and vegetables are bitter gourds and tomatoes;
the reagent comprises at least one of the following (1) to (6):
(1) A recombinant vector containing a nucleic acid molecule shown in SEQ ID NO. 1;
(2) Recombinant bacteria containing nucleic acid molecules shown in SEQ ID NO. 1;
(3) A recombinant bacterium containing the recombinant vector of (1);
(4) Recombinant cells containing nucleic acid molecules shown in SEQ ID NO. 1;
(5) A recombinant cell comprising the recombinant vector of (1);
(6) A recombinant cell comprising the recombinant bacterium of (2).
4. The application of the over-expression bitter gourd McRPF transcription factor in preparing fruit and vegetable ripener;
wherein the amino acid sequence of the Momordica Charantia McRPF transcription factor is shown in SEQ ID NO. 2;
the fruits and vegetables are bitter gourds and tomatoes.
5. The use as claimed in claim 4 wherein the nucleic acid molecule encoding the Momordica Charantia McRPF transcription factor has the sequence shown in SEQ ID No. 1.
CN202210029975.1A 2022-01-12 2022-01-12 Bitter gourd transcription factor for regulating fruit and vegetable fruit ripening and application thereof Active CN114457109B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210029975.1A CN114457109B (en) 2022-01-12 2022-01-12 Bitter gourd transcription factor for regulating fruit and vegetable fruit ripening and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210029975.1A CN114457109B (en) 2022-01-12 2022-01-12 Bitter gourd transcription factor for regulating fruit and vegetable fruit ripening and application thereof

Publications (2)

Publication Number Publication Date
CN114457109A CN114457109A (en) 2022-05-10
CN114457109B true CN114457109B (en) 2022-11-22

Family

ID=81409668

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210029975.1A Active CN114457109B (en) 2022-01-12 2022-01-12 Bitter gourd transcription factor for regulating fruit and vegetable fruit ripening and application thereof

Country Status (1)

Country Link
CN (1) CN114457109B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117210611B (en) * 2023-10-30 2024-03-15 广东省农业科学院蔬菜研究所 Internal reference gene of balsam pear with different tissues and fruits with different maturity stages and application thereof

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2599870A3 (en) * 2006-06-15 2013-09-11 CropDesign N.V. Plants having enhanced yield-related traits and a method for making the same
IN2014CN02009A (en) * 2011-10-21 2015-05-29 Basf Plant Science Co Gmbh
EP3114228A1 (en) * 2014-03-06 2017-01-11 BASF Plant Science Company GmbH Plants having one or more enhanced yield-related traits and a method for making the same
CN110129335B (en) * 2019-05-27 2022-04-15 河南科技大学 Grape fruit maturation related gene VvNAC and application thereof
CN111690046B (en) * 2020-07-03 2021-10-26 南京农业大学 Pear transcription factor PbHB.G7.2 and application thereof in promoting fruit ripening
CN112322644B (en) * 2020-11-26 2022-06-10 浙江大学 Application of tomato SlSPY gene in controlling tomato fruit ripening process

Also Published As

Publication number Publication date
CN114457109A (en) 2022-05-10

Similar Documents

Publication Publication Date Title
CN109081865B (en) Phyllostachys pubescens PeVQ28 protein and coding gene and application thereof
CN114457109B (en) Bitter gourd transcription factor for regulating fruit and vegetable fruit ripening and application thereof
CN117683109A (en) Application of ScF3&#39; H gene in improving cold resistance of potatoes
CN109055392A (en) State&#39;s orchid allelotaxis controlling gene and its coding albumen and application
CN109295075B (en) NfOCP1 drought-resistant gene, amino acid sequence coded by same and application thereof in improving plant drought resistance
CN115197951B (en) Tea tree flavonol synthesis candidate gene CsNAC086 and application thereof
CN114134157B (en) Application of IbSAP15 gene in regulation and control of leaf type and flower type of sweet potato
CN102559699A (en) CsCoL1 gene relative to cymbidium sinense photoperiod and application of CsCoL1 gene
CN106939314B (en) Halophyte drought-resistant gene Hg.S4 and application thereof
CN110387376B (en) Application of expression vector containing mung bean flowering gene VrFT5a
CN109897865B (en) Method for increasing iron content in plant tissue
CN110343159B (en) Application of expression vector of mung bean flowering gene VrELF3
CN109207490B (en) Nfgdh drought-resistant gene, amino acid sequence coded by same and application thereof in improving plant drought resistance
CN107603988B (en) Nostoc flagelliforme NfcrtO drought-resistant gene and amino acid sequence and application thereof
CN107602675B (en) Nostoc flagelliforme Nfcuspin 1 drought-resistant gene and amino acid sequence and application thereof
CN106011145B (en) A kind of adversity gene and its coding albumen and application from jerusalem artichoke
CN113173981B (en) Phyllostachys pubescens PeDREB3 gene and application thereof in plant cold resistance regulation
CN114438103B (en) Transcription factor OsNAC15 gene for regulating drought and salt stress tolerance of rice and application thereof
CN116286952B (en) Application of soybean GmSAMMT gene in regulating and controlling plant protein content and/or yield
CN115011631B (en) Protein for regulating drought resistance of corn at seedling stage, and coding gene and application thereof
KR102051453B1 (en) Expression vector and process for enhancing biomass of plants by using suppression of PagSAP11 gene
CN109337917B (en) Nfdirp drought-resistant gene, coded amino acid sequence thereof and application thereof in improving plant drought resistance
CN115851812B (en) Dragon fruit HuC3H35 gene and encoding protein and application thereof
CN114836463B (en) Efficient genetic transformation method for broccoli by taking fleshy pedicel as explant
CN113373158B (en) Application of sesame SiWRKY67 gene in regulation and control of melatonin synthesis

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant