CN114836463B

CN114836463B - Efficient genetic transformation method for broccoli by taking fleshy pedicel as explant

Info

Publication number: CN114836463B
Application number: CN202210311643.2A
Authority: CN
Inventors: 虞慧芳; 顾宏辉; 盛小光; 王建升; 沈钰森; 赵振卿
Original assignee: Zhejiang Academy of Agricultural Sciences
Current assignee: Zhejiang Academy of Agricultural Sciences
Priority date: 2022-03-28
Filing date: 2022-03-28
Publication date: 2023-09-05
Anticipated expiration: 2042-03-28
Also published as: CN114836463A

Abstract

The invention discloses a high-efficiency genetic transformation method of broccoli with fleshy pedicel as an explant, which comprises the following steps: (1) selecting a fleshy pedicel explant; (2) sterilization of explants: cleaning and sterilizing the meat pedicel; (3) preculture of the explants; (4) dip-dyeing of the explants; (5) co-culturing the explant and bacterial liquid; (6) delay culture of explants: (7) screening and culturing the explants; (8) rooting culture of the resistant buds; (9) positive detection of regenerated plants: the plants which are positive through the double detection of PCR and GUS staining are the broccoli genetic transformation positive seedlings. The method can regenerate the fleshy pedicel to bud in a short time, the positive rate of the genetically transformed plant is 22-25%, the transformation time is short, the transformation result is stable, and the test repeatability is high.

Description

Efficient genetic transformation method for broccoli by taking fleshy pedicel as explant

Technical Field

The invention relates to a high-efficiency genetic transformation method of broccoli, in particular to a high-efficiency genetic transformation method of broccoli with fleshy pedicel as an explant.

Background

Broccoli (Brassica oleracea l. Var. Itica) is a variety of edible products in which the brassica oleracea brassica seed consists of flower buds, flower stalks, meat-based flower stalks and part of stems, and is highly favored by people because of its rich nutrition and its rich sulforaphane. With global warming, anomalous weather increasingly affects broccoli field production. The research and cultivation of broccoli varieties with disease and insect resistance, high temperature resistance, severe cold resistance, drought resistance and the like are extremely important for agricultural safety production. The agrobacterium-mediated genetic transformation technology is an important means for rapid transfer of exogenous excellent genes and site-directed mutation of target endogenous genes, and is also an extremely important link in gene function verification. Therefore, the establishment of the efficient genetic transformation method of the broccoli has important significance for molecular breeding and gene function research of the broccoli.

At present, the genetic transformation of broccoli is less reported, and the problems of low transformation efficiency, poor experimental repeatability and the like exist.

Disclosure of Invention

The invention aims to provide a high-efficiency genetic transformation method for broccoli by taking a fleshy pedicel as an explant, which solves the problem of genetic transformation of broccoli, and the fleshy pedicel can regenerate and bud in a short time, the positive rate of a genetic transformation plant is 22-25%, the transformation time is short, the transformation result is stable, and the test repeatability is high.

In order to achieve the above object, the present invention provides a method for efficient genetic transformation of broccoli using fleshy pedicel as an explant, comprising:

(1) Selecting a meat pedicel explant: removing upper flower buds of the flower bulbs of the mature broccoli, and selecting meat peduncles with the transverse diameter of 0.3-1.8 cm as explants; for the explant, if the transverse diameter of the explant is smaller than 0.3cm, the explant is too tender and has weak tolerance to agrobacterium, and the contact area of a notch and a leaching solution is too small, so that the genetic transformation positive rate is obviously reduced; the lateral diameter of the explant is larger than 1.8cm, the incision area is too large, a large amount of quinone substances can be generated in the culture process, the incision browning is accelerated, and the bud regeneration efficiency is obviously reduced. Therefore, the pedicel explant with the transverse diameter of 0.3-1.8 cm has higher bud regeneration capability, and simultaneously has stronger tolerance to agrobacterium (the browning degree of the explant is very low when the agrobacterium is infected for 20-30 min), thus being most suitable for agrobacterium-mediated genetic transformation;

(2) Sterilization of explants: cleaning and sterilizing the meat pedicel;

(3) Preculture of explants: sucking the surface moisture of the sterilized meat peduncles, cutting wounds at two ends of the meat peduncles, cutting the explants into small sections with the length of 0.5-1.5 cm, and pre-culturing the explants in an explant pre-culture medium for 3-7 d at 25 ℃ for 16h/d; wherein the explant pre-culture medium comprises: MS culture medium, 30g/L sucrose, 8g/L agar, 1.5-2.0 mg/L6-BA, 0.01-0.05 mg/L NAA, 0.4-0.5 mg/LTrans-ZT, pH is 5.6-6.0;

(4) Dip-staining of explants: placing the pre-cultured explant in an explant dip dyeing liquid for dip dyeing; wherein, the preparation of the explant dye liquor comprises the following steps: the agrobacterium strain GV3101 with the target gene vector pCambia1301 is shake cultured at 28 ℃ overnight to bacterial liquid OD ₆₀₀ Centrifuging the bacterial solution to 0.6-1.0, discarding the supernatant, suspending with the same volume of sterile MS-sucrose solution, and adding acetosyringone with the final concentration of 20mg/L to obtain the explant leaching solution; wherein the sterile MS-sucrose solution comprises: MS liquid culture medium and 20g/L sucrose; the nucleotide sequence of the target gene is shown as SEQ ID NO. 1;

(5) Co-culturing the explant and bacterial liquid: sucking the surface liquid of the impregnated explant to dry, adding a piece of sterile filter paper on the surface layer of the explant co-culture medium, placing the explant on the filter paper after the filter paper is wetted, and co-culturing for 3d under the dark condition; wherein the explant co-culture medium comprises: MS culture medium, 30g/L sucrose, 9g/L agar, 1.5-2.0 mg/L6-BA, 0.01-0.05 mg/LNAA, 0.4-0.5 mg/L Trans-ZT, and pH is 5.6-6.0; the surface layer of the co-culture medium is paved with sterile filter paper, so that the pollution rate of the explant can be effectively reduced, the co-culture stage is an important stage of infecting incision cells of the explant by agrobacterium, the activity of bacteria in a dry environment can be greatly reduced or even dead, the activity of the agrobacterium is favorably maintained by high humidity, and the infection positive rate is improved, so that the concentration of agar in the co-culture medium is smaller than that of other types of culture mediums, and the water content in the culture medium is larger; the invention can carry out agrobacterium infection in a longer time (3 d) without damaging the explant, and can improve the positive rate of regenerated plants;

(6) Delay culture of explants: transferring the co-cultured explant into an explant delay culture medium, and carrying out delay culture for 5-7 d at 25 ℃ with the illumination time of 16h/d; wherein the explant retardation medium comprises: MS culture medium, 30g/L sucrose, 9g/L agar, 1.5-2.0 mg/L6-BA, 0.01-0.05 mg/LNAA, 0.4-0.5 mg/LTrans-ZT, 300mg/L timentin, and pH value of 5.6-6.0;

(7) Explant screening culture: transferring the explants subjected to delay culture into an explant screening culture medium, screening and culturing at 25 ℃, and transferring the explants onto a new explant screening culture medium every 10-15 d for 16h/d under illumination until resistant buds grow; wherein the explant selection medium comprises: MS culture medium, 30g/L sucrose, 8g/L agar, 1.5-2 mg/L6-BA, 0.01-0.05 mg/LNAA, 300mg/L timentin and 5-50 mg/L hygromycin, and the pH value is 5.6-6.0;

(8) Rooting culture of resistant buds: cutting off regenerated resistant buds from the lower part of a growing point, transferring the buds to a bud rooting culture medium, and culturing until roots grow out; wherein the bud rooting medium comprises: MS culture medium, 0.05-0.1 mg/LNAA, 30g/L sucrose, 8g/L agar, 300mg/L timentin and 5mg/L hygromycin, and the pH value is 5.6-6.0;

(9) Positive detection of regenerated plants: the plants which are positive through the double detection of PCR and GUS staining are the broccoli genetic transformation positive seedlings; the PCR takes genomic DNA of the rooting resistant seedling leaves as a template, the nucleotide sequences of the adopted primers are shown as SEQ ID NO.6 and SEQ ID NO.7, the band of the PCR product is at 658bp, and the result is positive; the GUS staining indicates that blue dots or blue is positive on the white background of the leaf.

Preferably, the broccoli selection plants and flower bulbs grow healthy broccoli.

Preferably, 2-4% sodium hypochlorite solution is adopted for sterilizing the fleshy pedicel.

Preferably, the meat pedicel is sterilized: cutting the meat peduncles into small sections within 5cm, sterilizing by using 2-4% sodium hypochlorite solution, and cleaning by using sterile water.

Preferably, the sterilization time of the fleshy pedicel is 10-15 min.

Preferably, the explant is impregnated for 10-30 min.

Preferably, the PCR reaction system is: template, 2 XPCRmix, upstream primer, downstream primer and water.

Preferably, the PCR reaction procedure is: 94 ℃ for 3min;94℃30s,55℃15s,72℃15s,30 cycles; extending at 72deg.C for 7min, and maintaining at 16deg.C.

Preferably, the GUS staining is: taking leaves of a positive plant detected by PCR, adding GUS dyeing working solution to fully submerge the leaves, placing the leaves in a vacuumizing tank, vacuumizing for 5min, and then preserving heat for 2h at 30 ℃; the leaves are transferred into 70% ethanol for decoloration for 3-4 times until a negative control is white, wherein the negative control is the leaves of a plant which does not contain 658bp bands through PCR detection; and observing that blue small dots on the white background of the leaf are positive plants by naked eyes.

The efficient genetic transformation method of broccoli with the fleshy pedicel as the explant solves the problem of genetic transformation of broccoli, and has the following advantages:

the invention establishes a high-efficiency genetic transformation system taking the broccoli fleshy pedicel as an explant for the first time, and combines the PCR detection and GUS staining results, the positive rate of the genetic transformation plant is about 22-25% (which is superior to the reported time and transformation efficiency required by the broccoli genetic transformation). The invention can realize the regeneration of transgenic positive seedlings within 2-3 months, has short transformation time, stable transformation result and high test repeatability, and has important significance for broccoli molecular breeding and gene function research.

Drawings

FIG. 1 is a photograph of a regenerated bud of a fleshy pedicel of broccoli obtained by the method of the present invention.

FIG. 2 shows the results of the detection of the regenerated resistant seedlings (A) and the non-resistant seedlings (B) obtained by the method of the present invention.

FIG. 3 shows the results of PCR detection (A) and GUS staining (B) of the target gene of the plant with the regeneration resistance of the fleshy pedicel of broccoli by the method of the present invention.

Detailed Description

The following description of the technical solutions in the embodiments of the present invention will be clear and complete, and it is obvious that the described embodiments are only some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

Example 1

1. Preparation of culture Medium

The medium comprising the stages of genetic transformation is formulated as follows. And (3) injection: the preparation of the basic culture medium (MS+sucrose+agar) requires autoclaving at 121 ℃ for 20min, and various hormones, timentin and hygromycin are added after the basic culture medium is sterilized at high temperature and cooled to about 60 ℃.

(1) Explant preculture medium: MS medium+30 g/L of sucrose+8 g/L of agar+6-BA 1.5 mg/L+NAA0.01 mg/L+Trans-ZT 0.4mg/L (Trans-zeatin, CAS number 1637-39-4, available from microphone), pH 5.8;

(2) Explant co-culture medium: MS culture medium, sucrose 30g/L, agar 9g/L, 6-BA 1.5 mg/L, NAA0.01 mg/L, trans-ZT 0.4mg/L and pH 5.8;

(3) Explant retardation medium: MS culture medium, 30g/L of sucrose, 9g/L of agar, 1.5 mg/L of 6-BA, 0.01mg/L of NAA, 0.4mg/L of Trans-ZT, 300mg/L of timentin and pH 5.8;

(4) Explant selection medium: MS culture medium, sucrose 30g/L, agar 8g/L, 6-BA 1.5 mg/L, NAA0.01 mg/L, timentin 300mg/L, hygromycin 50mg/L and pH 5.8;

(5) Bud rooting medium: MS culture medium, NAA 0.05mg/L, sucrose 30g/L, agar 8g/L, timentin 300mg/L, hygromycin 5mg/L and pH 5.8.

2. Construction of broccoli gene expression vector

(1) Gene cloning

Primers were designed based on the TO1000SOC1 gene sequence (SEQ ID NO. 1) as follows:

SOC1-KpnI-F(SEQ ID NO.2)：

GCGGGTCGACGGTACCATGGTGAGGGGGAAAACTC；

SOC1-KpnI-R(SEQ ID NO.3)：

TAGACATATGGGTACCTCACTTTCTTGAAGAACAAGG。

RNA was extracted from broccoli shoots and reverse transcribed into cDNA (using HiScript 1st Strand cDNA Synthesis Kit from Vazyme Inc.), as follows:

(1.1) RNA template denaturation

The mixture shown in Table 1 below was prepared in an RNase-free centrifuge tube, heated at 65℃for 5min, rapidly quenched on ice, and allowed to stand on ice for 2min.

Table 1 shows the components of the mixture for RNA template denaturation

(1.2) first Strand cDNA Synthesis

Mixing the mixed solution obtained in the step (1.1) with 2 xRT Mix and HiScript II Enzyme Mix, specifically shown in table 2, lightly blowing and mixing by a pipette, reacting for 45min at 50 ℃ and reacting for 5min at 85 ℃.

Table 2 shows the components of the mixture for cDNA synthesis

(1.3) PCR amplification

PCR amplification was performed using the above primers SOC1-KpnI-F and SOC1-KpnI-R (Vazyme company phanta max super-fidelity DNA Polymerase) using cDNA as a template.

The PCR reaction (total volume 50. Mu.L) was as follows in Table 3:

the PCR reaction procedure was: 95 ℃ for 30s; (95 ℃ C. For 15s, annealing temperature for 15s, extension for 1min at 72 ℃ C.) x 39 cycles; finally, the temperature is 72 ℃ and the time is 5min.

The PCR products were subjected to gel electrophoresis, and the result showed that the amplification was carried out to a single band (642 bp) with the correct size.

(2) Vector construction

Vector pCambia1301 (VT 1842, purchased from youbao organisms, whose structure is shown in fig. 3) was linearized (using corresponding restriction enzyme products from Thermo or Takara) by single cleavage with KpnI, and the cleavage reaction system is shown in table 4 below.

Table 4 shows the cleavage reaction system

The digested products were purified and subjected to a recombination reaction with the above PCR products (the recombination reaction kit was Vazyme ClonExpress-II One Step Cloning Kit), and the recombination ligation reaction system (total volume 10. Mu.l) was as shown in Table 5 below.

Table 5 shows a recombinant ligation reaction system

The reaction solution is gently sucked and beaten by a pipette, collected to the bottom of a tube by short centrifugation, placed at 37 ℃ for reaction for 30min, and then immediately placed on ice for cooling.

(3) Recombinant product transformed E.coli DH5 alpha cells

The specific transformation procedure for transforming E.coli DH 5. Alpha. Cells with the recombinant product is as follows:

(3.1) adding 10. Mu.L of the product of the above recombinant ligation reaction to 100. Mu.L of E.coli competent cells;

(3.2) ice bath for 30min;

(3.3) heat shock at 42 ℃ for 60-90 s;

(3.4) ice bath for 2min;

(3.5) adding 800. Mu.L of LB liquid medium;

(3.6) shaking culture at 37 ℃ for 30min;

(3.7) centrifuging at 6000rpm for 3min, discarding the supernatant, and coating a Kana (50 mg/L) resistant medium plate;

(3.8) after inverted culture at 37 ℃ for 12-16 hours, picking out resistant colonies;

(3.9) 100. Mu.L of LB (Kana-containing) liquid medium was added to each well in a 96-well plate;

(3.10) taking 4-8 colonies from each plate, and performing amplification culture at 37 ℃ and 180rpm for 2 hours;

(3.11) taking 1 mu L of bacterial liquid for PCR positive detection;

(3.12) picking up PCR positive transformants, culturing and extracting plasmids by shaking bacteria, sequencing amplified products, wherein amplified and sequenced primers are vector sequences inserted into two sides of a target gene, and the primers are as follows:

35S-F(SEQ ID NO.4)：

5’-GACGCACAATCCCACTATCC-3’；

2301-F(SEQ ID NO.5)：

5’-GCTTCCGGCTCGTATGTTG-3’。

(4) Agrobacterium competent cells (GV 3101) transformed with positive plasmid

After sequencing the PCR amplified product, the positive plasmid containing the target gene is transformed into competent cells of Agrobacterium GV3101, and the specific transformation steps are as follows:

(4.1) thawing Agrobacterium GV3101 competent cells 100. Mu.L on ice;

(4.2) adding 3. Mu.L of pCambia1301 plasmid DNA with the desired fragment, standing on ice for 30min, freezing in liquid nitrogen for 1min, and then water-bathing at 37℃for 3min;

(4.3) adding 900. Mu.L of YEP culture medium without antibiotics, and culturing at 28 ℃ at 200rpm/min with shaking for 3 hours;

(4.4) centrifugation at 10000rpm for 1min to concentrate the bacterial liquid, and re-dissolving the bacterial cells with 100. Mu.LYEP;

(4.5) the re-solubilized cells were plated on solid YEP medium supplemented with 50mg/L kanamycin, and cultured at 28℃for 12-16 hours.

(4.6) PCR identification of positive colonies, PCR primers were as above: 35S-F and 2301-F.

(5) Analysis of vector sequencing results

Comparing the sequencing results, and displaying the results: the target gene is inserted into the vector, and the expression vector is constructed accurately.

3. Acquisition of Agrobacterium-mediated regenerated plants from broccoli by genetic transformation

(1) Selection of meat-based pedicel explants

Selecting a healthy broccoli with a healthy plant and a healthy flower bulb as a donor plant, taking the flower bulb with the diameter of about 10cm, removing the flower bud at the upper part, and selecting the fleshy flower stalk with the transverse diameter of 0.3-1.8 cm as an explant.

(2) Sterilization of explants

Cutting the fleshy pedicel into small sections within 5cm for convenient disinfection and cleaning, cleaning with purified water for 3 times, then placing the sections into a 2% sodium hypochlorite solution, slightly shaking (60 rpm) on a shaking table for surface disinfection for 15min, and cleaning with sterile water on an ultra-clean bench for 4 times for later use.

(3) Pre-culture of explants

Placing the sterilized fleshy pedicel on sterile filter paper on an ultra-clean bench, sucking surface moisture, and cutting off wounds at two ends of the fleshy pedicel. Finally, the explants were cut into small pieces of about 0.5-1.5 cm in length and pre-incubated in explant pre-culture medium for 3d (25 ℃ C., 16h/d light).

(4) Preparation of explant soaking dye solution

Agrobacterium strain GV3101 constructed with the vector of the desired gene SOC1 (SEQ ID NO. 1) (pCambia 1301) was shake-cultured overnight at 28℃to a bacterial liquid OD ₆₀₀ =1.0. Centrifuging the bacterial liquid for 10min at 5000rmp, and discarding the supernatant; suspending with sterile MS-sucrose solution (MS liquid culture medium+20g/L sucrose, high temperature sterilizing), adding acetosyringone with final concentration of 20mg/L to obtain explant soaking solution, and standing at normal temperature for 1 hr.

(5) Dip-staining of explants

And (3) lightly placing the pre-cultured pollution-free explant in the bacterial liquid prepared in the step (4) for 10min by using sterile long-handled forceps.

(6) Co-culture of explant and bacterial liquid

The impregnated explant is lightly placed on sterile filter paper by using sterile long-handled forceps, and surface bacterial liquid is sucked dry. The surface layer of the explant co-culture medium is added with a piece of sterile filter paper, the explant is vertically placed on the filter paper after the filter paper is wetted, and the explant is co-cultured for 3d under the dark condition. The placed sterile filter paper can absorb residual agrobacterium after infection of the explant, and reduce the pollution rate of the explant.

(7) Delay culture of explants

The explants after 3d of co-cultivation were transferred to an explant retardation medium and subjected to retardation cultivation of 7d (25 ℃ C., 16h/d light).

(8) Screening culture of explants

After the completion of the above-mentioned delayed culture, the explants were transferred to an explant selection medium (25 ℃ C., 16h/d of illumination) and the explants were transferred to a new explant selection medium every 15d until resistant shoots were grown (about 20 days). Finally, a total of 121 uncontaminated explants, of which 69 regenerated resistant shoots.

(9) Rooting culture of resistant buds

And cutting off the regenerated buds from the lower part of the growing point, transferring the regenerated buds to a bud rooting culture medium, and culturing until roots grow out, wherein 88 resistant plants with good rooting are obtained finally.

4. Positive detection of regenerated plants

(1) PCR detection of resistant regenerated plants

After constructing the target gene (SOC 1) into the vector (pCambia 1301), PCR primers were designed according to the target gene and the vector sequence, the primer sequences were as follows:

upstream primer SOC1TransPF1 (SEQ ID NO. 6):

GCGGGTCGACGGTACC(5’-3’)；

the downstream primer SOC1TransPR1 (SEQ ID NO. 7):

TCACTTTCTTGAAGAACAAGGTAACC(5’-3’)。

the genomic DNA of the rooting resistant seedling leaf is used as a template, the untransformed plant leaf DNA is used as a negative control, and the recombinant plasmid pCambia1301 is used as a positive control for PCR amplification.

The PCR procedure was: 94 ℃ for 3min;94℃30s,55℃15s,72℃15s,30 cycles; extending at 72deg.C for 7min, and maintaining at 16deg.C.

The PCR reaction system is as follows: 1. Mu.L of template, 10. Mu.L of 2 XPCR mix, 1. Mu.L of 10. Mu.M upstream primer, 1. Mu.L of 10. Mu.M downstream primer and 7. Mu.L of water.

After the PCR reaction is completed, taking the PCR product to carry out 1% agarose gel electrophoresis, wherein the negative control has no target band, the positive control has a bright target band (658bp,SEQ ID NO.8), the genomic DNA of the transformed resistant seedling leaf has a 658bp band, namely a positive plant, and the non-banded plant is a plant which is not transformed successfully. The results showed that of the 88 resistant plants with good rooting, 30 plants with a 658bp band of interest were detected by PCR.

(2) GUS staining of positive plant leaves by PCR detection

GUS staining working fluid was prepared according to the instructions of GUS staining fluid kit (available from Beijing Leagene, CAS number 18656-96-7).

Cutting 88 tender leaves of a PCR detection positive plant into a finger tube, adding a proper amount of GUS dyeing working solution to completely submerge the leaves, placing the leaves in a vacuumizing tank, vacuumizing for 5min, and then preserving heat at 30 ℃ for 2h; the leaves are transferred into 70 percent ethanol for decoloration for 3 to 4 times until negative control (untransformed plant leaves) is white; and (3) observing with naked eyes, wherein blue small dots (GUS expression sites) are arranged on the white background of the leaf, so that the leaf is a positive plant. The results showed that the PCR detection showed 27 plants with blue spots on GUS staining among 30 plants with the band of interest.

The method of the invention obtains 27 strains of broccoli genetic transformation positive seedlings (namely, positive seedlings with successful genetic transformation by double positive PCR detection and GUS staining detection) in a short time, and the total number of uncontaminated explants for experiments is 121, and the genetic transformation efficiency is 27/121×100% =22.31%.

Example 2

1. Preparation of culture Medium

Substantially the same as in example 1, except for the concentration of each component, the formulation of the medium at each stage of genetic transformation in this example was as follows:

(1) Explant preculture medium: MS culture medium, sucrose 30g/L, agar 8g/L, 6-BA 2.0mg/L, NAA 0.05mg/L, trans-ZT 0.5mg/L and pH 6.0;

(2) Explant co-culture medium: MS culture medium, sucrose 30g/L, agar 9g/L, 6-BA 2.0mg/L, NAA 0.05mg/L, trans-ZT 0.5mg/L and pH 6.0;

(3) Explant retardation medium: MS culture medium, sucrose 30g/L, agar 9g/L, 6-BA 2.0mg/L, NAA 0.05mg/L, trans-ZT 0.5mg/L, 300mg/L and timentin, and pH 6.0;

(4) Explant selection medium: MS culture medium, sucrose 30g/L, agar 8g/L, 6-BA 2.0mg/L, NAA 0.05mg/L, trans-ZT 0.5mg/L, timentin 300mg/L, hygromycin 5mg/L and pH 6.0;

(5) Bud rooting medium: MS culture medium, NAA 0.1mg/L, sucrose 30g/L, agar 8g/L, timentin 300mg/L, hygromycin 5mg/L and pH 6.0;

2. acquisition of Agrobacterium-mediated regenerated plants from broccoli by genetic transformation

(1) Selection of meat-based pedicel explants

And selecting the healthy broccoli growing on the plant and the flower ball as a donor plant, and taking the flower ball with the diameter of about 12 cm. Removing upper flower buds, and selecting meat-based flower stalks with the transverse diameter of 0.3-2.0cm as explants.

(2) Sterilization of explants

Cutting the fleshy pedicel into small sections within 5cm for convenient disinfection and cleaning, cleaning with purified water for 3 times, then placing the sections into a 4% sodium hypochlorite solution, slightly shaking (60 rpm) on a shaking table for surface disinfection for 10min, and cleaning with sterile water on an ultra-clean bench for 4 times for later use;

(3) Pre-culture of explants

Placing the sterilized meat peduncles on sterile filter paper on an ultra-clean bench, sucking surface moisture, and cutting off wounds soaked by sterilizing liquid at two ends of the meat peduncles. Finally, the explants were cut into small pieces of about 0.5-1.5 cm in length and pre-incubated in explant pre-culture medium for 7d (25 ℃ C., 16h/d light).

(4) Preparation of explant soaking dye solution

The agrobacterium strain GV3101 constructed with the target gene vector (pCambia 1301) is shake cultured overnight at 28 ℃ until the bacterial liquid OD ₆₀₀ =0.6. Centrifuging the bacterial liquid for 10 minutes at 5000rmp, and discarding the supernatant; suspending with sterile MS-sucrose solution (MS liquid culture medium+20g/L sucrose, high temperature sterilizing), adding acetosyringone with final concentration of 20mg/L, and standing at normal temperature for 1 hr.

(5) Dip-staining of explants

The explants without pollution after pre-culture for 7d were gently placed in bacterial solution for 30min with sterile long handled forceps.

(6) Co-culture of explant and bacterial liquid

The impregnated explant is lightly placed on sterile filter paper by using sterile long-handled forceps, and surface bacterial liquid is sucked dry. A piece of sterile filter paper is added to the surface layer of the co-culture medium, the explant is placed vertically on the filter paper after the filter paper is wetted, and co-culture is performed for 3d under dark conditions.

(7) Delay culture of explants

The explants after 3d co-cultivation were transferred to an explant retardation medium and incubated for 5d (25 ℃ C., 16h/d light).

(8) Screening culture of explants

After the end of the delay culture, the explants were transferred to an explant selection medium, and selection was performed for 4 weeks (25 ℃ C., 16h/d of light), wherein the explants were transferred to a new explant selection medium every 10d until resistant shoots developed. Eventually, a total of 113 uncontaminated explants, of which 72 regenerated resistant shoots.

(9) Rooting culture of resistant buds

And cutting the regenerated resistant buds from the lower part of the growing point, transferring the buds to a bud rooting culture medium, and culturing until roots grow out, wherein the total number of the resistant plants with good rooting is 80.

3. Positive detection of regenerated plants

(1) PCR detection of resistant regenerated plants

The same method as in example 1 was used to test, and the results showed that: among 80 resistant plants with good rooting, 33 plants with a 658bp target band were detected by PCR.

(2) GUS staining of positive plant leaves by PCR detection

The same method as in example 1 was used to test, and the results showed that: PCR detection of 29 plants with blue spots on GUS staining out of 33 plants with the band of interest.

29 strains of the broccoli genetic transformation positive seedlings (PCR and GUS staining double positive seedlings are positive seedlings with successful genetic transformation) are obtained in a short time by the method, 113 uncontaminated explants are used for experiments, and the genetic transformation efficiency is 29/113=25.66%.

While the present invention has been described in detail through the foregoing description of the preferred embodiment, it should be understood that the foregoing description is not to be considered as limiting the invention. Many modifications and substitutions of the present invention will become apparent to those of ordinary skill in the art upon reading the foregoing. Accordingly, the scope of the invention should be limited only by the attached claims.

Comparative example 1

The procedure used for the genetic transformation of regenerated plants from broccoli of example 1 was followed, except that the concentrations of 6-BA, NAA and Trans-ZT in the medium were varied.

TABLE 6 Effect of combinations of 6-BA and NAA at different concentrations on the efficiency of regeneration of the pedicel of the meat of broccoli

TABLE 7 Effect of Trans-ZT addition at different concentrations on efficiency and time of regeneration of the pedicel of the meat of broccoli

6-BA is an artificially chemically synthesized cytokinin that promotes shoot regeneration, while NAA is an auxin that promotes root growth. The invention researches the combination of cytokinin and auxin with different concentrations, and the budding rate of the broccoli meat pedicel explant is completely different under different concentration ratios. In addition, by adding a certain concentration of Trans-ZT (Trans-zeatin, natural cytokinin), the regeneration of the fleshy pedicel explant buds can be induced more quickly, the bud regeneration time is shortened, and the high-frequency bud regeneration effect is maintained.

Sequence list

<110> academy of agricultural sciences in Zhejiang province

<120> an efficient genetic transformation method of broccoli using fleshy pedicel as explant

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 642

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

atggtgaggg ggaaaactca gatgaagcga atagagaatg caacaagcag acaagtgact 60

ttctctaagc gaaggaatgg tttgttgaaa aaagcctttg agctctcagt gctttgtgat 120

gctgaagttt ctctgatcat cttctctcct aaggcaaaac tttatgaatt cgccagctcc 180

aatatgcaag ataccataga tcgttatctg aggcatacca aggatcgtgt cagcaccaaa 240

cctgtttctg aagaaaattt gcagcatttg aaacatgagg cagcaaacat gatgaagaaa 300

attgaacaac tcgaagcttc caaacgtaaa ctcttgggag aaggcatagg atcatgttcg 360

atagaggagc tgcagcaaat tgagcaacaa cttgagaaaa gtgtcaaatg tatccgagct 420

agaaagactc aagtgtttaa ggaacaaatt gagcagctca agcaaaagga gaaagctcta 480

gctgcagaaa acaagaagct cgctgaaaag tggggatctc atgaaatcga agtccggtcg 540

aataagaacc aagaaagtgg aagaggtgac gaagagagta gcccaagttc tgaagtagag 600

acagagttgt tcattgggtt accttgttct tcaagaaagt ga 642

<210> 2

<211> 35

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

gcgggtcgac ggtaccatgg tgagggggaa aactc 35

<210> 3

<211> 37

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

tagacatatg ggtacctcac tttcttgaag aacaagg 37

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

gacgcacaat cccactatcc 20

<210> 5

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

gcttccggct cgtatgttg 19

<210> 6

<211> 16

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

gcgggtcgac ggtacc 16

<210> 7

<211> 26

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

tcactttctt gaagaacaag gtaacc 26

<210> 8

<211> 658

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

gcgggtcgac ggtaccatgg tgagggggaa aactcagatg aagcgaatag agaatgcaac 60

aagcagacaa gtgactttct ctaagcgaag gaatggtttg ttgaaaaaag cctttgagct 120

ctcagtgctt tgtgatgctg aagtttctct gatcatcttc tctcctaagg caaaacttta 180

tgaattcgcc agctccaata tgcaagatac catagatcgt tatctgaggc ataccaagga 240

tcgtgtcagc accaaacctg tttctgaaga aaatttgcag catttgaaac atgaggcagc 300

aaacatgatg aagaaaattg aacaactcga agcttccaaa cgtaaactct tgggagaagg 360

cataggatca tgttcgatag aggagctgca gcaaattgag caacaacttg agaaaagtgt 420

caaatgtatc cgagctagaa agactcaagt gtttaaggaa caaattgagc agctcaagca 480

aaaggagaaa gctctagctg cagaaaacaa gaagctcgct gaaaagtggg gatctcatga 540

aatcgaagtc cggtcgaata agaaccaaga aagtggaaga ggtgacgaag agagtagccc 600

aagttctgaa gtagagacag agttgttcat tgggttacct tgttcttcaa gaaagtga 658

Claims

1. A method for efficient genetic transformation of broccoli with fleshy pedicel as an explant, which is characterized by comprising the following steps:

(1) Selecting a meat pedicel explant: removing upper flower buds of the flower bulbs of the mature broccoli, and selecting meat peduncles with the transverse diameter of 0.3-1.8 cm as explants;

(2) Sterilization of explants: cleaning and sterilizing the meat pedicel;

(3) Preculture of explants: sucking the surface moisture of the sterilized meat peduncles, cutting off wounds at two ends of the meat peduncles, cutting the explants into small sections with the length of 0.5-1.5 cm, and pre-culturing the small sections in an explant pre-culture medium for 3-7 d at 25 ℃ for 16h/d; wherein the explant pre-culture medium comprises: MS culture medium, 30g/L sucrose, 8g/L agar, 1.5-2.0 mg/L6-BA, 0.01-0.05 mg/LNAA, 0.4-0.5 mg/LTrans-ZT, and pH is 5.6-6.0;

(4) Dip-staining of explants: placing the pre-cultured explant in an explant dip dyeing liquid for dip dyeing; wherein, the preparation of the explant dye liquorComprising: the agrobacterium strain GV3101 with the target gene vector pCambia1301 is shake cultured at 28 ℃ overnight to bacterial liquid OD ₆₀₀ Centrifuging the bacterial solution to 0.6-1.0, discarding the supernatant, suspending with the same volume of sterile MS-sucrose solution, and adding acetosyringone with the final concentration of 20mg/L to obtain the explant leaching solution; wherein the sterile MS-sucrose solution comprises: MS liquid culture medium and 20g/L sucrose; the nucleotide sequence of the target gene is shown as SEQ ID NO. 1;

(5) Co-culturing the explant and bacterial liquid: sucking the liquid on the surface of the impregnated explant to dry, adding a piece of sterile filter paper on the surface layer of the co-culture medium of the explant, placing the explant on the filter paper after the filter paper is wetted, and co-culturing for 3d under the dark condition; wherein the explant co-culture medium comprises: MS culture medium, 30g/L sucrose, 9g/L agar, 1.5-2.0 mg/L6-BA, 0.01-0.05 mg/LNAA, 0.4-0.5 mg/LTrans-ZT, and pH is 5.6-6.0;

(7) Explant screening culture: transferring the explants subjected to delay culture into an explant screening culture medium, screening and culturing at 25 ℃, and transferring the explants onto a new explant screening culture medium every 10-15 d for 16h/d under illumination until resistant buds grow; wherein the explant selection medium comprises: MS culture medium, 30g/L sucrose, 8g/L agar, 1.5-2 mg/L6-BA, 0.01-0.05 mg/L NAA, 300mg/L timentin and 5-50 mg/L hygromycin, and the pH value is 5.6-6.0;

(9) Positive detection of regenerated plants: the plants which are positive through the double detection of PCR amplification and GUS staining are the broccoli genetic transformation positive seedlings; the PCR takes genomic DNA of the rooting resistant seedling leaves as a template, the adopted primer sequences are shown as SEQ ID NO.6 and SEQ ID NO.7, and the result is positive when the band of the PCR product is at 658 bp; the GUS staining indicates that blue dots or blue is positive on the white background of the leaf.

2. The efficient genetic transformation method of broccoli using fleshy pedicel as an explant according to claim 1, wherein the broccoli selects plants and bulbs for healthy growth of broccoli.

3. The efficient genetic transformation method of broccoli using fleshy pedicel as explant according to claim 1, wherein the fleshy pedicel is sterilized with 2-4% sodium hypochlorite solution.

4. The efficient genetic transformation method of broccoli using fleshy pedicel as explant according to claim 1, wherein the fleshy pedicel is sterilized: cutting the meat peduncles into small sections within 5cm, sterilizing by using 2-4% sodium hypochlorite solution, and cleaning by using sterile water.

5. The efficient genetic transformation method of broccoli using fleshy pedicel as explant according to claim 1, wherein the fleshy pedicel sterilization time is 10-15 min.

6. The efficient genetic transformation method of broccoli using fleshy pedicel as explant according to claim 1, wherein the time of the infection is 10-30 min.

7. The efficient genetic transformation method of broccoli using fleshy pedicel as an explant according to claim 1, wherein the PCR reaction system is: template, 2 XPCR mix, upstream primer, downstream primer and water.

8. The efficient genetic transformation method of broccoli using fleshy pedicel as explant according to claim 1, wherein the PCR reaction procedure is: 94 ℃ for 3min;94℃30s,55℃15s,72℃15s,30 cycles; extending at 72deg.C for 7min, and maintaining at 16deg.C.

9. The efficient genetic transformation method of broccoli using fleshy pedicel as explant according to claim 1, wherein the GUS staining is: taking leaves of a positive plant detected by PCR, adding GUS dyeing working solution to fully submerge the leaves, placing the leaves in a vacuumizing tank, vacuumizing for 5min, and then preserving heat for 2h at 30 ℃; the leaves are transferred into 70% ethanol for decoloration for 3-4 times until a negative control is white, wherein the negative control is the leaves of a plant which does not contain 658bp bands through PCR detection; blue small dots or blue positive plants on the white background of the leaf are observed by naked eyes.