CN109897865B - Method for increasing iron content in plant tissue - Google Patents

Abstract

The invention discloses a method for improving iron content in plant tissues, which comprises the following steps of over-expressing SEQ ID NO: 1, to obtain a transgenic plant with increased iron content compared with normal plants. The invention provides a method for improving the content of trace elements (iron) in plant tissues based on specific genes, which makes a pioneering and outstanding technical progress in the technical field, can obviously improve the iron content of soybean grains, and has important practical significance for the biological enhancement of soybeans, the improvement of the nutritional quality of the soybeans and the like.

Description

Method for increasing iron content in plant tissue

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a gene related to iron content in plant tissues and application thereof.

Background

Micronutrients play an extremely important role in the human body, and their deficiency and excess are associated with human health relatives. Worldwide, it is expected that children under the age of 1.61 million 5 years develop dysplasia, partly due to hidden hunger caused by a deficiency in vitamins and minerals consumed by food (branch et al, 2016). In nigeria, 75% of preschool children and 67% of pregnant women suffer from anemia (Geneva et al, 2008). Iron deficiency anemia affects the human immune system, impeding growth and impairing cognitive development in children (Black et al, 2008). Thus, the bio-fortification of major food crops by biotechnology is one of the strategies to ameliorate essential micronutrient deficiencies (Hefferon et al, 2015). In order to meet the normal needs of the human body for iron elements, supplementing iron elements with food is a safe and economical way.

Soybean is an important crop of grain and oil in the world and also a main source of high-quality protein for human beings. An important approach to iron bioaugmentation to increase the iron content of soybeans, despite previous cloning and demonstration in soybeansGmDMT1、GmZIP1Isogenes are involved in regulating and controlling iron transport in soybeans (Moreau et al, 2002; Kaiser et al, 2003), but elements or functional genes related to iron transport in soybeans still need to be vigorously excavated, so that theoretical support is provided for more fully utilizing the 'green' iron nutrition supply mode in production.

At present, no relation is foundYSL7Report on whether the soybean iron element has a regulation effect in absorption and transportation.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provide a method for improving the iron content in plant tissues.

In order to solve the technical problems, the technical scheme adopted by the invention is as follows.

A method for increasing the iron content in plant tissues, which comprises the step of over-expressing SEQ ID NO: 1, to obtain a transgenic plant with increased iron content compared with normal plants.

In a preferred embodiment of the present invention, the plant is a plant of the Papilionaceae family, and the plant tissue is an edible part of the plant.

As a preferred technical scheme of the invention, the plant is soybean, and the plant tissue is soybean grains.

As a preferred technical scheme of the invention, firstly, a peptide containing SEQ ID NO: 1, then constructing a transformant by using the recombinant expression vector, infecting a target plant by using the transformant, and screening a positive plant to obtain a transgenic plant with increased iron content compared with a normal plant.

As a preferred technical scheme of the invention, the recombinant overexpression vector takes a PTF101 vector as a skeleton vector and is connected with a 35S strong promoter.

As a preferred technical scheme of the invention, the recombinant expression vector is used for transforming agrobacterium EHA101 to prepare a transformant.

As a preferred technical scheme of the invention, the agrobacterium EHA101 mediated soybean stable transformation method is utilized to transform the receptor plant.

The invention also comprises an amplification primer pair of the gene, wherein the forward primer of the amplification primer pair is shown as SEQ ID NO: 2 is shown in the specification; the reverse primer is shown as SEQ ID NO: 3, respectively.

The invention also includes a recombinant expression vector and a transformant containing the gene.

The invention also comprises the transgenic plant prepared by the method.

Adopt the produced beneficial effect of above-mentioned technical scheme to lie in:

the invention provides a method for improving the content of trace elements (iron) in plant tissues based on specific genes for the first time, and pioneering and outstanding technical progress is made in the technical field.

Based on the scientific findings and verified by plant genetic engineering tests, the transgenic plant obtained by transforming the receptor soybean plant with the overexpression vector constructed by the invention can obviously improve the iron content of soybean grains, and has important practical significance for the biological enhancement of soybeans, the improvement of the nutritional quality of soybeans and the like.

Drawings

FIG. 1 is an overexpressionGmYSL7Then the iron content of the soybean seeds is analyzed, and the expression is up-regulated under the identical experimental environmentGmYSL7The iron content of the transgenic seeds was significantly increased compared to the empty vector transformed (EV) (FIG. 1A), FIG. 1B shows the increase in iron content in transgenic leavesGmYSL7Analysis of expression level of (3), results show in stable transgenic leavesGmYSL7Is significantly upregulated.

FIG. 2 is a photograph of transgenic plants and control plants.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from conventional biochemicals, unless otherwise specified. In the following examples,% is by mass unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.

Example 1 extraction of total DNA from root tissue of Glycine max Wilimas 82.

(1) Taking 0.1-0.2 g of plant tissues, putting the plant tissues into a 2 ml EP tube, adding steel balls, quickly freezing by using liquid nitrogen, and grinding the plant tissues into powder by using a sample making machine;

(2) adding 650 μ l CTAB, standing at 65 deg.C for 20 min;

(3) adding 0.5 volume of chloroform, mixing violently, and centrifuging at 12000 rpm for 10 min;

(4) taking the supernatant, putting the supernatant into a new 1.5 ml EP tube, adding absolute ethyl alcohol with the volume twice that of the supernatant, placing the mixture at the temperature of minus 20 ℃ for more than half an hour, and centrifuging the mixture at 12000 rpm for 10 min;

(5) removing supernatant, centrifuging, drying, dissolving in 40-100 μ l water, and storing at 4 deg.C in refrigerator. The reaction-synthesized DNA can be used as a template for a PCR reaction.

Example 2 construction of recombinant expression vectors.

（1）GmYSL7Cloning of the gene fragment.

According toGmYSL7Of (a) a coding sequence(SEQ ID NO: 1) design primer pairs for construction of over-expression vectors, and the ends of the primers were introduced into the vector PTF101 according to the multiple cloning sitesSmaI andBamHi, enzyme digestion recognition site; PCR amplification with DNA of soybean sequenced variety W82 as templateGmYSL7A 4886 bp long gene fragment (SEQ ID NO: 1); the primer sequence is as follows:

a forward primer: CCCCCGGG ATGGGTACTTCAGAAAGGATCGACTTGGAGC (SEQ ID NO: 2);

reverse primer: CGGGATCC TCAAGATTCTAAGAATCCATCCACCTTTGTATTTACCC (SEQ ID NO: 3);

the amplification procedure was: 5 min at 95 ℃; 30 sec at 95 ℃, 30 sec at 56 ℃, 5 min at 68 ℃ and 35 cycles; 5 min at 68 ℃;

carrying out 1% agarose gel electrophoresis on the PCR amplification product, and recovering and purifying a band of about 4886 bp by adopting a Shanghai crude rubber recovery kit;

the recovered DNA fragment was ligated with Blant3-T vector (Takara Co.), 1. mu.l of T vector was added to 5. mu.l of the system, 4. mu.l of the fragment was recovered, the mixture was mixed well, ligated overnight at 16 ℃ and transformed into E.coli competent cells by heat shock method, cultured overnight, cloned positively and submitted to Shanghai bioscience sequencing.

(2) And (3) constructing a recombinant expression vector.

a. Extraction of DNA containing correct sequencingGmYSL7 4886 bp gene sequence T vector plasmid, its preparation method and useSmaI andBamHi, obtaining a nucleotide sequence by enzyme digestion;

b. by usingSmaI andBamHi, carrying out enzyme digestion on PTF101 plasmid to obtain a linear PTF101 nucleotide sequence;

c. will be provided withGmYSL7Firstly cloning a nucleotide sequence fragment into a PTF101 vector;

d. transforming the ligation product obtained in the step 3 into a competent escherichia coli DH5 alpha strain through heat shock, culturing overnight at 37 ℃, and selecting a positive clone for sequencing; the sequencing result shows that the recombinant plasmid is obtainedGmYSL7-PTF101。

Example 3 agrobacterium EHA101 mediated stable transformation of soybean.

(1) The agrobacterium transformation adopts a liquid nitrogen freezing and dissolving method to transform agrobacterium, and the specific operation is as follows:

a. taking out 200 μ l of frozen competent cells, thawing, adding 5-10 μ l of plasmid DNA, flicking the tube wall, mixing, and standing on ice for 20-30 min;

b. placing in liquid nitrogen for 5 min, taking out, melting tube at 37 deg.C (5 min), adding 800 μ l LB (non-resistance) liquid culture medium, and oscillating at 28 deg.C at low speed (150 r/min) for 4-5 hr;

c. 4000 r/min, 30 sec, removing supernatant, adding 100 mul LB liquid culture medium, suspending thallus and plating to contain 50 mg/ml kanamycin);

d. culturing at 28 deg.C until white transformant grows out, and using for hairy root transformation.

(2) And (4) stably transforming the soybeans.

Taking soybean variety W82 as a material, taking the seed material, disinfecting the seed material for 10 h by using chlorine, placing the seed material in sterilized water, and carrying out dark culture at 26 ℃ for 16 h:

a. preparing bacterial liquid: preserving bacteria of the agrobacterium liquid which is subjected to primary culture and subculture until the OD600 is 0.8-1, scratching a flat plate for 3 days before, picking bacterial plaques on the flat plate in the afternoon of the previous day, diluting the bacterial plaques with 40% glycerol, coating the flat plate, collecting the grown bacterial lawn in the next morning, and diluting the bacterial lawn with liquid CCM (EM) until the OD = 0.7-0.8;

b. preparing an explant: the beans were germinated on GM while plating. The next morning the plates grew well and the soybeans germinated for about 16 hours. Pouring a small amount of bacterial liquid on a flat plate, cutting off the germinated soybean epicotyl by using a No. 15 surgical blade, separating two cotyledons along the right middle of the two cotyledons, and starting inoculation when each cotyledon is attached with a growth point (each explant is formed by connecting one cotyledon with one hypocotyl, namely one seed can form two explants) as far as possible;

c. inoculating an explant: placing 30-40 pieces of cut explants in a triangular flask, adding 50 ml of agrobacterium liquid resuspended in co-culture liquid to ensure that the explants are fully coated and infiltrated by the liquid, placing the explants on a horizontal shaking table at the rotating speed of 80-100rpm, replacing the resuspended liquid at about 5 pm, and placing the explants in a dark culture at 26 ℃ for overnight;

d. co-culturing: and (3) paving a layer of filter paper subjected to high-pressure sterilization on the co-culture medium in the morning on the third day, dipping the impregnated explant on the sterilized filter paper to dry redundant bacteria liquid, and drying the surface in a super clean bench. Then, the plates were spread paraxially downward on filter paper, 16-18/dish, and incubated in the dark at 26 ℃ for 5 days.

e. Inducing cluster buds: after co-cultivation, the culture medium is inoculated to a culture medium for inducing cluster buds. After 14 days of culture at 26 ℃ under 18h Light/6h Dark illumination, the clumpy buds were excised and the explants were subcultured on SI medium for 2 weeks;

f. elongation of the cluster buds: during the final period of induction of the multiple shoots, the meristems that have formed are removed, a new incision is made at the base of the growing point (horizontally oriented), and the cultured tissue is transferred to an elongation medium. Cultures were transferred to fresh medium every two weeks. A new horizontal incision is made at the base of the implant for each transfer. After 6-8 weeks of culture, the elongated shoots should have clear differentiation. This period can be extended to 12 weeks;

g. rooting: the elongated shoots (typically scissoring shoots >4cm long) were dipped with IBA (1 mg/mL) for 1-2min and transferred to rooting medium for rooting. Culturing for about 2-4 weeks, and transplanting when sufficient root system grows;

h. transplanting: the rooted plantlets were carefully transferred into small flowerpots, and culture soil (import soil: nutrient soil = 1: 1) was put into the flowerpots. After transplanting, the seedlings need to be covered with a freshness protection package for one week, so that the seedlings are used to the new environment of soil and keep humidity, the temperature in a culture room is 26 ℃, and the freshness protection package is taken down after one week.

Example 4 identification of overexpressing transgenic plants.

(1) Obtaining materials: the material used in the experiment was stably transformed T0 generation leaf (0.1 g cut and stored in liquid nitrogen for the time being).

(2) Isolation of mRNA: extracting soybean total RNA by using a Trizol method, namely putting tissues into grinding, grinding the tissues for 3 times by using liquid nitrogen, adding 0.1-0.2 g of the ground tissues into a1 mL centrifuge tube, then adding 1 mL TRI pure reagent, fully shaking to obtain a cracking product which is clear transparent viscous liquid, and standing for 5 min at room temperature; ② adding 200 mu L chloroform, shaking and mixing evenly, standing for 5 min at room temperature, 4 ℃, 12000 r/min, centrifuging for 15 min; thirdly, transferring the supernatant into another centrifugal tube, adding isopropanol with the same volume, uniformly mixing by oscillation, precipitating at-20 ℃ for 30 min, at 4 ℃ at 12000 r/min, and centrifuging for 10 min; fourthly, the supernatant is discarded, the supernatant is washed by 75 percent ethanol (prepared by DEPC treated sterile water), the temperature is 4 ℃, 12000 r/min, the centrifugation is carried out for 10 min, the centrifugation is repeated twice, the air drying is carried out for about 10 min at room temperature, and about 20 mu l of DEPC treated RNase Free water (DEPC water) is added for dissolving and precipitating.

(3) Reverse transcription into cDNA: the extracted mRNA was reverse transcribed into cDNA using TaKaRa reverse transcription kit.

(4) Real-time fluorescent quantitative PCR analysis: the specific experimental method adopted by the SuperReal PreMix Plus (SYBR Green) kit from TIANGEN company is as follows: mu.l of the cDNA template obtained in the above step, 0.2. mu.l of each forward and reverse primer, 5. mu.l of 2 XSuperReal PreMix Plus, ddH were added to a 10. mu.l system₂O4.4. mu.l; the amplification procedure was: 95 ℃ for 15 min; 95 ℃ for 10 sec; 60 ℃, 34 sec, 40 cycles; 65 ℃, 5 sec, 95 ℃, 5 sec; wherein,

the forward primer is: GTGGTGTCATTGCTGGTTTG (SEQ ID NO: 4);

the reverse primer is: CTAGGTTGCCAAAAGCCTTG (SEQ ID NO: 5).

Example 5 measurement of iron content of grain of overexpression transgenic plant.

5g of grains with different lines of stable transgenosis are sent to Zhongzhicongong department for iron content determination, and the main instrument is an atomic absorption spectrometer.

The results are shown in FIG. 1, which shows that under the same experimental environment, the expression is up-regulatedGmYSL7The iron content of the transgenic seeds was significantly increased compared to the empty vector transformed (EV) (FIG. 1A), FIG. 1B shows the increase in iron content in transgenic leavesGmYSL7Analysis of expression level of (3), results show in stable transgenic leavesGmYSL7Is significantly upregulated.

Example 6, discussion analysis.

YSL is a protein that transports oligopeptides and iron plasma, and is widely present in plants. There are 8 YSL proteins in the model plant Arabidopsis thaliana, and the expression patterns for these proteinsAnd function in iron transport is reported. Such as YSL and YSL3, are expressed in the veins of leaves and parenchyma around the veins in roots and leaves, and the expression is significantly enhanced in old leaves compared to young leaves; in roots, they are expressed predominantly in vascular tissue. While their expression patterns in floral tissues are different, YSLl is mainly expressed in the anthers and pollen of immature anthers and mature stamens, while YSL3 is expressed only in the anthers and pollen of mature stamens (Waters et a1., 2006).YSLlAndYSL3none of the single mutants had a distinct phenotype, butysl1The iron and NA content of the seeds of the single mutant was reduced (Le et a1., 2005).ysl1ysl3The double mutant showed significant interpulse yellowing, as well as reduced iron content in roots and leaves, seeds, and reduced fertility, pollens being non-viable, abnormal seed development, reduced germination rate, etc., whereas exogenous application of iron could partially complement these phenotypes (Waters et a1, 2006).ysl1ysl3The reduction of the reactivation efficiency of Fe, Mn, Zn and Cu in the old leaves of the double mutant indicates that YSLI and YSL3 play an important role in redistribution of ions in plants, reactivation of iron in the old leaves and transportation of iron to inflorescences and seeds.

The invention provides a method for improving the content of trace elements (iron) in plant tissues based on a specific YSLI7 gene for the first time, and pioneering and outstanding technical progress is made in the technical field. The overexpression vector constructed by the invention is used for transforming a receptor soybean plant to obtain a transgenic plant, the iron content of soybean grains can be obviously improved, and the overexpression vector has important practical significance for the biological enhancement of soybeans, the improvement of the nutritional quality of soybeans and the like.

The above description is only presented as an enabling solution for the present invention and should not be taken as a sole limitation on the solution itself.

Sequence listing

<110> university of agriculture in Huazhong

<120> a method for increasing iron content in plant tissue

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 4886

<212> DNA

<213> Glycine genus Soybean (Glycine max)

<400> 1

atgggtactt cagaaaggat cgacttggag cacggcggcg aggaggtggc ggaagcggcg 60

gcgtcggtgg agaaggcgtt tgaggggaag gaggtgccgc catgggagag gcaggtgacg 120

gtgaggtcga tggtggtgag tttggtgttg ggggtgatgt ttacgttcat cgtcatgaaa 180

cttaacctaa cgacgggaat tattccgtcg ctaaacatat cggcggggct gctagggttt 240

ttcttcgtga aggcgtggac gaagctgctc gccaaatcgg ggatgcttat gcaaccgtat 300

actcgtcagg agaatactgt tattcaaact tgcgttgttg cctctagtgg cattgctttc 360

agcggtaatc tctctctctc tctcttcttt tcacatcatc atcgaaatta aatctatctt 420

tgaaggcttt gcatcatgca aatggtttga ttaattttat tttgtttgaa ttttaaactg 480

atgaatgata aagtgaatag attgctcgtt tgtacacact ttgttttctt tgaatgaaat 540

tcaagctgtg atcagtactc tctagttagg aaatcttgaa aatgggacca attaataaat 600

gaaaaatgga actcacattc atattcatga aaccaaccta gatttcaaga gagattgtat 660

cggagcttct aaaattggaa aaacttagta caagtatttt tggcgttgtg ttttaattaa 720

aaatagattt atttgactaa ttaatgcgaa accttgatgt tggccagtat tttgacgtgc 780

gtgttaaaat ttatttattt aaatttgaat aaagttcacg tttggtttat tatagtaagt 840

tttctttatg aaaacattgg atgaaattaa ctatgatgga ctagtcttac tcatgtatat 900

gaggactatt gtctaataaa acatgacctg cttttactct agtgctcttt caatattaat 960

tttgaaatgg caatcacaaa tgtgacctct cttcattgag atgaatggaa ttttttatac 1020

tttaattctg aattggagaa atattttatg tatacatcat tatatttatt gtccatgtga 1080

acatatccaa cattttaaag ttttatatat atgatgaaat taggggttta ggttttcttg 1140

ctaaataacc aaccgaagta atggtgtcaa taaaacgata tgttttgtaa ttaactttaa 1200

tatggtcaat cctctaacaa ctaattataa ttctaacgga atgtatcttc tttgttgtta 1260

atgcttgttt gattggattt gcttgagcag gaggttttgg tagctacttg tttggaatga 1320

gttcagatat tgctaaacaa tctccagaag ctactgcaca ggatattaag gacccaggtt 1380

taggatggat gatagcattt gcatttgttg ttagctttct tggcctcttt tcattggttc 1440

cactacgaaa ggtacattaa ttaatctaat gtcctcaaat gaacaacgta ttcacgaaat 1500

atgctcaaag tagttagctt tgtcatcatt aattaattgt agggttaatt gcatatttta 1560

ttcttaactt tttaattttt ggtaaatttt atcaccaata aattaatttt acgtatttta 1620

tctcattttt taaagaactt gtaaatttta gccttatcat ttatccatta ataaacacaa 1680

aagttaaaag gtaaaattta gaaataaaat aaaataaata ggataaaatt caaaaaaaat 1740

aataaagttg gattcaaaat ttgtcaaaaa aaataaaaag ttgaagataa aaaatacaat 1800

tatattaaaa gtaaattgat agagaataaa atttataaat ttcttaaaag ttgaatataa 1860

aatgtgtaaa attaatttgt taagggtaaa atttgtcaaa aattaaaaaa ttaaaataaa 1920

aaaatgtaat taagccttaa ttataacccg caccactaca atatagggta aggtgcaaac 1980

tttggttaat ttgaatatga tttgaatgtc taattgtaaa tttgctagca tgaaatatat 2040

aactttttat gcatgaatct tcttgttgct taatgcatgt tgaattgagt attttttttc 2100

tttaacgttt gttgttagat tatgatcgta gacttcaaat tgacatatcc cagtggtact 2160

gcaacggccc atcttatcaa tagtttccat acaacagagg gtgccaaact agctaagtga 2220

ggatttaggc ctttaatatt gcaaaagctt tgttattctt tattataaat acatcaacaa 2280

gatgctctta atttcctttt aactcttttg cttttatagg aagcaagtaa atttgctggg 2340

aaagttcttc tcttttagct tcttttgggg cttcttccaa tggttttaca ctgctagtga 2400

tggttgtggc tttagcaact tccctacatt tggtctggaa gcctataaaa acaagtatgt 2460

gactcaccca tatcttatta atgaaaataa aatagaaaaa aaaaaattct tagttgaata 2520

aaaaatctct gttatagtga cttgaactct taagatgtca cctaagctct aatgcattga 2580

ttctttcggt tatctcaact cttttgatat tctctttagt tgtcacttac tcattttgct 2640

taagtgtcac ttctaggttc aatttcttat ttctcagtat tttcctttta tatacattat 2700

tgtgattata tatgtgcgga ttaccaaatt atttaaaaga ttcacttgaa taaaaacatt 2760

ttattatata ttttaaattt ttctaagaaa ttaggtacat gtacaacgtg cgagtttata 2820

tatagttatg tacaaaaatt ggcagaaacc tataatttct caaatatatg ctgagtggat 2880

tatccaatga ttttatttta accaccatat ccttagaagg agaaacagag gattatgaca 2940

tttacttctt attttaataa tacaccaatc aaaagtatta aaaaatattt attgattata 3000

tagttttata tatgtatttt ggttacctgt gtatcattta tttatctaca taacaggttc 3060

ttcttcgact tttcgactac atatgtcggg gttgggatga tatgcccata tataatcaat 3120

gtatcccttt tggttggtgg aattatctca tgggctatca tgtggcctct cattgataat 3180

aaaaaaggag actggtactc tgcaaagcta gagcagagca gtttgcatgg ccttcaaggt 3240

tacaaagtaa gttgtcttcc cagatttaaa cataattatt tccaaacatg cttatagttt 3300

gaattaacaa tgttgttgga gtataaatat aaaatgatga agtcttacgt ttgatagaaa 3360

taaaaaagtt gaacaacata taaataaaga aaaaacccat aaactagagt attaaaattt 3420

tagatttaag tgtaatgtca atttcacttg tatggttgct cataacctat tggtgtaaat 3480

ctctctaatg tttaactctt agtatccaca ataaatctga aattcatttt gttgaagtta 3540

tgattgatta tatcatatgg attgagaagg taacgagaca tttgaaacac cctaaaaaaa 3600

taatttacct aaaaaaatat caataatttg gacataattg atagatttag tatcaatata 3660

tgacactgta cgcaacatgt gacacaatat taatgtactg tcgcattgtt ctttgaatga 3720

tattgtagct aactgaagaa tatatcctag ttgatcagtt ttattgatgt attctttaat 3780

aacaggtttt catagcaata gcaatgattc ttggtgacgg tctatacaac ttcatcaagg 3840

ttcttggccg aacccttctt ggtttgtata accaattcta cagaaaaagc ttgggcacat 3900

catcatcatc cagtgatcca aattcacctc cattactttc atacgatgat gaacgcagaa 3960

ttgacatgtt cctcaaggac caaatccccg tatggtttgc tgtcattggc tacgttgtga 4020

ttgcagtagc ctcaattgtg attgtccccc acattttccc acagctcaag tggtactaca 4080

ttgttgtgat ctacatcatt gcaccagcat tagcattttg caatgcatat gggtgtggac 4140

tcacagattg gtcccttgca tcaacctatg gaaaattggc catcttcact attggtgcat 4200

gggctggtgc atctcagggt ggtgtcattg ctggtttggc tgcatgtgga gtcatgatga 4260

acattgtgtc cacagcatct gatctaacgc aagatttcaa gacaggttac atgacattag 4320

cttcaccaag gtccatgttt ttgagccaag ttttaggaac tgccatgggt tgtgttatat 4380

ctccttgtgt tttttggctt ttttacaagg cttttggcaa cctagggatt cctggctcag 4440

catatcctgc accttatgct cttgtttatc gcaacatggc gatacttgga gtagatggct 4500

tctcagcttt gccacaatat tgtctcaccc tttgttgtgt gttctttgtg gcagcaatag 4560

gtatcaatct tgttagagat ttggttggag aaaaatgggc caagtttatt cctgttccta 4620

tggctatggc aatacccttt tatattggaa gttactttgc tattgatatg tgtgttggta 4680

gtttgatctt gtttatttgg cagaggattg ataaggttaa tgctgacaca tttggatcag 4740

ctgtggcttc tggtttgatt tgtggggatg gaatttggac acttcctagc tcatttttgg 4800

ctctagcagg agtgaaacca cctatctgca tgaaattttt gtccagaggg gtaaatacaa 4860

aggtggatgg attcttagaa tcttga 4886

<210> 2

<211> 39

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 2

cccccgggat gggtacttca gaaaggatcg acttggagc 39

<210> 3

<211> 46

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 3

cgggatcctc aagattctaa gaatccatcc acctttgtat ttaccc 46

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 4

gtggtgtcat tgctggtttg 20

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 5

ctaggttgcc aaaagccttg 20

Claims (5)

1. A method of increasing the iron content of plant tissue, comprising: overexpressing in vivo in a plant the amino acid sequence set forth in SEQ ID NO: 1 to obtain a transgenic plant with increased iron content in plant tissues; the plant is soybean, and the plant tissue is soybean grains.

2. The method of claim 1, wherein the method comprises the step of: firstly, a peptide containing SEQ ID NO: 1, then constructing a transformant by using the recombinant expression vector, infecting a target plant by using the transformant, and screening a positive plant to obtain a transgenic plant with increased iron content in plant tissues.

3. The method of claim 2, wherein the step of increasing the iron content of the plant tissue comprises: the recombinant over-expression vector takes a PTF101 vector as a skeleton vector and is connected with a 35S strong promoter.

4. The method of claim 2, wherein the step of increasing the iron content of the plant tissue comprises: and transforming agrobacterium EHA101 by using the recombinant expression vector to prepare a transformant.

5. The method of claim 2, wherein the step of increasing the iron content of the plant tissue comprises: the target plant is transformed by utilizing an agrobacterium EHA101 mediated soybean stable transformation method.

Images