CN114561426B - Genetic transformation method of alfalfa - Google Patents
Genetic transformation method of alfalfa Download PDFInfo
- Publication number
- CN114561426B CN114561426B CN202210284506.4A CN202210284506A CN114561426B CN 114561426 B CN114561426 B CN 114561426B CN 202210284506 A CN202210284506 A CN 202210284506A CN 114561426 B CN114561426 B CN 114561426B
- Authority
- CN
- China
- Prior art keywords
- culture
- medium
- genetic transformation
- transformation method
- alfalfa
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H4/00—Plant reproduction by tissue culture techniques ; Tissue culture techniques therefor
- A01H4/002—Culture media for tissue culture
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H4/00—Plant reproduction by tissue culture techniques ; Tissue culture techniques therefor
- A01H4/008—Methods for regeneration to complete plants
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Developmental Biology & Embryology (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Cell Biology (AREA)
- Zoology (AREA)
- Botany (AREA)
- Environmental Sciences (AREA)
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention relates to the technical field of genetic transformation of alfalfa, in particular to a genetic transformation method of alfalfa. The genetic transformation method provided by the invention comprises the following steps: mixing the dyeing solution containing the target gene with the explant to be transformed, and treating for 10min under the vacuum degree of 0.085-0.09 Mpa to obtain a first mixed solution; carrying out ultrasonic treatment on the first mixed solution for 4-5 min to obtain a second mixed solution; treating the second mixed solution for 10min under the vacuum degree of 0.085-0.09 Mpa to obtain an infected explant; and screening the infected explants to obtain transformed plants. The genetic transformation rate of alfalfa is obviously improved through proper vacuum and ultrasonic treatment, and is 7.1% -14.3%; and the genetic transformation rate is stable, and the method has the advantages of high efficiency and repeatability.
Description
Technical Field
The invention relates to the technical field of genetic transformation of alfalfa, in particular to a genetic transformation method of alfalfa.
Background
Alfalfa (Medicago sativa L.) is one of the important pastures planted in China, the planting area is always the first of various pastures, the protein content is rich, the nutritional value is high, and the pastures are the reputation of 'pastures king'. However, the growth and development of alfalfa is seriously affected by adverse stress such as low temperature, drought, salt and alkali. In recent years, the cultivation of stress-resistant varieties is considered as an effective way to improve the resistance of alfalfa against stress. With the development of biotechnology, research on genetic transformation of alfalfa has achieved remarkable results. However, the genetic transformation rate of alfalfa is always low under the influence of factors such as low regeneration frequency, difficult differentiation of explants after agrobacterium infection and the like, and the requirement of rapid development of genetic engineering technology is difficult to meet.
Alfalfa (Medicago falcata L.) is an important forage grass of alfalfa genus, is an ideal forage grass for artificial grassland planting and natural grassland improvement in alpine regions, and is used as an important germplasm resource in reverse breeding of leguminous forage grass due to the characteristics of strong drought resistance, cold resistance, salt and alkali resistance, barren resistance and the like. Although the yield and regeneration of alfalfa is inferior to that of alfalfa, its stress resistance is superior to that of alfalfa. Therefore, alfalfa plays an important role in alfalfa resistance breeding.
In recent years, with the rapid development of biotechnology, the improvement of alfalfa traits by utilizing alfalfa stress-resistance genes has become an important way for genetic breeding of alfalfa. However. Because the genetic transformation system of alfalfa is not established yet, the pace of genetic transformation of alfalfa is seriously affected. Therefore, a stable, efficient and repeatable alfalfa genetic transformation system with high transformation frequency needs to be established, which plays an important role in promoting the development of alfalfa molecular genetic breeding.
Disclosure of Invention
In order to solve the problems, the invention provides a genetic transformation method of alfalfa. The genetic transformation method provided by the invention has the advantages of stability, high efficiency, high transformation frequency and repeatability.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides a genetic transformation method of alfalfa, which comprises the following steps:
mixing the dyeing solution containing the target gene with the explant to be transformed, and treating for 10min under the vacuum degree of 0.085-0.09 Mpa to obtain a first mixed solution;
carrying out ultrasonic treatment on the first mixed solution for 4-5 min to obtain a second mixed solution;
and (3) treating the second mixed solution for 10min under the vacuum degree of 0.085-0.09 Mpa to obtain the infected explant.
Preferably, the infection liquid comprises a liquid culture medium and receptor bacteria containing target genes;
the liquid culture medium comprises the following components in addition to the basic culture medium: 30g/L of sucrose, 100 mu mol/L of acetosyringone, 2,4-D4mg/L and 6-BA0.5mg/L;
the minimal medium comprises the following components: mgSO (MgSO) 4 ·7H 2 O 185mg/L、KNO 3 2830mg/L、(NH 4 ) 2 SO 4 463mg/L、CaCl 2 ·2H 2 O 166mg/L、KH 2 PO 4 400mg/L、MnSO 4 ·H 2 O 10mg/L、H 3 BO 3 5.0mg/L、ZnSO 4 ·7H 2 O 1.0mg/L、KI 1.0mg/L、Na 2 MoO 4 ·2H 2 O 0.1mg/L、CuSO 4 ·5H 2 O 0.2mg/L、CoCl 2 ·6H 2 O0.1 mg/L, EDTA-FeNa 140mg/L, thiamine hydrochloride 5.0mg/L, pyridoxine hydrochloride 5.0mg/L, nicotinic acid 5.0mg/L and inositol 100mg/L; the pH of the basic culture medium is 5.8-6.0.
Preferably, after obtaining the infected explant, further comprising: sequentially performing co-culture, callus culture, embryoid induction, embryoid differentiation and rooting culture on the infected explants to obtain transformed plants;
the co-culture medium comprises, in addition to the minimal medium: 30g/L of sucrose, 100 mu mol/L of acetosyringone, 4mg/L of 2,4-D, 0.5mg/L of 6-BA0.5mg/L and 3g/L of plant gel;
the minimal medium comprises the following components: mgSO (MgSO) 4 ·7H 2 O 185mg/L、KNO 3 2830mg/L、(NH 4 ) 2 SO 4 463mg/L、CaCl 2 ·2H 2 O 166mg/L、KH 2 PO 4 400mg/L、MnSO 4 ·H 2 O 10mg/L、H 3 BO 3 5.0mg/L、ZnSO 4 ·7H 2 O 1.0mg/L、KI 1.0mg/L、Na 2 MoO 4 ·2H 2 O 0.1mg/L、CuSO 4 ·5H 2 O 0.2mg/L、CoCl 2 ·6H 2 O0.1 mg/L, EDTA-FeNa 140mg/L, thiamine hydrochloride 5.0mg/L, pyridoxine hydrochloride 5.0mg/L, nicotinic acid 5.0mg/L and inositol 100mg/L; the pH of the minimal medium is 5.8-6.0.
Preferably, the culture medium for callus culture further comprises, in addition to the minimal medium: 30g/L of sucrose, 4-D4mg/L of 2, 4-B, 6-B0.5 mg/L, timetin mg/L of hygromycin B10mg/L and 3g/L of plant gel, and the PH is 5.8-6.0.
Preferably, the embryoid-induced medium uses MS medium as a minimal medium, and further comprises: 30g/L of sucrose, 1mg/L of kinetin, 6-BA0.5mg/L, timetin mg/L, 5mg/L of hygromycin B and 3g/L of plant gel, and the PH is 5.8-6.0.
Preferably, the embryoid body differentiation medium further comprises, in addition to the minimal medium: sucrose 20g/L, timetin mg/L, hygromycin B5mg/L and plant gel 3g/L. PH5.8-6.0.
Preferably, the rooting culture medium uses MS culture medium as basic culture medium, and further comprises: 10g/L sucrose and 3g/L vegetable gel, and the PH is 5.8-6.0.
Preferably, the culture conditions of embryoid induction, embryoid differentiation and rooting culture respectively comprise: the illumination intensity was 3000Lx, the temperature was 22℃and 16h of illumination/8 h of darkness.
Preferably, the rooting culture further comprises greenhouse culture; the greenhouse culture method comprises the following steps:
transferring the plants subjected to rooting culture into a first substrate, irrigating with a 1/2MS liquid culture medium, covering a preservative film, performing first culture for 10 days, and transferring into a second substrate for second culture;
the first substrate comprises vermiculite and perlite; the volume ratio of the vermiculite to the perlite is 1:1, a step of;
the second substrate comprises nutrient soil and vermiculite; the volume ratio of the nutrient soil to the vermiculite is 1:1, a step of;
the conditions of the first culture and the second culture respectively include: the illumination intensity is 3000Lx, the temperature is 24-26 ℃ and 16h illumination/8 h darkness.
Preferably, the explant to be transformed comprises: seedling leaves are cultivated for 4 to 6 weeks.
The beneficial effects are that:
the invention provides a genetic transformation method of alfalfa, which comprises the following steps: mixing the dyeing solution containing the target gene with the explant to be transformed, and treating for 10min under the vacuum degree of 0.085-0.09 Mpa to obtain a first mixed solution; carrying out ultrasonic treatment on the first mixed solution for 4-5 min to obtain a second mixed solution; treating the second mixed solution for 10min under the vacuum degree of 0.085-0.09 Mpa to obtain an infected explant; and screening the infected explants to obtain transformed plants. The genetic transformation rate of alfalfa is obviously improved through proper vacuum and ultrasonic treatment, and is 7.1% -14.3%; and the genetic transformation rate is stable, and the method has the advantages of high efficiency and repeatability.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are required to be used in the embodiments will be briefly described below.
FIG. 1 is a physical diagram showing the different culture stages in example 1.
Detailed Description
The invention provides a genetic transformation method of alfalfa, which comprises the following steps:
mixing the dyeing solution containing the target gene with the explant to be transformed, and treating for 10min under the vacuum degree of 0.085-0.09 Mpa to obtain a first mixed solution;
carrying out ultrasonic treatment on the first mixed solution for 4-5 min to obtain a second mixed solution;
and (3) treating the second mixed solution for 10min under the vacuum degree of 0.085-0.09 Mpa to obtain the infected explant.
In the present invention, the infection liquid preferably comprises a liquid culture medium and a receptor bacterium containing a target gene; OD of the target gene-containing recipient bacterium in a liquid medium 600 The nm is preferably 0.2 to 0.3.
The liquid medium preferably further comprises, in addition to the minimal medium: 30g/L of sucrose, 100 mu mol/L of acetosyringone, 2,4-D4mg/L and 6-BA0.5mg/L;
the minimal medium preferably comprises the following components: mgSO (MgSO) 4 ·7H 2 O 185mg/L、KNO 3 2830mg/L、(NH 4 ) 2 SO 4 463mg/L、CaCl 2 ·2H 2 O 166mg/L、KH 2 PO 4 400mg/L、MnSO 4 ·H 2 O10mg/L、H 3 BO 3 5.0mg/L、ZnSO 4 ·7H 2 O 1.0mg/L、KI 1.0mg/L、Na 2 MoO 4 ·2H 2 O0.1mg/L、CuSO 4 ·5H 2 O 0.2mg/L、CoCl 2 ·6H 2 O 0.1mg/L、EDTA-FeNa 140mg/L, thiamine hydrochloride 5.0mg/L, pyridoxine hydrochloride 5.0mg/L, nicotinic acid 5.0mg/L and inositol 100mg/L; the pH of the minimal medium is preferably 5.8 to 6.0, more preferably 5.8.
In the present invention, the recipient bacteria preferably include agrobacterium; the agrobacterium preferably comprises EHA105 agrobacterium. The EHA105 Agrobacterium of the present invention is preferably purchased from Shanghai high-feather Biotechnology Co.
The method for constructing the target gene-containing recipient bacterium is not particularly limited, and can be performed by methods known to those skilled in the art.
In the present invention, the alfalfa includes alfalfa or alfalfa; the explant to be transformed preferably comprises: seedling leaves obtained after 4-6 weeks of seed cultivation, more preferably 4 weeks of seedling leaves; the seedling leaves preferably comprise aseptic seedling leaves or greenhouse seedling leaves; when the seedling leaves are greenhouse seedling leaves, the seeds are cultivated for 4 to 6 weeks, and the method preferably further comprises sterilization treatment; the sterilization treatment preferably includes: the greenhouse seedling leaves were rinsed twice with shaking in sterile water, then sterilized with bleach and one drop of tween20 for 10min, and finally rinsed 3 times with sterile water.
The method mixes the dyeing solution containing the target gene with the explant to be transformed, and processes the mixture for 10min under the vacuum degree of 0.085 Mpa-0.09 Mpa to obtain a first mixed solution.
After the first mixed solution is obtained, the first mixed solution is subjected to ultrasonic treatment for 4-5 min to obtain a second mixed solution. In the present invention, the frequency of the ultrasonic treatment is preferably 40kHz; the time of the ultrasonic treatment is 4 to 5 minutes, more preferably 4.5 minutes.
And (3) treating the second mixed solution for 10min under the vacuum degree of 0.085-0.09 Mpa to obtain the infected explant.
The genetic transformation rate of alfalfa is obviously improved through proper vacuum and ultrasonic treatment, and is 7.1% -14.3%; and the genetic transformation rate is stable, and the method has the advantages of high efficiency and repeatability.
After obtaining the infected explant, the present invention preferably further comprises: and (3) sequentially carrying out co-culture, callus culture, embryoid induction, embryoid differentiation and rooting culture on the infected explant to obtain a transformed plant.
In the present invention, the temperature of the co-culture is preferably 22 to 25 ℃, more preferably 24 to 25 ℃; the co-culture is dark culture; the co-cultivation time is preferably 24 to 30 hours, more preferably 26 to 28 hours;
the co-culture medium preferably further comprises, in addition to the minimal medium: 30g/L of sucrose, 100 mu mol/L of acetosyringone, 4mg/L of 2,4-D, 0.5mg/L of 6-BA0.5mg/L and 3g/L of plant gel; the components of the minimal medium are the same as those of the minimal medium, and are not described in detail herein.
In the present invention, the culture medium for callus culture preferably further comprises, in addition to the minimal medium: 30g/L of sucrose, 2,4-D4mg/L, 6-BA0.5mg/L, timetin mg/L, 10mg/L of hygromycin B and 3g/L of plant gel, wherein the components of the basic culture medium are the same as those of the basic culture medium, and are not described in detail herein; the temperature of the callus culture is preferably 22-25 ℃, more preferably 24-25 ℃; the callus culture is dark culture; the callus culture time is preferably once every two weeks and 2-3 times of subculture.
In the present invention, the embryoid-induced medium uses MS medium as a minimal medium, and preferably further comprises: 30g/L of sucrose, 1mg/L of kinetin, 6-BA0.5mg/L, timetin mg/L, 5mg/L of hygromycin B and 3g/L of plant gel, wherein the components of the basic culture medium are the same as those of the basic culture medium, and are not described in detail herein; the embryoid-induced conditions preferably include: culturing under light for 10-14 d, more preferably 11-13 d; the illumination culture condition is preferably illumination intensity 3000Lx, temperature is 22 ℃, 16h illumination/8 h darkness.
In the present invention, the embryoid body differentiation medium preferably further comprises, in addition to the minimal medium: sucrose 20g/L, timetin mg/L, hygromycin B5mg/L and plant gel 3g/L, wherein the components of the basic culture medium are the same as those of the basic culture medium, and are not described in detail herein; the conditions for embryoid body differentiation preferably include: culturing under illumination, wherein the culture is carried out once every two weeks for 2-3 times; the condition of the illumination culture is preferably illumination intensity of 3000Lx, temperature of 22 ℃ and 16h illumination/8 h darkness.
In the invention, the rooting culture medium takes MS culture medium as basic culture medium, and preferably further comprises: 10g/L of sucrose and 3g/L of plant gel; the rooting culture conditions preferably comprise: culturing under illumination until 6cm plantlet grows; the condition of the illumination culture is preferably illumination intensity of 3000Lx, temperature of 22 ℃ and 16h illumination/8 h darkness.
After rooting culture to grow 6cm plantlets, the invention preferably also includes greenhouse culture. In the present invention, the method of greenhouse cultivation preferably comprises:
transferring the plants subjected to rooting culture into a first substrate, irrigating with a 1/2MS liquid culture medium, covering a preservative film, performing first culture for 10 days, and transferring into a second substrate for second culture. In the present invention, the matrix-preferably includes vermiculite and perlite; the volume ratio of vermiculite to perlite is preferably 1:1. in the invention, the second substrate preferably comprises nutrient soil and vermiculite; the volume ratio of the nutrient soil to the vermiculite is preferably 1:1. in the present invention, the conditions of the first culture and the second culture preferably include: the illumination intensity is 3000Lx, the temperature is 24-26 ℃ and 16h illumination/8 h darkness.
The invention assists agrobacterium-mediated transformation by vacuum and ultrasonic treatment, combines proper culture medium and culture conditions, further improves the genetic transformation rate of alfalfa, has stable genetic transformation rate, has the advantages of high efficiency and repeatability, and can obtain a large number of regenerated seedlings at one time.
In order to further illustrate the present invention, a genetic transformation method for alfalfa provided by the present invention will be described in detail with reference to examples, but they should not be construed as limiting the scope of the present invention.
Example 1
A genetic transformation method of alfalfa comprises the following steps:
(1) Preparation of sterile explants
Preparation of aseptic seedling leaves: selecting alfalfa (alfalfa No. 1) seeds with full seeds and uniform size, and placing the alfalfa seeds on an ultra-clean workbenchTreating with 75% (V/V) ethanol for 2min, washing with sterile water for 2 times, and adding 0.1wt.% HgCl 2 Sterilizing for 15min, cleaning with sterile water for 8 times, sucking water on the surface of the seeds with sterile filter paper, inoculating to an MS culture medium, carrying out dark spring at 4 ℃ for two days, and transferring the seeds to a tissue culture bottle containing the MS culture medium for culturing for 4 weeks after the seeds are placed in dark at room temperature (22-25 ℃) for two days to obtain sterile seedling leaves; the culture condition is 16h illumination/8 h darkness, the temperature is 22 ℃, the light intensity is 3000Lx, and the humidity is 60%.
The sterile seedling leaves cultivated for 4 weeks are put into sterile water for standby.
(2) Preparation of agrobacterium containing the gene of interest:
the pCAMBIA1307 vector and the target gene fragment (alfalfa MfERF026, accession No. MH130207.1; methods for amplifying the target fragment are described [ Parabain, cloning of wild alfalfa ERF family members MfERF026 and MfERF086 genes and preliminary functional studies; university of inner Mongolia, 2019) ] were digested with BamHI and XbaI, gel recovered, ligated with T4DNA ligase at 16℃for 1h and transformed into E.coli DH 5. Alpha. Competent cells, which were subjected to colony PCR and restriction enzyme verification and sent to sequencing; and (3) introducing the recombinant vector which is sequenced successfully into competent cells of the agrobacterium EHA105, and performing colony PCR and enzyme digestion verification to obtain a positive strain which can be used for subsequent infection experiments. The gel recovery method refers to the instruction book of SanPrep column type DNA gel recovery kit of the Producer, and the method for introducing E.coli and Agrobacterium refers to the instruction book of the French Biotechnology Co., ltd.
Selecting agrobacterium tumefaciens single colony containing target gene (alfalfa MfERF 026) and inoculating the agrobacterium tumefaciens single colony into 4mL of LB liquid medium containing 50mg/Lrif (rifampicin) and 50mg/Lkana (kanamycin), and culturing at 28 ℃ under 200r/min shaking overnight to obtain bacterial liquid; the agrobacterium is EHA105, purchased from the company of the high-feather biotechnology; the EHA105 strain contains a vector pCAMBIA1307.
1mL of the bacterial liquid is absorbed and inoculated into 30mL of LB liquid medium containing 50mg/Lrif (rifampicin) and 50mg/Lkana (kanamycin) and cultured in a shaking way at 28 ℃ for 200r/min until OD 600 When the nm reaches 0.6-0.8, centrifuging at 2400rpm for 15min at room temperature, discarding the supernatant, and collecting thalli for later use;
use liquidSuspension of cells in a cell culture medium to obtain OD 600 nm reaches 0.215, and the prepared infection liquid is ready for use;
the liquid medium contains, in addition to the minimal medium, only: 30g/L of sucrose, 100 mu mol/L of acetosyringone, 2,4-D4mg/L and 6-BA0.5mg/L;
the minimal medium consists of the following components: mgSO (MgSO) 4 ·7H 2 O 185mg/L、KNO 3 2830mg/L、(NH 4 ) 2 SO 4 463mg/L、CaCl 2 ·2H 2 O 166mg/L、KH 2 PO 4 400mg/L、MnSO 4 ·H 2 O 10mg/L、H 3 BO 3 5.0mg/L、ZnSO 4 ·7H 2 O 1.0mg/L、KI 1.0mg/L、Na 2 MoO 4 ·2H 2 O 0.1mg/L、CuSO 4 ·5H 2 O 0.2mg/L、CoCl 2 ·6H 2 O0.1 mg/L, EDTA-FeNa 140mg/L, thiamine hydrochloride 5.0mg/L, pyridoxine hydrochloride 5.0mg/L, nicotinic acid 5.0mg/L and inositol 100mg/L; the pH of the minimal medium was 5.8.
(3) Vacuum infiltration combined ultrasonic assisted agrobacterium infection
Soaking the sterile explant prepared in the step (1) with the dye liquor prepared in the step (2), performing vacuum infiltration in a vacuum dryer, and timing for 10min when the pointer reaches the maximum vacuum degree (0.09 Mpa); then ultrasonic (40 kHz) treatment is carried out for 4min; and then vacuum infiltration is carried out, and when the pointer reaches the maximum vacuum degree (0.09 Mpa), the time is 10min, so that the infected blade is obtained.
(4) Screening of resistant plants
Co-cultivation: sucking the bacterial liquid on the infected leaves in the step (3) by using sterilizing filter paper, and then placing the bacterial liquid into a co-culture medium for dark culture for 26 hours at room temperature (22-25 ℃); the co-culture medium contains, in addition to the minimal medium, only: 30g/L of sucrose, 100 mu mol/L of acetosyringone, 4mg/L of 2,4-D, 0.5mg/L of 6-BA0.5mg/L and 3g/L of plant gel; the composition of the minimal medium is the same as that of the minimal medium in the step (2).
Callus culture: transferring the co-cultured leaves into a selection culture medium, performing dark culture at room temperature (22-25 ℃), and performing subculture once every two weeks for 3 times; the selection medium includes, in addition to the minimal medium: 30g/L of sucrose, 2,4-D4mg/L, 6-BA0.5mg/L, timetin mg/L, 10mg/L of hygromycin B and 3g/L of plant gel; the composition of the minimal medium is the same as that of the minimal medium in the step (2).
Embryoid induction: transferring the callus into embryoid induction medium, and culturing under light for 14d; the illumination culture condition is illumination intensity of 3000Lx, temperature of 22 ℃ and 16h illumination/8 h darkness; the embryoid induction culture takes MS culture medium as basic culture medium, and also only contains: 30g/L of sucrose, 1mg/L of kinetin, 6-BA0.5mg/L, timetin mg/L, 5mg/L of hygromycin B and 3g/L of plant gel, and the pH value is 5.8.
Embryoid differentiation: transferring the embryogenic callus into a differentiation medium, culturing under illumination, and promoting embryoid bud growth, and performing subculture once every two weeks for 2 times; the illumination culture condition is illumination intensity of 3000Lx, temperature of 22 ℃ and 16h illumination/8 h darkness; the differentiation medium contains, in addition to the minimal medium, only: sucrose 20g/L, timetin mg/L, hygromycin B5mg/L and plant gel 3g/L; the composition of the minimal medium is the same as that of the minimal medium in the step (2).
Rooting culture: transferring the embryoid of the differentiated bud into a rooting culture medium, and culturing under illumination until a 6cm plantlet grows; the illumination culture condition is illumination intensity of 3000Lx, temperature of 22 ℃ and 16h illumination/8 h darkness; the rooting culture medium takes an MS culture medium as a basic culture medium and only comprises: sucrose 10g/L and plant gel 3g/L, pH 5.8.
(5) Greenhouse culture
Cleaning the culture medium on the young seedlings in the step (4), transferring the young seedlings into a substrate I (the substrate I is a mixture of vermiculite and perlite, the volume ratio is 1:1), covering the young seedlings with a preservative film, pouring the young seedlings with a 1/2MS liquid culture medium, culturing the young seedlings in an incubator with illumination intensity of 3000Lx and temperature of 24 ℃ and 16h illumination/8 h darkness for 10 days, transferring the young seedlings into soil (a mixture of nutrient soil and vermiculite, the volume ratio is 1:1), and culturing the young seedlings in a greenhouse under the culture conditions of 16h illumination/8 h darkness and the culture temperature of 25 ℃.
Example 2
A genetic transformation method of alfalfa comprises the following steps:
(1) Preparation of sterile explants
Preparation of greenhouse seedling leaves: selecting alfalfa (alfalfa No. 1) seeds with full seeds and uniform sizes, soaking the alfalfa seeds in 98% concentrated sulfuric acid for 5min, cleaning the alfalfa seeds with sterile water for 8 times, placing the alfalfa seeds in a culture dish paved with 2 layers of wet filter paper, and culturing the alfalfa seeds in soil (the nutrient soil and vermiculite are uniformly mixed according to the volume ratio of 1:1) for 5 weeks after the alfalfa seeds germinate, wherein the culture condition is 16h illumination/8 h darkness and the culture temperature is 25 ℃.
The leaves of greenhouse seedlings cultivated for 5 weeks are rinsed twice by shaking in sterile water, then sterilized for 10min by using a bleaching agent and one drop of tween20, and finally rinsed for 3 times by using sterile water for standby.
(2) Preparation of agrobacterium containing the gene of interest:
the pCAMBIA1307 vector and the target gene fragment (alfalfa MfERF086, accession No. MH796792; methods for amplifying the target fragment are described [ Parabain, cloning of wild alfalfa ERF family members MfERF026 and MfERF086 genes and preliminary functional studies, university of inner Mongolia, 2019 ]) were digested with BamHI and XbaI, after gel recovery, ligated with T4DNA ligase at 16℃for 1h and transformed into E.coli DH 5. Alpha. Competent cells, which were subjected to colony PCR and restriction enzyme verification and then sent to sequencing; and (3) introducing the recombinant vector which is sequenced successfully into competent cells of the agrobacterium EHA105, and performing colony PCR and enzyme digestion verification to obtain a positive strain which can be used for subsequent infection experiments. The gel recovery method refers to the instruction book of SanPrep column type DNA gel recovery kit of the Producer, and the method for introducing E.coli and Agrobacterium refers to the instruction book of the French Biotechnology Co., ltd.
Selecting agrobacterium tumefaciens single colony containing target gene (alfalfa MfERF 086) and inoculating the agrobacterium tumefaciens single colony into 4mL of LB liquid medium containing 50mg/Lrif (rifampicin) and 50mg/Lkana (kanamycin), and culturing at 28 ℃ under 200r/min shaking overnight to obtain bacterial liquid; the agrobacterium is EHA105, purchased from the company of the high-feather biotechnology; the EHA105 strain contains a vector pCAMBIA1307.
1mL of the bacterial liquid is absorbed and inoculated into 30mL of LB liquid medium containing 50mg/Lrif (rifampicin) and 50mg/L kanamycin, and the bacterial liquid is cultured in a shaking way at 28 ℃ for 200r/min until OD 600 nm up toCentrifuging at 2400rpm for 15min at room temperature at 0.6-0.8, discarding the supernatant, and collecting thalli for later use;
suspending the cells in a liquid medium to adjust the OD 600 nm reaches 0.3, and the prepared infection liquid is ready for use;
the liquid medium contains, in addition to the minimal medium, only: 30g/L of sucrose, 100 mu mol/L of acetosyringone, 2,4-D4mg/L and 6-BA0.5mg/L;
the minimal medium consists of the following components: mgSO (MgSO) 4 ·7H 2 O 185mg/L、KNO 3 2830mg/L、(NH 4 ) 2 SO 4 463mg/L、CaCl 2 ·2H 2 O 166mg/L、KH 2 PO 4 400mg/L、MnSO 4 ·H 2 O 10mg/L、H 3 BO 3 5.0mg/L、ZnSO 4 ·7H 2 O 1.0mg/L、KI 1.0mg/L、Na 2 MoO 4 ·2H 2 O 0.1mg/L、CuSO 4 ·5H 2 O 0.2mg/L、CoCl 2 ·6H 2 O0.1 mg/L, EDTA-FeNa 140mg/L, thiamine hydrochloride 5.0mg/L, pyridoxine hydrochloride 5.0mg/L, nicotinic acid 5.0mg/L and inositol 100mg/L; the pH of the minimal medium was 5.9.
(3) Vacuum infiltration combined ultrasonic assisted agrobacterium infection
Soaking the sterile explant prepared in the step (1) with the dye liquor prepared in the step (2), performing vacuum infiltration in a vacuum dryer, and timing for 10min when the pointer reaches the maximum vacuum degree (0.085 Mpa); then ultrasonic (40 kHz) treatment is carried out for 5min; and then vacuum infiltration is carried out, and when the pointer reaches the maximum vacuum degree (0.085 Mpa), the time is 10min, so that the infected blade is obtained.
(4) Screening of resistant plants
Co-cultivation: sucking the bacterial liquid on the infected leaves in the step (3) by using sterilizing filter paper, and then placing the bacterial liquid into a co-culture medium for dark culture for 25 hours at room temperature (22-25 ℃); the co-culture medium contains, in addition to the minimal medium, only: 30g/L of sucrose, 100 mu mol/L of acetosyringone, 4mg/L of 2,4-D, 0.5mg/L of 6-BA0.5mg/L and 3g/L of plant gel; the composition of the minimal medium is the same as that of the minimal medium in the step (2).
Callus culture: transferring the co-cultured leaves into a selection culture medium, performing dark culture at room temperature (22-25 ℃), and performing subculture once every two weeks for 3 times; the selection medium includes, in addition to the minimal medium: 30g/L of sucrose, 2,4-D4mg/L, 6-BA0.5mg/L, timetin mg/L, 10mg/L of hygromycin B and 3g/L of plant gel; the composition of the minimal medium is the same as that of the minimal medium in the step (2).
Embryoid induction: transferring the callus into embryoid induction medium, and culturing under light for 13d; the illumination culture condition is illumination intensity of 3000Lx, temperature of 22 ℃ and 16h illumination/8 h darkness; the embryoid-induced culture is divided by MS culture medium to be basic culture medium, and only contains: 30g/L of sucrose, 1mg/L of kinetin, 6-BA0.5mg/L, timetin mg/L, 5mg/L of hygromycin B and 3g/L of plant gel, and the pH value is 5.8.
Embryoid differentiation: transferring the embryogenic callus into a differentiation medium, culturing under illumination, and promoting embryoid bud growth, and performing subculture once every two weeks for 2 times; the illumination culture condition is illumination intensity of 3000Lx, temperature of 22 ℃ and 16h illumination/8 h darkness; the differentiation medium contains, in addition to the minimal medium, only: sucrose 20g/L, timetin mg/L, hygromycin B5mg/L and plant gel 3g/L; the composition of the minimal medium is the same as that of the minimal medium in the step (2).
Rooting culture: transferring the embryoid of the differentiated bud into a rooting culture medium, and culturing under illumination until a 6cm plantlet grows; the illumination culture condition is illumination intensity of 3000Lx, temperature of 22 ℃ and 16h illumination/8 h darkness; the rooting culture medium takes an MS culture medium as a basic culture medium and only comprises: 10g/L sucrose and 3g/L vegetable gel.
(5) Greenhouse culture
Cleaning the culture medium on the young seedlings in the step (4), transferring the young seedlings into a substrate I (the substrate I is a mixture of vermiculite and perlite, the volume ratio is 1:1), covering the young seedlings with a preservative film, pouring the young seedlings with a 1/2MS liquid culture medium, culturing the young seedlings in an incubator with illumination intensity of 3000Lx and temperature of 24-26 ℃ and 16h illumination/8 h darkness for 10 days, transferring the young seedlings into soil (a mixture of nutrient soil and vermiculite, the volume ratio is 1:1), culturing the young seedlings in a greenhouse under the culture condition of 16h illumination/8 h darkness, and culturing the young seedlings at the temperature of 25 ℃.
Example 3
A genetic transformation method similar to that of example 1, except that the seed in step (1) was alfalfa (hulenbel).
Comparative example 1
A genetic transformation method similar to that of example 1, except that step (3) was not subjected to ultrasonic treatment.
Comparative example 2
A genetic transformation method similar to that of example 1, except that step (3) was not subjected to vacuum infiltration.
Comparative example 3
A genetic transformation method similar to that of example 3, except that step (3) was not subjected to ultrasonic treatment.
Comparative example 4
A genetic transformation method similar to that of example 3, except that step (3) was not subjected to vacuum infiltration.
The genetic transformation rates of examples 1-3 and comparative examples 1-4 were tested by PCR method, wherein the genetic transformation rate = 100% positive plants/explants, and the specific test method is as follows:
1. the CTAB method is adopted to extract the DNA of the regenerated seedling leaves:
(1) weighing 100mg of leaves, putting into a 1.5ml Eppendorf centrifuge tube, adding liquid nitrogen into a mortar, rapidly grinding the leaves into fine powder, adding 600 mu L of CTAB (beta-mercaptoethanol) -containing extraction buffer preheated at 65 ℃, fully and uniformly mixing, preserving heat for 1.5h in a water bath at 65 ℃, and gently mixing every 15min or 30 min.
(2) After cooling, an equal volume of chloroform to isoamyl alcohol (24:1) was added, mixed slowly and repeatedly upside down for 5min, after phase change of chloroform, left to stand for 10min, and centrifuged at 12000rpm for 10min.
(3) Transferring the supernatant to a new Eppendorf tube, adding equal volume of precooled isopropanol, gently reversing and mixing to obtain flocculent precipitate, and standing in a refrigerator at-20deg.C for 10min.
(4) Centrifuge at 12000rpm for 10min, discard supernatant, add 500ul70% ethanol to wash the precipitate, centrifuge at 12000rpm for 5min, total 2 times.
(5) The precipitate is kept and the ethanol is dried in an ultra clean bench.
(6) After drying, it was dissolved in 30. Mu.LddH 2 In O buffer.
2. Transgene validation, the reaction system is: 10 x Buffer 2.5. Mu. L, dNTP 2. Mu. L, PF (5 uM) 2. Mu. L, PR (5 uM) 2. Mu.L, rTaq 0.125. Mu.L, template (DNA) 2. Mu.L, and ddH 2 O 14.375μL。
The reaction process is as follows: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s, annealing at 57.4℃for 30s, extension at 72℃for 30s, and cycling for 30 times; 72 ℃ for 10min; preserving at 4 ℃.
When the target gene is MfERF026, the nucleotide sequence of PF in the reaction system is shown in SEQ ID NO. 1: CGGGATCCATGAATAGTAGTACTATTGAAC, PR has the nucleotide sequence shown in SEQ ID NO. 2: GCTCTAGACTAGCTATAGTTATTATAAATG;
when the target gene is MfERF086, the nucleotide sequence of PF in the reaction system is shown in SEQ ID NO. 3: CGAGCTCATGGAGGATCACCAGAAGGG, PR has the nucleotide sequence shown in SEQ ID NO. 4: GCTCTAGATTACTTTTTCTTTTTCACCTCCTCT.
The detection results are shown in Table 1.
TABLE 1 genetic transformation rates for the different methods
| Group of | Number of explants | Positive plant number (plant) | Genetic transformation rate |
| Example 1 | 203 | 29 | 14.3％ |
| Example 2 | 227 | 19 | 8.4％ |
| Example 3 | 225 | 16 | 7.1％ |
| Comparative example 1 | 231 | 9 | 3.9％ |
| Comparative example 2 | 202 | 11 | 5.4％ |
| Comparative example 3 | 197 | 7 | 3.6％ |
| Comparative example 4 | 185 | 9 | 4.9％ |
As can be seen from Table 1, the genetic transformation rate obtained by the method provided by the invention is 7.1% -14.3%. Compared with other methods, the genetic transformation rate is stable, the efficiency is high, a large number of regenerated seedlings can be obtained at one time, and the broad spectrum is achieved.
In conclusion, the method provided by the invention obviously improves the genetic transformation rate of alfalfa, has the advantages of stable genetic transformation rate, high efficiency and repeatability, and can obtain a large number of regenerated seedlings at one time.
While the invention has been described in terms of preferred embodiments, it is not intended to be limited thereto, but rather to enable any person skilled in the art to make various changes and modifications without departing from the spirit and scope of the present invention, which is therefore to be limited only by the appended claims.
Sequence listing
<110> university of inner Mongolia
<120> a genetic transformation method of alfalfa
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 30
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
cgggatccat gaatagtagt actattgaac 30
<210> 2
<211> 30
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
gctctagact agctatagtt attataaatg 30
<210> 3
<211> 27
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
cgagctcatg gaggatcacc agaaggg 27
<210> 4
<211> 33
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
gctctagatt actttttctt tttcacctcc tct 33
Claims (10)
1. A genetic transformation method of alfalfa, comprising the steps of:
mixing the dyeing solution containing the target gene with the explant to be transformed, and treating for 10min under the vacuum degree of 0.085-0.09 Mpa to obtain a first mixed solution;
carrying out ultrasonic treatment on the first mixed solution for 4-5 min to obtain a second mixed solution; the frequency of the ultrasonic treatment is 40kHz;
and (3) treating the second mixed solution for 10min under the vacuum degree of 0.085-0.09 Mpa to obtain the infected explant.
2. The genetic transformation method according to claim 1, wherein the invading fluid comprises a liquid medium and a recipient bacterium comprising the gene of interest;
the liquid culture medium comprises the following components in addition to the basic culture medium: 30g/L of sucrose, 100 mu mol/L of acetosyringone, 2,4-D4mg/L and 0.5mg/L of 6-BA;
the minimal medium comprises the following components: mgSO (MgSO) 4 ·7H 2 O 185mg/L、KNO 3 2830 mg/L、(NH 4 ) 2 SO 4 463 mg/L、CaCl 2 ·2H 2 O 166mg/L、KH 2 PO 4 400 mg/L、MnSO 4 ·H 2 O 10mg/L、H 3 BO 3 5.0 mg/L、ZnSO 4 ·7H 2 O 1.0mg/L、KI 1.0mg/L、Na 2 MoO 4 ·2H 2 O 0.1mg/L、CuSO 4 ·5H 2 O 0.2mg/L、CoCl 2 ·6H 2 O0.1 mg/L, EDTA-FeNa 140mg/L, thiamine hydrochloride 5.0mg/L, pyridoxine hydrochloride 5.0mg/L, nicotinic acid 5.0mg/L and inositol 100mg/L; the pH of the basic culture medium is 5.8-6.0.
3. The genetic transformation method according to claim 1 or 2, wherein after obtaining the infected explant, further comprising: sequentially performing co-culture, callus culture, embryoid induction, embryoid differentiation and rooting culture on the infected explants to obtain transformed plants;
the co-culture medium comprises, in addition to the minimal medium: 30g/L of sucrose, 100 mu mol/L of acetosyringone, 4mg/L of 2,4-D, 0.5mg/L of 6-BA and 3g/L of plant gel;
the minimal medium comprises the following components: mgSO (MgSO) 4 ·7H 2 O 185mg/L、KNO 3 2830 mg/L、(NH 4 ) 2 SO 4 463 mg/L、CaCl 2 ·2H 2 O 166mg/L、KH 2 PO 4 400 mg/L、MnSO 4 ·H 2 O 10mg/L、H 3 BO 3 5.0 mg/L、ZnSO 4 ·7H 2 O 1.0mg/L、KI 1.0mg/L、Na 2 MoO 4 ·2H 2 O 0.1mg/L、CuSO 4 ·5H 2 O 0.2mg/L、CoCl 2 ·6H 2 O0.1 mg/L, EDTA-FeNa 140mg/L, thiamine hydrochloride 5.0mg/L, pyridoxine hydrochloride 5.0mg/L, nicotinic acid 5.0mg/L and inositol 100mg/L; the pH of the basic culture medium is 5.8-6.0.
4. The genetic transformation method according to claim 3, wherein the culture medium for callus culture comprises, in addition to the minimal medium: 30g/L of sucrose, 2,4-D4mg/L, 6-BA0.5mg/L, timetin mg/L, 10mg/L of hygromycin B and 3g/L of plant gel.
5. The genetic transformation method according to claim 3, wherein the embryoid-induced medium is a minimal medium comprising MS medium, further comprising: 30g/L of sucrose, 1mg/L of kinetin, 6-BA0.5mg/L, timetin mg/L, 5mg/L of hygromycin B and 3g/L of plant gel, and the PH is 5.8-6.0.
6. The genetic transformation method according to claim 3, wherein the embryoid body differentiation medium comprises, in addition to the minimal medium: sucrose 20g/L, timetin mg/L, hygromycin B5mg/L and plant gel 3g/L, pH5.8-6.0.
7. The genetic transformation method according to claim 3, wherein the rooting medium is a minimal medium comprising MS medium, further comprising: 10g/L of sucrose and 3g/L of plant gel, and the PH is 5.8-6.0.
8. The genetic transformation method according to claim 3, wherein the culture conditions of embryoid induction, embryoid differentiation and rooting culture comprise: the illumination intensity was 3000Lx, the temperature was 22℃and 16h of illumination/8 h of darkness.
9. The genetic transformation method according to claim 3, wherein the rooting culture further comprises a greenhouse culture; the greenhouse culture method comprises the following steps:
transferring the plants subjected to rooting culture into a first substrate, irrigating with a 1/2MS liquid culture medium, covering with a preservative film, performing first culture for 10 days, and transferring into a second substrate for second culture;
the first substrate comprises vermiculite and perlite; the volume ratio of the vermiculite to the perlite is 1:1, a step of;
the second substrate comprises nutrient soil and vermiculite; the volume ratio of the nutrient soil to the vermiculite is 1:1, a step of;
the conditions of the first culture and the second culture respectively include: the illumination intensity is 3000Lx, the temperature is 22-26 ℃ and 16h illumination/8 h darkness.
10. The genetic transformation method according to claim 1, wherein the explant to be transformed comprises: seedling leaves are cultivated for 4 to 6 weeks.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210284506.4A CN114561426B (en) | 2022-03-22 | 2022-03-22 | Genetic transformation method of alfalfa |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210284506.4A CN114561426B (en) | 2022-03-22 | 2022-03-22 | Genetic transformation method of alfalfa |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114561426A CN114561426A (en) | 2022-05-31 |
| CN114561426B true CN114561426B (en) | 2023-05-05 |
Family
ID=81719845
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210284506.4A Active CN114561426B (en) | 2022-03-22 | 2022-03-22 | Genetic transformation method of alfalfa |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114561426B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116640201B (en) * | 2023-07-21 | 2023-10-24 | 内蒙古大学 | Application of regulating and controlling MfERF026 gene in alfalfa growth and development and stress tolerance |
| CN116640200B (en) * | 2023-07-21 | 2023-10-24 | 内蒙古大学 | Application of MfERF086 gene in alfalfa growth and development and/or cold resistance regulation |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101063149B (en) * | 2007-04-25 | 2011-05-25 | 东北师范大学 | Agriculture bacillus mediated alfalfa genetic conversion method |
| CN101457235B (en) * | 2008-08-05 | 2011-04-27 | 山东省林业科学研究院 | Method for converting lucerne by vacuum penetrating aided agrobacterium-mediation |
-
2022
- 2022-03-22 CN CN202210284506.4A patent/CN114561426B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN114561426A (en) | 2022-05-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN114561426B (en) | Genetic transformation method of alfalfa | |
| AU670316B2 (en) | An improved method of (agrobacterium)-mediated transformation of cultured soybean cells | |
| JPH10117776A (en) | Transformation of indica rice | |
| CN111893133A (en) | Agrobacterium-mediated cabbage heart genetic transformation method | |
| CN104770294B (en) | A kind of protocorm based on the sprouting of iris seed is the breeding method of acceptor | |
| CN117004649B (en) | Agrobacterium-mediated broom corn millet efficient genetic transformation method | |
| CN110819639A (en) | Tobacco low-temperature early-flowering related gene NtDUF599 and application thereof | |
| CN112553248B (en) | Establishment method and genetic transformation method of Miscanthus stramineus genetic transformation system | |
| CN107475287B (en) | Eggplant genetic transformation method | |
| CN114921490B (en) | Genetic transformation method for agrobacterium-mediated white clover callus | |
| CN114836464B (en) | Agrobacterium tumefaciens-mediated Chinese wildrye genetic transformation method | |
| CN116732047A (en) | Application of gene OsMADS5in regulation and control of plant root elongation | |
| Das et al. | Agrobacterium-mediated genetic transformation in lentil (Lens culinaris Medik.) followed by in vitro flowering and seed formation | |
| CN102559676B (en) | Rice root specific promoter and application thereof | |
| CN110951776B (en) | Agrobacterium-mediated pepper genetic transformation method | |
| WO2013010368A1 (en) | Use of rice aerenchyma formation key gene oslsd2 | |
| KR100736209B1 (en) | Method for improving the introduction of the target gene into plant cell | |
| CN116640201B (en) | Application of regulating and controlling MfERF026 gene in alfalfa growth and development and stress tolerance | |
| CN112553217B (en) | Application of GmVIT1 gene of soybean and recombinant vector containing GmVIT1 gene | |
| CN103320468B (en) | UCH320 protein and application of coding gene thereof in adjusting and controlling plant growth and development | |
| CN116179573B (en) | Application of carrot gibberellin oxidase gene DcGA2ox1 in regulation of plant growth and development | |
| CN114836463B (en) | Efficient genetic transformation method for broccoli by taking fleshy pedicel as explant | |
| CN116769799B (en) | Soybean mutant gene for improving yield of leguminous crops and application thereof | |
| CN115948421B (en) | Wheat alkali-resistant auxin response protein gene TaSAUR and application thereof | |
| CN116640200B (en) | Application of MfERF086 gene in alfalfa growth and development and/or cold resistance regulation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |