KR101677482B1 - Antibiotic marker-free transgenic rice with over-expressed high affinity phosphate transporter OsPT4 gene from Oryza sativa - Google Patents

Antibiotic marker-free transgenic rice with over-expressed high affinity phosphate transporter OsPT4 gene from Oryza sativa Download PDF

Info

Publication number
KR101677482B1
KR101677482B1 KR1020140160405A KR20140160405A KR101677482B1 KR 101677482 B1 KR101677482 B1 KR 101677482B1 KR 1020140160405 A KR1020140160405 A KR 1020140160405A KR 20140160405 A KR20140160405 A KR 20140160405A KR 101677482 B1 KR101677482 B1 KR 101677482B1
Authority
KR
South Korea
Prior art keywords
ospt4
gene
rice
callus
vector
Prior art date
Application number
KR1020140160405A
Other languages
Korean (ko)
Other versions
KR20160059103A (en
Inventor
황운하
박동수
박수권
신동진
조준현
이종희
이지윤
한상익
남민희
송유천
손영보
Original Assignee
대한민국
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 대한민국 filed Critical 대한민국
Priority to KR1020140160405A priority Critical patent/KR101677482B1/en
Publication of KR20160059103A publication Critical patent/KR20160059103A/en
Application granted granted Critical
Publication of KR101677482B1 publication Critical patent/KR101677482B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8209Selection, visualisation of transformants, reporter constructs, e.g. antibiotic resistance markers

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Cell Biology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

본 발명은 식물체 형질전환에 관한 기술로서, 구체적으로 벼 유래의 고친화성 인산운반체 유전자인 OsPT4가 도입되고 항생제 선발 마커가 제거된 형질전환 벼 및 이의 제조방법에 관한 것이다.
본 발명의 형질전환 벼는 항생제 선발마커가 들어있지 않아 GM작물에 대한 소비자들의 안전성에 대한 우려를 경감하여 상업적인 활용이 타 형질전환 벼에 비해 우수하다. 또한, 본 발명에 사용된 OsPT4은 인산결핍시 벼에서 발현되는 고친화성 인산운반체로서, 상기 유전자의 과발현을 통해 식물이 필요로 하는 필수 영양소 중의 하나인 인산흡수를 증진시킴으로써 토양인산 이용성을 높일 수 있다.
TECHNICAL FIELD The present invention relates to a method of transforming plants, and more particularly, to a transgenic rice in which OsPT4, a high-affinity phosphate carrier gene derived from rice, is introduced, and an antibiotic selection marker is removed, and a method for producing the same.
Since the transgenic rice of the present invention does not contain an antibiotic selection marker, commercial use is superior to other transgenic rice by alleviating the concern about safety of consumers on GM crops. In addition, OsPT4 used in the present invention is a highly-phosphorylated phosphoric acid transporter expressed in rice when it is deficient in phosphoric acid. Thus, overexpression of the gene promotes the uptake of phosphoric acid, which is one of the essential nutrients required by plants, .

Description

벼 유래의 고친화성 인산운반체 OsPT4 유전자가 과발현된 항생제 마커프리 형질전환 벼{Antibiotic marker-free transgenic rice with over-expressed high affinity phosphate transporter OsPT4 gene from Oryza sativa}{Antibiotic marker-free transgenic rice with overexpressed high affinity phosphate transporter OsPT4 gene from Oryza sativa} overexpressing OsPT4 gene from high-affinity phosphate-

본 발명은 벼 유래의 고친화성 인산운반체 유전자인 OsPT4가 도입되고 항생제 선발 마커가 제거된 형질전환 벼 및 이의 제조방법에 관한 것이다.
The present invention relates to transgenic rice plants in which OsPT4, which is a high-affinity phosphate carrier gene derived from rice, and antibiotic selection markers have been removed, and a method for producing the same.

벼는 세계 4대 식량작물의 하나로 우리나라를 포함한 아시아 지역 사람들의 주식이 되는 작물로, 많은 연구자들이 관행 교배육종, 분자육종 및 형질전환방법 등 다양한 육종방법을 통해 경제성 및 수량성을 향상을 위해 노력하고 있다. 이 중 형질전환 방법은 관행의 육종방법에 비해 농업적으로 유용한 유전자를 직접 작물에 도입함으로써 유전적으로 개량된 신품종을 개발할 수 있는 장점이 있다. 즉 농업분야에서의 형질전환기술은 병충해, 가뭄, 습해, 자외선 등 다양한 생물학적, 비생물학적 스트레스에 대한 내성 등 작물의 수량성 관련 형질은 물론, 아이소플라본, 비타민 A, 철분 등 작물의 유용성분을 증가시킬 수 있도록 하는 품질관련 형질의 개선을 위해 보다 직접적이고 적극적으로 활용할 수 있는 육종법이다. Rice is one of the four major food crops in the world. It is a stock of Asian people including Korea. Many researchers try to improve economic efficiency and yield through various breeding methods such as cross breeding, molecular breeding and transformation methods. . Among them, the transgenic method has the merit that genetically improved new varieties can be developed by directly introducing agriculturally useful genes into the crops as compared with conventional breeding methods. In other words, the transformation technology in the agricultural field increases the useful components of crops such as isoflavone, vitamin A, and iron, as well as the yield related traits of crops such as resistance to various biological and non-biological stresses such as pests, droughts, This is a breeding method that can be utilized more directly and positively to improve the quality related traits that can be made.

그러나 대부분의 기존의 형질전환기술은 유전자가 도입된 세포, 캘러스, 식물조직의 선발, 배양, 및 식물체 재분화를 위해 bar(Basta herbicide resistant gene), hpt(hygromycin phosphotransferase), NPTⅡ(neomycin phosphotransferase) 등의 제초제 및 항생제 저항성 유전자가 선발마커(selectable marker)로 이용된다. 선발마커 유전자는 목적유전자와 함께 동일 벡터에 탑재하여 식물조직에 형질전환 한 후 포스피노트리신 또는 하이그로마이신 B 등 항생제가 포함된 배지에서 선발 및 배양함으로써 효과적으로 형질전환 식물체를 생산하는 방법이다. 그러나 일반소비자들은 선발마커 유전자의 유해성 우려로, 형질전환작물 및 이를 원료로 한 가공식품에 대해 매우 부정적인 시각을 가지고 있어 형질전환작물의 실용화는 매우 어려운 실정이다. However, most of the existing transgenic techniques are not suitable for the selection of cells, callus, and plant tissues with gene transfer, for the production of Basta herbicide resistant gene, hpt (hygromycin phosphotransferase) and NPT II (neomycin phosphotransferase) Herbicide and antibiotic resistance genes are used as selectable markers. The selection marker gene is inserted into the same vector together with the target gene, transformed into plant tissue, and then selected and cultured in a medium containing antibiotics such as phosphinotricin or hygromycin B to produce transgenic plants effectively. However, commercial consumers have a very negative view of transgenic crops and processed foods made of them as a result of concern about the risk of selection marker genes, making commercialization of transgenic crops very difficult.

한편, 인산은 작물의 생육 및 발달에 중요한 원소로서, 토양 내에서 철분, 칼슘 등과 쉽게 결합하여 식물이 이용할 수 없는 형태로 쉽게 변형된다. 이 때문에 비료를 통한 투입을 필요로 하나, 투입된 비료의 20%만이 식물에 이용되고, 나머지 80%는 토양 속 철분, 칼슘 등과 결합하여 축적된다. 인산질 비료는 인광석을 주원료로 개발되고 있으나, 인광석은 모로코, 중국, 미국 등에 매장되어 있으며 그 매장량도 한정적인 바, 향후 50~100년 사이에 고갈될 것으로 예상되고 있다. 이에 따라, 토양 내 인산을 효율적으로 이용할 수 있는 작물 또는 인산 부족 조건에서도 안정적인 수량을 확보할 수 있는 작물을 개발하기 위해 지금까지 많은 연구가 수행되고 있다.
On the other hand, phosphoric acid is an important element in the growth and development of crops, and easily transforms into a form that plants can not use because it easily bonds with iron and calcium in the soil. For this reason, it is necessary to input through fertilizer, but only 20% of the applied fertilizer is used in plants and the remaining 80% is accumulated by binding with iron, calcium and so on in the soil. Phosphoric acid fertilizers are being developed mainly for phosphorus, but phosphate ore is buried in Morocco, China, and the United States. Its reserves are limited, and it is expected to be depleted in the next 50 ~ 100 years. Accordingly, a lot of researches have been conducted so far to develop a crop capable of securing a stable yield even in a crop or phosphate-deficient condition that can efficiently utilize phosphoric acid in the soil.

이러한 배경 하에, 본 발명자들은 토양 내 존재하는 인산을 효율적으로 이용할 수 있도록, 인산흡수를 증진시키는 벼에서 유래한, 고친화성 인산운반체인 OsPT4 유전자가 도입되고, 항생제 선발마커가 제거된 형질전환용 벡터를 제작하였고, 이를 형질전환시켜 토양 내 인산 이용성이 향상된 항생제 선발마커프리 형질전환 벼를 개발함으로써 본 발명을 완성하였다.
Under these circumstances, the inventors of the present invention have found that, in order to efficiently utilize the phosphoric acid present in the soil, the OsPT4 gene, which is a high-affinity phosphate carrier derived from rice, which promotes phosphoric acid uptake, And developed the antibiotic selection marker free transgenic rice improved in the availability of phosphate in the soil by transforming the transgenic rice.

본 발명의 목적은 (a) 인산을 포함하는 MS(Murashige-Skoog) 배지에 현미를 치상하여 30 내지 35℃에서 배양하여 캘러스를 유도하는 단계; (b) OsPT4 유전자를 포함하는 마커프리 벡터가 도입된 아그로박테리움 및 항생제 저항성 유전자를 포함하는 벡터가 도입된 아그로박테리움을 2.5 : 1 내지 3.5 : 1의 비율로 캘러스에 접종시켜 배양하는 단계; (c) 상기 (b) 단계의 배양된 캘러스로부터 재분화 벼 식물체를 유도하는 단계; 및 (d) 상기 유도된 재분화 식물체로부터 OsPT4 유전자가 도입되고, 항생제 저항성 유전자를 포함하지 않는, 형질전환 벼를 선별하는 단계를 포함하는, OsPT4(Oryza sativa putative phosphate transporter) 유전자가 도입되고 항생제 선발 마커가 제거된, 형질전환 벼의 제조 방법을 제공하는 것이다.The object of the present invention is to provide a method for culturing a microorganism, which comprises the steps of: (a) culturing a microorganism in a medium containing phosphoric acid (Murashige-Skoog) medium at 30 to 35 占 폚 to induce callus; (b) culturing the callus by inoculating Agrobacterium containing a marker-free vector containing OsPT4 gene and Agrobacterium containing a vector containing an antibiotic resistance gene in a ratio of 2.5: 1 to 3.5: 1; (c) deriving regenerated rice plants from the cultured callus of step (b); And (d) a step of selecting OsPT4 (Oryza sativa putative phosphate transporter) gene, which comprises the step of selecting transgenic rice from which the OsPT4 gene is introduced from the derived regenerated plant and does not contain an antibiotic resistance gene, The present invention provides a method for producing transgenic rice.

본 발명의 다른 목적은 OsPT4 유전자가 도입되고 항생제 선발 마커가 제거된, 형질전환 벼를 제공하는 것이다.
Another object of the present invention is to provide transgenic rice in which the OsPT4 gene is introduced and antibiotic selection markers are removed.

상기의 목적을 달성하기 위한 하나의 양태로서, 본 발명은 (a) 인산을 포함하는 MS(Murashige-Skoog) 배지에 현미를 치상하여 30 내지 35℃에서 배양하여 캘러스를 유도하는 단계; (b) OsPT4 유전자를 포함하는 마커프리 벡터가 도입된 아그로박테리움 및 항생제 저항성 유전자를 포함하는 벡터가 도입된 아그로박테리움을 2.5 : 1 내지 3.5 : 1의 비율로 캘러스에 접종시켜 배양하는 단계; (c) 상기 (b) 단계의 배양된 캘러스로부터 재분화 벼 식물체를 유도하는 단계; 및 (d) 상기 유도된 재분화 식물체로부터 OsPT4 유전자가 도입되고, 항생제 저항성 유전자를 포함하지 않는, 형질전환 벼를 선별하는 단계를 포함하는, OsPT4(Oryza sativa putative phosphate transporter) 유전자가 도입되고 항생제 선발 마커가 제거된, 형질전환 벼의 제조 방법을 제공한다.
In order to accomplish the above object, the present invention provides a method for culturing a cell line, comprising the steps of: (a) inducing calli by culturing the cells in a medium containing phosphoric acid in an MS (Murashige-Skoog) medium at 30 to 35 ° C; (b) culturing the callus by inoculating Agrobacterium containing a marker-free vector containing OsPT4 gene and Agrobacterium containing a vector containing an antibiotic resistance gene in a ratio of 2.5: 1 to 3.5: 1; (c) deriving regenerated rice plants from the cultured callus of step (b); And (d) a step of selecting OsPT4 (Oryza sativa putative phosphate transporter) gene, which comprises the step of selecting transgenic rice from which the OsPT4 gene is introduced from the derived regenerated plant and does not contain an antibiotic resistance gene, Is removed, and a method for producing transgenic rice is provided.

본 발명의 (a) 단계는 형질전환 벼를 제조하기 위하여, 먼저 인산을 포함하는 MS(Murashige-Skoog) 배지에 현미를 치상하여 30 내지 35℃에서 배양하여 캘러스를 유도하는 단계이다.
The step (a) of the present invention is a step of inducing callus by culturing at 30 to 35 ° C against brown rice in a MS (Murashige-Skoog) medium containing phosphoric acid first to produce transgenic rice.

본 발명에서 용어, “벼(Oryza sativa)”는 외떡잎식물 벼목 화본과의 한해살이풀 식용작물로서, 열매를 찧은 것을 쌀이라고 하며, 전세계 인구의 40% 정도가 쌀을 주식량으로 한다. 벼속에 속하는 식물로는 20여 종(種) 이상이 알려져 있으나 실제로 재배되고 있는 것은 벼(O. sativa)가 대부분이다. 본 발명의 형질전환 대상으로서, 구체적으로 풍옥, 수성, 팔굉, 팔달, 진흥, 재건, 팔금, 농백, 낙동, 관악, 진주, 설악, 동진 등이 있으나, 벼목에 속하는 식물체라면 이에 제한되지 않으며, 바람직하게는 동진벼일 수 있다.The term " rice (Oryza sativa) " in the present invention is an annual vegetable crop of the alopecia plantus. The fruit is called rice, and about 40% of the world's population is rice. More than 20 species are known to belong to the rice plant, but most of them are cultivated rice (O. sativa). As the transgenic object of the present invention, there may be mentioned pung oak, water, palpop, palm, promotion, reconstruction, palm, rice paddy, nakdong, gwanak, pearl, It could be Dong Jinbin.

본 발명에서 용어, “배지”란 미생물이나 동식물의 세포 또는 조직 등을 배양하기 위해 배양체가 필요로 하는 영양물질을 주성분으로 함유한 것을 의미한다. 현재까지 수많은 종류의 배지가 개발되어 있으나, 실험 목적에 따라 적절히 선택할 수 있다. 본 발명에서 사용한 MS 배지는 Murashige-Skoog 배지라고도 하며, 상기 배지는 일반적으로 캘러스 등의 식물세포를 배양하기에 적절한 증식배지로 당업계에 널리 알려져 있다. 상기 MS 배지는 다른 배지에 비하여 질산, 암모늄 등의 질소원과 포타슘 이온의 함량이 높은 편이다.In the present invention, the term " medium " means that the microorganism, the cells or tissues of plants and animals are cultured, and the nutrients necessary for the cultures are contained as a main component. Although many kinds of media have been developed so far, they can be appropriately selected according to the purpose of the experiment. The MS medium used in the present invention is also called Murashige-Skoog medium, and the medium is generally known in the art as a propagation medium suitable for culturing plant cells such as callus. The MS medium has a higher content of nitrogen ions and potassium ions such as nitric acid, ammonium, and the like compared to other media.

본 발명에서 용어, “현미”란 수확한 벼를 건조, 탈곡한 후 왕겨를 벗긴 쌀로서, 과피, 종피 등의 겨층은 벗겨지지 않은 상태의 쌀을 의미한다. 바람직하게 상기 현미는 동진벼 품종일 수 있으나, 이에 제한되지 않는다. In the present invention, the term " brown rice " means rice in which the harvested rice is dried and thawed and then the rice husk is peeled off. Preferably, the brown rice may be a Dongjin rice variety, but is not limited thereto.

본 발명에서 용어, “캘러스”란 분화되지 않은 부정형의 세포덩어리를 의미하며, 식물체에 상처가 났을 때 상처 주변에 생기는 분열조직이 형성한 종양조직이 대표적이다. 이러한 캘러스의 배양은 식물의 기관에서 분리해 낸 상처받은 절편체 조직으로부터 세포 분열 증식시키는 것을 의미하며, 이는 형태형성, 세포 구조 및 물질대사를 연구하는데 널리 이용될 수 있다.
In the present invention, the term " callus " refers to an indefinite amorphous cell mass, and tumor tissue formed by a cleavage tissue formed around a wound when a plant is injured is typical. The culture of these calli means cell proliferation from injured interstitial tissue isolated from plant organs, which can be widely used to study morphogenesis, cell structure and metabolism.

본 발명의 (a) 단계는 캘러스를 유도하는 단계로서, ⅰ) MS 배지에 인산을 추가로 포함하고, 또한 ⅱ) 종래의 캘러스 배양온도인 25℃보다 높은 30 내지 35℃에서 배양함으로써 캘러스의 배양기간을 훨씬 단축시킬 수 있는 효과가 있다.The step (a) of the present invention is a step of inducing a callus comprising culturing the callus by i) further culturing the MS medium at 30 to 35 ° C, which further comprises phosphoric acid and ii) It is possible to shorten the period much more.

일반적으로 캘러스의 치상배지에서 현미를 배양함에 있어, 25℃ 내외의 온도에서 배양을 한다. 다만, 본 발명에서는 캘러스 배양온도를 종래의 25℃에서 30 내지 35℃, 바람직하게는 32℃로 높임으로써 캘러스 배양기간이 단축되는 효과를 확인하였다.In general, culturing of brown rice is carried out at a temperature of about 25 ° C in a callus germination medium. However, in the present invention, the callus incubation period was shortened by raising the callus incubation temperature from 25 캜 to 30 캜 to 35 캜, preferably 32 캜.

또한, 본 발명에서는 캘러스의 생장촉진을 위하여 종래의 MS 배지에 인산, 구체적으로 KH2PO4를 추가함으로써, 마찬가지로 캘러스 배양기간을 단축시킬 수 있음을 확인하였다. 이때, 상기 배지 내에 포함되는 인산의 농도는 바람직하게는 3.0 내지 4.0 %(w/v), 가장 바람직하게는 3.6 %(w/v) 일 수 있으나, 이에 제한되는 것은 아니다.Further, in the present invention, it was confirmed that by adding phosphoric acid, specifically KH2PO4, to the conventional MS medium for promoting callus growth, the callus incubation period can be similarly shortened. At this time, the concentration of phosphoric acid contained in the medium may be preferably 3.0 to 4.0% (w / v), most preferably 3.6% (w / v), but is not limited thereto.

이에 따라, 캘러스 발생기간이 2주에서 1주로 단축되었고, 현미에서 유도된 캘러스를 새로운 캘러스 유도 배지에 치상하고 나서 1주일 후에 생장된 캘러스를 형질전환에 이용할 수 있었다. 따라서 기존의 캘러스 배양에 4주의 기간이 소요되던 것을 2주로 단축할 수 있음을 확인하였다.
As a result, callus development time was shortened from two weeks to one week, and the callus induced from brown rice could be used for transformation after a week after a new callus induction medium. Therefore, it was confirmed that it was possible to shorten the period of time required for 4 weeks in conventional callus culturing to 2 weeks.

본 발명의 (b) 단계는 OsPT4 유전자를 포함하는 마커프리 벡터가 도입된 아그로박테리움 및 항생제 저항성 유전자를 포함하는 벡터가 도입된 아그로박테리움을 2.5 : 1 내지 3.5 : 1의 비율로 캘러스에 접종시켜 배양하는 단계이다.
In step (b) of the present invention, agrobacterium into which a marker-free vector containing OsPT4 gene is introduced and agrobacterium into which a vector containing an antibiotic resistance gene is introduced is inoculated into callus at a ratio of 2.5: 1 to 3.5: 1 Followed by incubation.

구체적으로, 본 발명의 (b) 단계는 아그로박테리움 공동형질전환법(Agrobacterium-mediated co-transformation)으로 형질전환 벼를 제조하는 단계이다. Specifically, step (b) of the present invention is a step of producing transformed rice with Agrobacterium-mediated co-transformation.

먼저, OsPT4 유전자를 포함하면서 항생제 저항성 유전자가 제거된 마커프리 재조합 발현벡터는 하기와 같이 제조될 수 있다.First, a marker-free recombinant expression vector containing the OsPT4 gene and having the antibiotic resistance gene removed can be prepared as follows.

본 발명에서 용어, “OsPT4"은 고친화성 인산운반체를 암호화하는 OsPT(Oryza sativa Phosphate Transporter) 군(family)의 하나로서, 토양 내 인산 흡수를 증진시키는 인산운반체 단백질을 발현하는 유전자로 알려져 있다. 바람직하게는 상기 OsPT4 유전자는 서열번호 5의 서열을 가질 수 있으나, 이에 제한되는 것은 아니다. The term " OsPT4 "in the present invention is a family of OsPT (Oryza sativa Phosphate Transporter) family that encodes a high affinity phosphate carrier and is known as a gene expressing a phosphate carrier protein that promotes absorption of phosphate in the soil. The OsPT4 gene may have the sequence of SEQ ID NO: 5, but is not limited thereto.

본 발명의 “유전자”에는 DNA, RNA 등이 포함될 수 있다. DNA에는 유전체 DNA(gemonic DNA), cDNA 등을 포함할 수 있으며, RNA에는 mRNA 등을 포함할 수 있다. 본 발명의 유전자는 오픈리딩프레임(open reading frame)은 물론, TATA 박스나 폴리-A-tail 서열 등의 비번역 부위(UTR) 등을 모두 포함할 수 있으며, 이에 제한되지 않는다.The "gene" of the present invention may include DNA, RNA, and the like. DNA may include gemonic DNA, cDNA, etc., and RNA may include mRNA and the like. The gene of the present invention may include, but is not limited to, an open reading frame as well as a non-translated region (UTR) such as a TATA box or a poly-A tail sequence.

본 발명에서 용어, “벡터”란 프로모터 및 상기 프로모터와 작동가능하게 연결되어 있는 목적 단백질을 암호화하는 유전자 서열이 삽입 또는 도입될 수 있는 당분야에 공지된 플라스미드, 바이러스 또는 기타 매개체를 의미한다. 구체적으로, 고친화성 인산운반체 유전자 OsPT4의 발현 프로모터 및 상기 프로모터와 작동가능하게 연결되어 있는 인산운반체 단백질을 암호화하는 OsPT4 유전자 서열은 발현 조절 서열에 작동 가능하게 연결될 수 있으며, 상기 작동가능하게 연결된 유전자 서열과 발현 조절 서열은 선발마커 및 복제 개시점(replication origin)을 같이 포함하고 있는 하나의 벡터 내에 포함될 수 있다. 상기에서 용어, "작동 가능하게 연결(operably linked)"된다는 것은 적절한 분자가 발현 조절 서열에 결합될 때 유전자 발현을 가능하게 하는 방식으로 연결되는 것을 의미한다. 또한, 상기 용어, "발현 조절 서열(expression control sequence)"이란, 특정한 숙주 세포에서 작동 가능하게 연결된 폴리뉴클레오티드 서열의 발현을 조절하는 DNA 서열을 의미한다. 상기 조절 서열은 전사를 실시하기 위한 프로모터, 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합 부위를 코딩하는 서열 및 전사 및 해독의 종결을 조절하는 서열을 포함할 수 있다.The term " vector " in the present invention means a plasmid, virus or other medium known in the art into which a promoter and a gene sequence encoding a target protein operably linked to the promoter can be inserted or introduced. Specifically, an OsPT4 gene sequence encoding an expression promoter of the high-affinity phosphate carrier gene OsPT4 and a phosphate carrier protein operably linked to the promoter may be operably linked to an expression control sequence, wherein the operably linked gene sequence And expression control sequences may be contained within a single vector containing both a selection marker and a replication origin. As used herein, the term "operably linked" means that the appropriate molecule is linked in such a way as to enable gene expression when bound to expression control sequences. The term "expression control sequence" also refers to a DNA sequence that regulates the expression of a polynucleotide sequence operably linked to a particular host cell. The regulatory sequence may include a promoter to effect transcription, an optional operator sequence to regulate transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence to control the termination of transcription and translation.

본 발명에 따른 벡터는, 단백질 발현에 사용되는 기존의 벡터를 기본 골격으로 하여 본 발명의 프로모터의 하류(downstream)쪽으로 OsPT4을 암호화하는 염기서열을 삽입함으로써 제조할 수 있다. 따라서 본 발명에 사용될 수 있는 벡터로 식물 바이러스 벡터 등이 있으며, 구체적 예로서 pCHF3, pPZP, pGA, pCAMBIA 계열과 같은 바이너리벡터를 사용할 수 있다. 그러나 당업자라면 본 발명의 프로모터 및 상기 프로모터와 작동가능하게 연결되어 있는 목적 단백질을 암호화하는 염기서열을 숙주 세포내로 도입할 수 있는 벡터라면 어떠한 벡터라도 모두 사용할 수 있다. The vector according to the present invention can be prepared by inserting a nucleotide sequence coding for OsPT4 downstream of the promoter of the present invention using a conventional vector used for protein expression as a basic framework. Thus, the vectors that can be used in the present invention include plant virus vectors, and specific examples include binary vectors such as pCHF3, pPZP, pGA, and pCAMBIA sequences. However, those skilled in the art can use any vector as long as it can introduce the promoter of the present invention and the nucleotide sequence encoding the target protein operably linked to the promoter into the host cell.

한편, 발현벡터에 존재하는 항생제 저항성 유전자 및/또는 이의 프로모터를 제거하고 난 후, 남은 부분을 재결합(ligation)시킴으로써 상기 항생제 저항성 유전자 및/또는 이의 프로모터가 없는 마커프리 벡터를 제조할 수 있다. 본 발명에서 용어, “마커프리”는 항생제 내성 유전자가 없는 또는 항생제 내성 유전자를 제거한 것을 의미할 수 있으나, 이에 제한되지 않는다. 상기 용어, 항생제는 미생물 등이 생산하는 대사산물로서, 소량으로 다른 미생물의 발육을 억제하거나 사멸시키는 물질을 의미한다. 항생제의 종류에는 페니실린류, 세팔로스포린류, 아미노글리코사이드류, 테트라사이클린류, 클로람페니콜, 폴리펩티드류, 퀴놀론류 등이 존재하며, 바람직하게는 아미노글리코사이드류일 수 있으며, 더욱 바람직하게는 하이그로마이신일 수 있으나, 이에 제한되는 것은 아니다.On the other hand, the antibiotic resistance gene and / or its promoter existing in the expression vector is removed, and the remaining part is ligated to produce the marker-free vector without the antibiotic resistance gene and / or its promoter. The term " marker-free " in the present invention can mean, but not be limited to, the absence of an antibiotic resistance gene or the removal of an antibiotic resistance gene. The term antibiotic is a metabolite produced by a microorganism or the like, and refers to a substance that suppresses or kills the growth of other microorganisms in a small amount. Examples of the antibiotics include penicillins, cephalosporins, aminoglycosides, tetracyclines, chloramphenicol, polypeptides, quinolones and the like, preferably aminoglycosides, and more preferably, But is not limited thereto.

본 발명에서 용어, “항생제 저항성 유전자를 포함하는 벡터”는 목적 유전자가 도입되지 않으며, 항생제 저항성 유전자를 포함하는 벡터를 의미한다. 상기 항생제 저항성 유전자를 포함하는 벡터는 공벡터로도 명명되며, 상기에 설명한 OsPT4 유전자가 도입된 마커프리 벡터의 제조단계를 거치지 않은 일반적인 플라스미드일 수 있으며, 구체적으로 pCAMBIA1300 벡터일 수 있으나, 특별히 이에 제한되는 것은 아니다.In the present invention, the term " vector containing an antibiotic resistance gene " means a vector containing no antigens resistance gene and no target gene introduced therein. The vector containing the antibiotic resistance gene is also referred to as a public vector, and may be a general plasmid without the step of preparing a marker-free vector into which the OsPT4 gene is introduced, and may be a pCAMBIA1300 vector. It is not.

본 발명의 (b) 단계는 상기 벡터를 캘러스에 접종하는 단계로서, 구체적으로 상기 과정을 통해 제조된, OsPT4 유전자를 포함하는 항생제 마커프리 발현벡터 또는 항생제 저항성 유전자를 포함하는 벡터를 아그로박테리움 균주에 도입시키는 단계에 해당한다. 본 발명에서는 형질전환 벼 생산을 위해 LBA4404, AGL1 및 EHA105 등 다양한 아그로박테리움이 제한없이 이용될 수 있으며, 도입방법 역시 통상적인 아그로박테리움의 도입방법이 적용될 수 있다.The step (b) of the present invention is a step of inoculating the callus with the vector. Specifically, an antibiotic marker-free expression vector containing the OsPT4 gene or a vector containing the antibiotic resistance gene, which is produced through the above process, is transformed into Agrobacterium strain As shown in FIG. In the present invention, various agrobacterium such as LBA4404, AGL1 and EHA105 may be used without limitation for the production of transgenic rice. Conventional methods for introducing Agrobacterium can also be used as an introduction method.

바람직하게는 상기 캘러스는 배양한지 2주 내지 3주 이내의 것일 수 있으나, 이에 제한되지 않는다.Preferably, the callus may be within 2 to 3 weeks of cultivation, but is not limited thereto.

바람직하게는 상기 OsPT4 유전자를 포함하는 항생제 마커프리 발현벡터와 항생제 저항성 유전자를 포함하는 벡터의 비율은 2.5 : 1 내지 3.5 : 1의 비율로 혼합하여 도입될 수 있으며, 보다 바람직하게는 3 : 1의 비율로 혼합하여 도입될 수 있으나, 이에 제한되는 것은 아니다. OsPT4 유전자를 포함하는 항생제 마커프리 발현벡터가 도입된 개체를 수득하고자 하는 것이므로, 항생제 저항성 유전자를 포함하는 벡터보다 더 많이 혼합되어야 하나, 지나치게 많은 경우에는 항생제가 포함된 재분화배지에서 재분화된 개체를 수득하기 어려우므로, 2.5 : 1 내지 3.5 : 1의 비율로 혼합하여 도입될 수 있으며, 보다 바람직하게는 3 : 1의 비율로 혼합하여 도입하는 것이 바람직하다.
Preferably, the ratio of the antibiotic marker-free expression vector containing the OsPT4 gene to the vector containing the antibiotic resistance gene may be mixed in a ratio of 2.5: 1 to 3.5: 1, more preferably 3: 1 But the present invention is not limited thereto. Since it is intended to obtain an individual into which an antibiotic marker-pre-expression vector containing OsPT4 gene is introduced, it is necessary to mix more than the vector containing the antibiotic resistance gene. In an excessive number of cases, the regenerated individuals are obtained from the regeneration medium containing antibiotics It is preferable to mix them at a ratio of 2.5: 1 to 3.5: 1, and more preferably at a ratio of 3: 1.

본 발명의 (c) 단계는 상기 (b) 단계의 배양된 캘러스로부터 재분화 벼 식물체를 유도하는 단계이다.
The step (c) of the present invention is a step of deriving the regenerated rice plant from the cultured callus of the step (b).

구체적으로, 상기 벡터가 도입된 아그로박테리움이 접종된 캘러스를 재분화 배지에 배양함으로써, 벼 식물체를 성장시키는 단계이다. Specifically, the step of growing the rice plant by culturing the agrobacterium-introduced callus into which the vector has been introduced in a regeneration medium.

본 발명에서 용어, “재분화”는 배양 조건을 변화시킴으로써 부정 싹이나 부정 뿌리가 형성되어 식물체가 재생하는 출발점이 되는 현상을 의미한다. 즉, 기존의 캘러스 상태의 세포는 특별한 기능을 갖도록 성장하는 능력이 없었으나, 배양 조건을 변화시켜 줌으로써 식물체가 자랄 수 있도록 하는 것을 의미한다.In the present invention, the term " regeneration " refers to a phenomenon in which a plant is regenerated by regeneration of cultured conditions, thereby forming an indefinite shoot or a roots. That is, existing callus cells do not have the ability to grow to have a specific function, but it means that the plant can grow by changing the culturing conditions.

본 발명에서의 재분화 배지에는 항생제가 포함되어 있는 것을 특징으로 한다. 따라서 상기 배지에서 재분화하는 벼 식물체는 OsPT4 유전자를 포함하는 마커프리 벡터와 항생제 저항성 유전자를 포함하는 공벡터가 함께 도입된 형질전환 벼이거나, 또는 항생제 저항성 유전자를 포함하는 공벡터만이 도입된 형질전환 벼에 해당할 수 있다.
The regeneration medium in the present invention is characterized by containing antibiotics. Therefore, the rice plant that regenerates in the medium may be a transgenic rice plant into which a public vector containing an OsPT4 gene and a public vector containing an antibiotic resistance gene are introduced, or a transgenic plant in which only a vector containing an antibiotic resistance gene is introduced It may correspond to rice.

본 발명의 (d) 단계는 상기 유도된 재분화 식물체로부터 OsPT4 유전자가 도입되고, 항생제 저항성 유전자를 포함하지 않는, 형질전환 벼를 선별하는 단계이다.
The step (d) of the present invention is a step of selecting transgenic rice plants to which the OsPT4 gene is introduced from the derived regenerated plant and does not contain the antibiotic resistance gene.

구체적으로, 상기 (d) 단계는, (c) 단계의 재분화 단계를 통해 선발된 형질전환 식물체 중에서 OsPT4 유전자를 포함하는 마커프리 벡터가 도입된 형질전환체를 선택적으로 선발하기 위하여, OsPT4 유전자를 검출하고, 항생제 저항성 유전자의 도입 여부를 확인하는 단계이다. Specifically, in step (d), OsPT4 gene is detected in order to selectively select a transformant into which a marker-free vector containing OsPT4 gene has been introduced in the transgenic plants selected through the regeneration step of step (c) , And confirming whether or not the antibiotic resistance gene is introduced.

이러한 (d) 단계는 OsPT4 유전자를 포함하는 마커프리 벡터에 특이적인 프라이머를 사용하여 중합효소 연쇄반응(PCR) 등으로 OsPT4 유전자의 도입 여부를 확인함으로써, OsPT4 마커프리 벡터가 삽입된 개체를 선발할 수 있으나, 이에 제한되지 않는다. In step (d), the introduction of the OsPT4 gene is confirmed by polymerase chain reaction (PCR) using a primer specific to a marker-free vector containing the OsPT4 gene, thereby selecting an object into which the OsPT4 marker-free vector has been inserted But is not limited thereto.

이때, PCR 반응의 증폭산물을 검출하는 방법 또한 전기영동법에 의할 수 있으나, 당업계에 알려진 다른 기술에 의하여도 증폭될 수 있으며, 이에 제한되는 것은 아니다.At this time, a method of detecting the amplification product of the PCR reaction can also be performed by electrophoresis, but may also be amplified by other techniques known in the art, but is not limited thereto.

이후, 상기 형질전환 벼 개체를 이앙하여 수득한 종자의 이앙개체로부터 DNA 추출을 통하여 항생제 저항성 유전자의 삽입 여부를 확인할 수 있고, 이들 개체의 세대 진전을 통하여 수득한 개체에 대하여도 이를 확인함으로써 OsPT4 유전자가 도입되고, 항생제 저항성 유전자를 포함하지 않는, 형질전환 벼를 최종적으로 선발할 수 있다.
Thereafter, the insertion of the antibiotic resistance gene can be confirmed by DNA extraction from the transgenic organ of the seed obtained by transplanting the transgenic rice plant, and by confirming the obtained gene through the generation of these individuals, the OsPT4 gene And transgenic rice that does not contain an antibiotic resistance gene can be finally selected.

본 발명의 일 실시예에서는, pCAMBIA1300벡터에 제한효소 XhoI과 EcoRI을 처리하여 하이그로마이신 저항성 유전자(HPT)가 제거하고, 이후 상기 벡터에 OsPT4 유전자를 삽입하여 제조한 마커프리 벡터를 만들고, 상기 마커프리 벡터와 공벡터를 3 : 1의 비율로 캘러스에 접종시켜 배양 및 재분화한 후, OsPT4 마커프리 벡터 특이적인 프라이머를 사용하여 PCR 및 전기영동을 통해 OsPT4 마커프리 벡터가 삽입된 22개체를 선발하였다. 이후 세대 진전을 통한 개체에 대한 선발을 계속한 결과 생육양상이 가장 우수한 계통의 OsPT4 마커프리 형질전환 벼를 선발하여 이를 기탁하였다.
In one embodiment of the present invention, a marker-free vector prepared by treating the pCAMBIA1300 vector with restriction enzymes XhoI and EcoRI to remove the hygromycin resistance gene (HPT) and then inserting the OsPT4 gene into the vector, The free vector and the empty vector were inoculated into the callus at a ratio of 3: 1 and cultured and regenerated. Then, 22 individuals in which the OsPT4 marker free vector was inserted by PCR and electrophoresis using the OsPT4 marker free vector specific primer were selected . As a result of continuing the selection of individuals through the progress of the next generation, OsPT4 marker-free transgenic rice plants with the best growth pattern were selected and deposited.

또 하나의 양태로서, 본 발명은 OsPT4 유전자가 도입되고 항생제 선발 마커가 제거된, 형질전환 벼를 제공한다.
In another aspect, the present invention provides transgenic rice plants in which the OsPT4 gene is introduced and antibiotic selection markers are removed.

상기 OsPT4 유전자, 항생제 선발 마커에 대하여는 상기에서 설명한 바와 같다.The OsPT4 gene and the antibiotic selection marker are as described above.

본 발명에서 용어, “형질전환”은 일반적으로 DNA를 숙주로 도입하여 DNA가 염색체외 인자로서 또는 염색체 통합완성에 의해 복제가능하게 되는 것을 의미할 수 있다. 상기 형질전환은 당 분야에서 공지된 바와 같이 숙주 세포에 따라 적합한 표준 기술을 선택하여 수행할 수 있으며, 바람직하게는 식물 병원균 아그로박테리움을 이용할 수 있으나, 이에 제한되는 것은 아니다. 상기 아그로박테리움은 그들의 Ti(종양 유도성, tumor-inducing) 또는 Ri(뿌리 유도성, root-inducing) 플라스미드 DNA 중 일부(T-DNA)를 감염된 식물 세포 내로 전이 이식시키는 능력을 지니고 있다. 따라서 목적 유전자를 T-DNA 내에 재조합한 후 이를 보유한 균과 식물체를 공동 배양하면 식물 세포의 형질전환이 가능해진다. The term " transformation " as used herein in the context of the present invention may generally refer to the introduction of DNA into a host, such that the DNA is replicable as an extrachromosomal element or by chromosomal integration. The transformation can be carried out by selecting a suitable standard technique depending on the host cell as known in the art, and preferably, a plant pathogen Agrobacterium can be used, but is not limited thereto. The Agrobacterium has the ability to transduce some of its Ti (tumor-inducing) or Ri (root-inducing) plasmid DNA (T-DNA) into infected plant cells. Therefore, when the target gene is recombined in T-DNA and co-cultured with the bacteria and the plant having the gene, the transformation of the plant cell becomes possible.

본 발명의 형질전환 벼는 벼 유래 고친화성 인산운반체인 OsPT4 유전자가 발현된 또는 발현될 수 있는 상태로 세포 내에 존재하는 벼의 형질전환 세포일 수 있다. 또한, 본 발명의 형질전환 벼는 상기 유전자가 도입된 형질전환세포를 포함한 벼의 식물체 전체 또는 일부 기관 등을 모두 포함할 수 있으며, 상기 유전자가 도입된 식물체의 유성생식 또는 무성생식에 의해 얻어질 수 있는 종자, 식물체 및 이의 조직이나 기관의 일부도 포함될 수 있다. 바람직하게는 본 발명의 형질전환 벼는 기탁번호 KACC98042P인 것인 형질전환 벼 또는 이의 종자일 수 있으나, 이에 제한되지 않는다.The transgenic rice of the present invention may be a transgenic rice cell in which the OsPT4 gene, which is a high-affinity phosphate transporter derived from rice, is expressed or can be expressed. In addition, the transgenic rice of the present invention may include all or part of rice plants including transgenic cells into which the gene is introduced, and may be obtained by ovarian reproduction or asexual reproduction of the plant into which the gene is introduced Seeds, plants and parts of tissues or organs thereof. Preferably, the transgenic rice of the present invention is the transgenic rice or its seed, which is the accession number KACC98042P, but is not limited thereto.

본 발명의 형질전환 벼는 OsPT4을 과발현시키는 것을 특징으로 할 수 있다. 상기 용어, “과발현”이란 폴리펩티드를 암호화하는 서열을 포함하는 유전자를 변형 세포 내에서 인공적으로 발현시켜 전구체 숙주 세포 내에서 동일한 폴리펩티드의 발현 수준을 넘어서는 암호화된 폴리펩티드의 발현의 수준을 생성하도록 하는 과정을 의미한다. 따라서, 본 발명의 형질전환 벼는 OsPT4 유전자가 형질전환 됨으로써, 상기 단백질을 암호화하는 유전자의 카피의 수를 증가되어 이를 과발현할 수 있다.The transgenic rice of the present invention may be characterized by overexpressing OsPT4. The term " over-expression " refers to the process of artificially expressing a gene comprising a sequence encoding a polypeptide in a modified cell to produce a level of expression of the encoded polypeptide that is above the expression level of the same polypeptide in the precursor host cell it means. Therefore, the transformed rice of the present invention can overexpress an OsPT4 gene by increasing the number of copies of the gene encoding the protein by transforming the OsPT4 gene.

바람직하게는, 본 발명의 형질전환 벼는 상기의 제조방법에 의해 제조된 것일 수 있으나, 이에 제한되지 않는다.
Preferably, the transgenic rice of the present invention may be one produced by the above-mentioned production method, but is not limited thereto.

본 발명의 형질전환 벼는 항생제 선발마커가 들어있지 않아 GM작물에 대한 소비자들의 안전성에 대한 우려를 경감하여 상업적인 활용이 타 형질전환 벼에 비해 우수하다. 또한, 본 발명에 사용된 OsPT4은 인산결핍시 벼에서 발현되는 고친화성 인산운반체로서, 상기 유전자의 과발현을 통해 식물이 필요로 하는 필수 영양소 중의 하나인 인산흡수를 증진시킴으로써 토양인산 이용성을 높일 수 있다.
Since the transgenic rice of the present invention does not contain an antibiotic selection marker, commercial use is superior to other transgenic rice by alleviating the concern about safety of consumers on GM crops. In addition, OsPT4 used in the present invention is a highly-phosphorylated phosphoric acid transporter expressed in rice when it is deficient in phosphoric acid. Thus, overexpression of the gene promotes the uptake of phosphoric acid, which is one of the essential nutrients required by plants, .

도 1은 pCAMBIA1300 형질전환용 벡터를 이용하여 벼 유래 인산 고친화성 OsPT4을 삽입하고, 항생제 선발마커(하이그로마이신저항성) 유전자를 제거하여 형질전환용 마커프리 벡터를 제작한 것을 나타낸 도이다. 도 1a는 pCAMBIA1300의 선발마커-프리 형질전환용 벡터를 나타낸 도이고, 도 1b는 pCAMBIA1300의 하이그로마이신 삽입 공벡터를 나타낸 도이다.
도 2는 캘러스가 치상된 재분화배지, 재분화 배지에서 캘러스를 재분화하는 모습, 재분화된 식물체가 성장하는 모습을 나타낸 사진이다.
도 3은 T0세대에서의 OsPT4 형질전환용 벡터의 삽입여부의 확인을 위한 전기영동 결과를 나타낸 것으로, 재분화식물체의 DNA를 추출하여 마커프리 벡터 특이적인 프라이머를 제작하였으며, PCR을 통하여 마커프리 벡터가 삽입된 식물체를 22개체 선발하였다.
도 4는 OsPT4 마커프리 벡터 삽입이 확인된 형질전환벼의 유효인산함량을 확인한 것이다.
도 5는 하이그로마이신 벡터 삽입 및 선발마커프리 벡터 삽입 확인용 PCR 결과 및 RT-PCR 결과를 나타낸 것으로, 선발된 식물체를 세대진전하여 개체 분리를 통하여 T4세대에서 항생제선발마커 유전자가 분리되고 마커프리 형질전환용 벡터만 삽입된 개체 7개체를 선발하였으며, 이들 개체에서 OsPT4유전자 발현량을 확인하였다.
Brief Description of the Drawings Fig. 1 is a diagram showing the preparation of a marker-free vector for transformation by inserting a high-affinity phosphate-derived OsPT4 derived from rice using pCAMBIA1300 transfection vector and removing an antibiotic selection marker (hygromycin resistance) gene. FIG. 1A is a diagram showing a selection marker-free transformation vector of pCAMBIA1300, and FIG. 1B is a diagram showing a hygromycin insertion vector of pCAMBIA1300.
Fig. 2 is a photograph showing regrowth of callus-regulated medium, regeneration of callus in regeneration medium, and growth of regenerated plant.
FIG. 3 shows the results of electrophoresis for confirming the insertion of the OsPT4 transfection vector in the T0 generation. The DNA of the regenerated plant was extracted to prepare a marker-free vector-specific primer. Twenty - two seedlings were selected.
FIG. 4 is a graph showing the effective acidity of transgenic rice in which OsPT4 marker-free vector insertion was confirmed.
FIG. 5 shows PCR results and RT-PCR results for hygromycin vector insertion and selection marker free vector insertion confirmation. Generation of the selected plants and isolation of the antibiotic selection marker gene from T4 generation, 7 transgenic individuals were selected, and OsPT4 gene expression levels were determined in these individuals.

이하, 하기 예에 의하여 본 발명을 보다 상세히 설명하고자 한다. 그러나, 하기 예는 본 발명을 예시하기 위한 것으로 이들만으로 본 발명의 범위가 한정되는 것은 아니다.
Hereinafter, the present invention will be described in more detail with reference to the following examples. However, the following examples are for illustrative purposes only and are not intended to limit the scope of the invention.

실시예Example 1:  One: 마커프리Marker-free 벡터 제작 Vector production

pCAMBIA1300벡터에 제한효소 XhoI과 EcoRI을 처리하여 하이그로마이신 저항성 유전자(HPT) 및 하이그로마이신 저항성 유전자의 발현을 위한 CaMV35S 프로모터까지 제거하였다. 이 후 DNA 엑소뉴클레아제(DNA exonuclease)를 처리하여 잘려진 벡터 양쪽 말단(N-terminal, C-terminal)부위에 각각 남아 있는 XhoI과 EcoRI 부위를 평활말단(blunt-end)으로 만든 후 양쪽 말단을 자가결합(self-ligation)시켜 마커프리 벡터를 제조하였다. 이후 상기 마커프리 벡터에 OsPT4 유전자를 제한효소 XbaI 위치에 맞게 삽입함으로써, 형질전환용 벡터를 제조하였다(도 1).
The pCAMBIA1300 vector was treated with restriction enzymes XhoI and EcoRI to remove the hygromycin resistance gene (HPT) and the CaMV35S promoter for expression of the hygromycin resistance gene. DNA exonuclease was then treated to blunt-end the XhoI and EcoRI sites remaining in the truncated vector (N-terminal, C-terminal) The marker-free vector was prepared by self-ligation. Then, the OsPT4 gene was inserted into the marker-free vector in accordance with the restriction enzyme XbaI site to prepare a transformation vector (FIG. 1).

실시예Example 2: 형질전환을 위한  2: for transformation 캘러스Callus 유도 Judo

형질전환에 사용되는 캘러스를 유도하기 위하여 캘러스 치상 배지(4.43 g/l MS salts with vitamins, 2 mg/ℓ 2,4-D, 2.872 g L-proline, 2 g/ℓ Casein hydrolysate, 30 g/ℓ sucrose 및 4 g/ℓ Gelite, 0.36 g KH2PO4, pH 5.8)를 제조하였다. 제조된 배지를 pH 5.8로 맞추어 고압 멸균 후 페트리 디쉬에 분주하여 건조 후 현미를 치상하였다. 현미를 치상 후 배양온도를 기존 25℃에서 32℃로 높여 1주일간 배양하였고 현미에서 유도된 캘러스를 새로운 캘러스 유도 배지에 치상하여 1주일간 배양하여 형질전환에 사용하였다.
In order to induce the calli used in the transformation, callus dental culture medium (4.43 g / l MS salts with vitamins, 2 mg / 2,4-D, 2.872 g L-proline, 2 g / ℓ Casein hydrolysate, 30 g / sucrose and 4 g / l Gelite, 0.36 g KH2PO4, pH 5.8). The prepared medium was adjusted to pH 5.8, sterilized by high pressure, and dispensed into a Petri dish. The culture temperature was increased from 25 ℃ to 32 ℃ after one week incubation for 1 week, and the calli induced from brown rice were placed on a new callus induction medium and cultured for 1 week for transformation.

실시예Example 3:  3: OsPT4OsPT4 마커프리Marker-free 벡터를 이용한 형질전환 Transformation using vectors

상기 실시예 1에 따라 제조한 형질전환용 벡터를 이용하여, 상기 실시예 2에 따라 제조된 캘러스를 이용하여 아그로박테리움-매개 공동형질전환법(Agrobacterium-mediated co-transformation)으로 형질전환 벼를 제조하고자 하였다.Using the transfection vector prepared according to Example 1, the transformed rice was transformed into Agrobacterium-mediated co-transformation using the calli prepared according to Example 2, Respectively.

형질전환용 OsPT4 마커프리 벡터가 들어있는 아그로박테리움과, 하이그로마이신 저항성 유전자 삽입 벡터가 들어있는 아그로박테리움을 각각 카나마이신 및 리팜피신 항생제가 포함된 YEP 액체배지에서 28℃에서 3일간 증식시켰다. 증식된 각 벡터를 원심분리하여 추출하여 OsPT4 마커프리 벡터의 아그로박테리움과 하이그로마이신 저항성 유전자 삽입 벡터 아그로박테리움의 농도를 3:1로 조절하여 형질전환에 이용하였다.Agrobacterium containing the OsPT4 marker-free vector for transformation and Agrobacterium containing the hygromycin resistance gene insertion vector were grown for 3 days at 28 DEG C in YEP liquid medium containing kanamycin and rifampicin antibiotics, respectively. Each proliferated vector was centrifuged and extracted, and the concentration of agrobacterium and hygromycin resistance gene insertion vector agrobacterium in OsPT4 marker free vector was adjusted to 3: 1 and used for transformation.

제조된 형질전환용 벡터 삽입 균을 100 μM 아세토실링곤이 포함된 부유배지(suspension medium, 4.43 g/ℓ MS salts with vitamins, 2 mg/ℓ 2,4-D, 0.5 g/ℓ casamino acid, 65.8 g/ℓ sucrose 및 36 g/ℓ glucose, pH 5.7)에 희석하여 OsPT4 마커프리 벡터의 아그로박테리움과 하이그로마이신 저항성 유전자 삽입 벡터 아그로박테리움의 농도가 3:1로 조절된 혼합 균의 농도를 0.01(OD600=0.01)로 만들어 캘러스를 혼합하였다. The transfection vector was cultured in a suspension medium containing 100 μM acetosiloxane (4.43 g / ℓ MS salts with vitamins, 2 mg / 2,4-D, 0.5 g / ℓ casamino acid, 65.8 g / l sucrose and 36 g / l glucose, pH 5.7), and the concentration of the mixed microorganism in which the concentration of agrobacterium and hygromycin resistance gene insertion vector agrobacterium in the OsPT4 marker free vector was adjusted to 3: 1 was 0.01 (OD600 = 0.01) and mixed with callus.

아그로박테리움균이 혼합된 부유 배지(suspension medium)에 캘러스를 넣고 20분간 접종 뒤 공동배양배지(4.43 g/ℓ MS salts with vitamins, 2 mg/ℓ 2,4-D, 0.5 g/ℓ L-proline, 30 g/ℓ sucrose, 10 g/ℓ glucose, 0.5 g/ℓ MES 및 2.5 g/ℓ phytogel, pH 5.7 with 100 μM 아세토실링곤)에 치상 후 3일간 25℃에서 배양하였다. After incubation for 20 minutes with calli in a suspension medium containing Agrobacterium sp., The cells were incubated in a co-culture medium (4.43 g / l MS salts with vitamins, 2 mg / l 2,4-D, 0.5 g / proline, 30 g / l sucrose, 10 g / l glucose, 0.5 g / l MES and 2.5 g / l phytogel, pH 5.7 with 100 μM acetosiloxane) for 3 days at 25 ° C.

공동배양배지에 치상하고 3일 후, 캘러스를 선발배지(4.43 g/ℓ MS salts with vitamins, 2 mg/ℓ 2,4-D, 0.5 g/ℓ L-proline, 30 g/ℓ sucrose, 10 g/ℓ glucose, 0.5 g/ℓ MES 및 2.5 g/ℓ phytogel, pH 5.7, 50mg HPT)에 치상하여 25℃에서 3주간 배양 뒤 정상적인 생장을 하는 캘러스를 재분화 배지Ⅰ(4.43 g/ℓ MS salts with vitamins, 2 mg/ℓ 2,4-D, 0.5 g/ℓ L-proline, 30 g/ℓ sucrose, 10 g/ℓ glucose, 0.5 g/ℓ MES, 30 g D-Sorbitol 및 2.5 g/ℓ phytogel, pH 5.7, 50 mg HPT, 0.1 ㎖/ℓ NAA, 1 ㎖/ℓ kinetin)에 1주간 배양 후, 타 영양성분은 재분화 배지Ⅰ과 같고 생장호르몬인 NAA과 kinetin의 함량을 조절한 재분화 배지 Ⅱ(10 ㎕/ℓ NAA, 3 ㎖/ℓ kinetin)에 2주 이상 배양하여 재분화된 식물체를 MS배지로 이식하여 형질전환 식물체 100개체를 확보하였다(도 2).
After 3 days from the co-culture medium, the callus was added to the selection medium (4.43 g / l MS salts with vitamins, 2 mg / l 2,4-D, 0.5 g / l L-proline, 30 g / / mL glucose, 0.5 g / L MES and 2.5 g / L phytogel, pH 5.7, 50 mg HPT) and cultured at 25 ° C for 3 weeks. The normal callus was grown in regeneration medium I (4.43 g / ℓ MS salts with vitamins , 2 g / l 2,4-D, 0.5 g / l L-proline, 30 g / l sucrose, 10 g / l glucose, 0.5 g / l MES, 30 g D-sorbitol and 2.5 g / l phytogel, pH 5.7, 50 mg HPT, 0.1 ml / ℓ NAA, 1 ml / ℓ kinetin), and the other nutrients were the same as the regeneration medium I, and the regeneration medium II (10 μl / l NAA, 3 ml / l kinetin) for more than 2 weeks to transplant the regenerated plant into MS medium to obtain 100 transgenic plants (Fig. 2).

실시예Example 4: 형질전환 벼( 4: Transgenic rice ( T0T0 )의 선발) Selection

상기 실시예 3을 통해 확보된 형질전환 식물체의 하이그로마이신 유전자 삽입 벡터 및 OsPT4 마커프리 벡터의 삽입 여부를 확인하기 위하여 하기 표 1에 나타낸 OsPT4 마커프리 벡터 특이적인 프라이머(OsPT4 Vector F, OsPT4 Vector R)를 제작하였다. In order to confirm the insertion of the hygromycin gene insertion vector and the OsPT4 marker free vector of the transgenic plants obtained in Example 3, OsPT4 marker vector-specific primers (OsPT4 Vector F, OsPT4 Vector R ).

OsPT4 Vector FOsPT4 Vector F CCTCTTCTCGCGCCAGTTCCTG
(서열번호 1)
CCTCTTCTCGCGCCAGTTCCTG
(SEQ ID NO: 1)

OsPT4 마커프리 벡터 삽입 확인용

OsPT4 Marker Free Vector Insertion Confirmation
OsPT4 Vector ROsPT4 Vector R GAAACCGGCGGTAAGGATC
(서열번호 2)
GAAACCGGCGGTAAGGATC
(SEQ ID NO: 2)

확보한 식물체를 변형된 CTAB DNA 추출방법(Modified CTAB DNA Method)[Lee et al. 2008 JSCS. 40(3):286-290]에 따라 형질전환 벼에서 DNA를 추출하였다.The modified CTAB DNA extraction method (Lee et al. 2008 JSCS. 40 (3): 286-290).

잎 0.2 g을 막자사발에 넣고 액체질소를 이용하여 파쇄한 후 퀵프랩 버퍼(200 mM Tris-HCl, 250 mM NaCl, 25 mM EDTA, 0.5% SDS) 1.5 ㎖과 함께 튜브에 넣은 후, 60 ℃에 1시간 반응시켰다. 10,000 X g에서 10분 원심분리하여 상층액 400 ㎕를 새 튜브에 넣고, 이소프로판올(isopropanol) 300 ㎕를 첨가 후 잘 섞은 후 -80 ℃에서 30분 반응시켰다. 20,000 X g에서 10분 원심분리하여 상층액을 제거하고, 70% 에탄올을 넣고 가볍게 씻어준 후 30분 건조시켰다. DNA 추출버퍼(10 mM NH4OAC, 0.25 mM EDTA) 150 ㎕를 첨가 후 잘 섞어주었다. 60 ℃에서 1 시간 반응 후 10,000 X g에서 10분 원심분리하여 상층액 100 ㎕를 새 튜브에 넣었다. 이렇게 추출한 DNA를 이용하여 제작한 프라이머를 이용하여 다음의 PCR조건으로 PCR을 수행하였다. (0.2 g) was placed in a mortar and disrupted with liquid nitrogen, and then placed in a tube together with 1.5 ml of QuickPrep buffer (200 mM Tris-HCl, 250 mM NaCl, 25 mM EDTA, 0.5% SDS) And reacted for 1 hour. After centrifugation at 10,000 × g for 10 minutes, 400 μl of the supernatant was added to a new tube, 300 μl of isopropanol was added, mixed well, and reacted at -80 ° C. for 30 minutes. The supernatant was removed by centrifugation at 20,000 x g for 10 minutes, and 70% ethanol was added thereto, followed by gently rinsing, followed by drying for 30 minutes. 150 μl of DNA extraction buffer (10 mM NH4OAC, 0.25 mM EDTA) was added and mixed well. After reacting at 60 ° C for 1 hour, the mixture was centrifuged at 10,000 × g for 10 minutes, and 100 μl of the supernatant was placed in a new tube. PCR was performed using the primers prepared using the DNA thus extracted under the following PCR conditions.

PCR 프라이머로 상기 표 1의 프라이머 세트를 사용하고, 3'-5' 엑소 뉴클레아제 활성이 없는 Taq 중합효소를 사용하여 94 ℃ 30초, 56.5 ℃ 30초, 72 ℃ 30초의 조건으로 PCR 증폭을 수행하였다.The primer set of Table 1 was used as the PCR primer, and PCR amplification was carried out using Taq polymerase without 3'-5 'exonuclease activity at 94 ° C for 30 seconds, 56.5 ° C for 30 seconds, and 72 ° C for 30 seconds Respectively.

PCR 반응 방법으로 DNA는 각 50 ng을 사용하였으며, SSR(Simple Sequence Repeat) 마커 프라이머쌍은 각각 10 pmol를 사용하였으며, PCR 증폭에 관련하여 폴리머라제 및 PCR 완충액이 혼합되어 있는 Premix(Cat. No. G2002, (주) 제넷바이오)를 사용하여 PCR을 수행하였다.PCR was performed using 50 ng of each DNA, 10 pmol of SSR (Simple Sequence Repeat) marker primer pairs, and 5 μl of Premix (Cat. G2002, Genet Bio Inc.).

PCR 증폭 조건으로는 추출된 각 계통의 50 ng의 게놈 DNA를 이용하여 30 ㎕ 의 부피 (100 pM의 각 프라이머, 200 μM 각각의 dNTPs, 10 mM Tris-HCl pH 9.0, 2 mM MgCl2, 50 mM KCl, 0.1% Triton X-100 및 0.5 U Taq 중합효소) 조건에서 94.5 ℃, 5 분, 94 ℃ 30 초, 55 ℃ 30 초, 72 ℃ 1 분, 40 번 반복 반응한 후 마지막으로 72 ℃에서 10 분간 반응한 후 증폭하였다.As PCR amplification conditions, 50 ng of genomic DNA of each strain was used and 30 μl volume (100 pM of each primer, 200 μM of each dNTPs, 10 mM Tris-HCl pH 9.0, 2 mM MgCl 2, 50 mM KCl , 94 ° C for 5 minutes, 94 ° C for 30 seconds, 55 ° C for 30 seconds, 72 ° C for 1 minute, 40 times in the condition of 0.1% Triton X-100 and 0.5 U Taq polymerase) And then amplified.

PCR 증폭 후, 상기 서열번호 1 및 서열번호 2의 프라이머 세트를 사용하여 증폭한 증폭산물은 1 %의 아가로즈 겔(EtBr 0.5 ㎍/㎖ 함유) 상에서 UV로 확인하여 OsPT4 마커프리 벡터가 삽입된 개체 총 22개체를 선발하였다(도 3).
After the PCR amplification, the amplification product amplified using the primer set of SEQ ID NO: 1 and SEQ ID NO: 2 was confirmed by UV on 1% agarose gel (containing EtBr 0.5 g / ml) and the OsPT4 marker- A total of 22 individuals were selected (Fig. 3).

이렇게 선별된 형질전환 벼의 유효인산함량을 측정하기 위해 식물체 잎을 채취하여 액체질소에 얼린 후 사발을 이용해 가루화 하였다. 각 시료가루 0.5g을 취하여 튜브에 넣은 뒤 10% Perchloric acid solution을 1ml 넣어 잘 섞어 주었다. 9ml의 5% Perchloric acid solution을 첨가하여 10배로 희석한 뒤 다시 잘 섞어 얼음에 30분간 처리하였다. 원심분리기를 이용해 4℃에서 12000rpm 속도로 10분간 원심분리하여 상등액 50ul을 2ml 튜브에 담은 뒤 발색시약 500ml, 증류수 450ul을 추가하여 섞은 뒤 40℃에서 20분간 반응 후 820nm의 파장으로 흡광도를 측정하였다. 발색시약으로는 0.4% (w/v) ammonium molybdate와 10% Ascorbic acid가 6:1의 비율로 사용되었다. In order to measure the effective acid content of selected transgenic rice plants, plant leaves were harvested, frozen in liquid nitrogen, and ground using a bowl. 0.5 g of each sample powder was put into a tube and mixed with 1 ml of 10% Perchloric acid solution. 9 ml of 5% perchloric acid solution was added to dilute 10-fold, and then mixed again for 30 minutes on ice. The mixture was centrifuged at 4,000 rpm at 12,000 rpm for 10 minutes, and 50 ul of the supernatant was added to a 2 ml tube. Then, 500 ml of a coloring reagent and 450 ul of distilled water were added thereto, followed by reaction at 40 ° C for 20 minutes and then absorbance at 820 nm. 0.4% (w / v) ammonium molybdate and 10% ascorbic acid were used as coloring reagents in a ratio of 6: 1.

그 결과, 인산흡수 증진으로 인하여, 동진벼에 비하여, OsPT4 마커프리 벡터가 삽입된 형질전환벼에서, 유효인산함량이 현저히 증가함을 확인하였다(도 4).
As a result, it was confirmed that the effective phosphorus acid content was significantly increased in transgenic rice plants in which the OsPT4 marker free vector was inserted compared with Dongjin rice due to the increase in phosphoric acid uptake (FIG. 4).

실시예Example 5: 항생제  5: Antibiotics 선발마커Selection Marker 프리free 형질전환 벼( Transgenic rice ( T4T4 )의 선발) Selection

선발된 OsPT4 마커프리 벡터 삽입 벼를 온실에 이앙하여 종자를 수확하였다. 수확된 종자(T4)를 포장에 이앙하였고, 이앙개체에서 상기 실시예 4와 같은 방법으로 DNA를 추출하여 하이그로마이신 유전자 특이적인 프라이머를 제작하여(표 2), 이 유전자의 삽입 여부를 PCR을 통해 확인하였다. 그 결과 하이그로마이신이 제거된 7개체를 선발하였다(도 5).The OsPT4 marker free vector inserted rice seeds were harvested by transferring to the greenhouse. The harvested seeds (T4) were transferred to a packaging and DNAs were extracted from the transgenic individuals in the same manner as in Example 4 to prepare hygromycin gene-specific primers (Table 2) Respectively. As a result, seven hygromycin-deleted individuals were selected (Fig. 5).

HPT FHPT F CCCATTCGGACCGCAAGGA
(서열번호 3)
CCCATTCGGACCGCAAGGA
(SEQ ID NO: 3)

하이그로마이신 삽입 벡터 확인용

For identification of hygromycin insertion vector
HPT RHPT R CGCTTCTGCGGGCGATTT
(서열번호 4)
CGCTTCTGCGGGCGATTT
(SEQ ID NO: 4)

실시예Example 6: 항생제  6: Antibiotics 선발마커Selection Marker 프리free 형질전환 벼( Transgenic rice ( T4T4 )의 유전자 고정세대 선발) Generation of Genetically Modified Generation

실시예 5와 같이 선발된 개체의 종자를 수확하여 동계온실에 이앙하여 T4 개체를 확보하였다. 이들 개체들의 유전자 고정상태를 확인하기 위하여 DNA를 추출한 후, OsPT4 마커프리 벡터 특이적인 프라이머(OsPT4 Vector F, OsPT4 Vector R)를 이용하여 PCR을 수행한 결과 유전자 고정계통 3계통을 선발하였다. 이 중 식물체 생육양상이 가장 우수한 1계통을 선발하였고, 이를 농업유전자원센터에 2014년 11월 7일자로 기탁하였다(기탁번호: KACC98042P)
The seeds of the selected individuals were harvested as in Example 5 and transferred to the winter greenhouse to obtain T4 individuals. To confirm the gene fixation status of these individuals, DNA was extracted and PCR was performed using OsPT4 marker-free vector specific primers (OsPT4 Vector F, OsPT4 Vector R), and three strains of gene fixing system were selected. Among them, 1 line with the best plant growth pattern was selected and deposited on November 7, 2014 (Accession No .: KACC98042P)

이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며, 한정적인 것이 아닌 것으로서 이해하여야 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허청구범위의 의미 및 범위 그리고 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.
From the above description, it will be understood by those skilled in the art that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. In this regard, it should be understood that the above-described embodiments are illustrative in all aspects and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention without departing from the spirit or scope of the present invention as defined by the appended claims.

국립농업과학원 농업유전자원센터National Institute of Agricultural Science KACC98042PKACC98042P 2014110720141107

<110> REPUBLIC OF KOREA(MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION) <120> Antibiotic marker-free transgenic rice with over-expressed high affinity phosphate transporter OsPT4 gene from Oryza sativa <130> KPA141083KR <160> 5 <170> KopatentIn 2.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> OsPT4 Vector reverse primer <400> 1 cctcttctcg cgccagttcc tg 22 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> OsPT4 Vector reverse primer <400> 2 gaaaccggcg gtaaggatc 19 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> HPT forward primer <400> 3 cccattcgga ccgcaagga 19 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> HPT reverse primer <400> 4 cgcttctgcg ggcgattt 18 <210> 5 <211> 1901 <212> DNA <213> Oryza sativa (japonica cultivar-group) phosphate transporter 4 mRNA, complete cds <400> 5 atggcgggag ggcagctcaa cgtgctgagc acgcgcgacc aggcgaagac gcaatggtac 60 cacttcatgg cgatcgtcat cgccggcatg ggcttcttca ccgacgccta cgacctcttc 120 tgcatttccc tcgtcaccaa gctgctcggc cgcatctact acaccgacga ttccaaggac 180 acccccggcg cgctcccgcc caacgtgtcg gccgccgtca ccggcgtcgc gctctgcggc 240 acgctcgccg gccagctttt cttcggatgg ctcggcgaca agctcggacg caagagcgtg 300 tatggtttca cgctgattct gatggtcgtg tgctcggtcg cgtccgggct ctcgttcggg 360 agctcggcca agggcgtcgt gtctacgctc tgcttcttcc ggttctggct cggcttcggc 420 atcggcggcg actacccgct cagcgccacc atcatgtcgg agtacgcgaa caagaggacg 480 cgcggggcct tcatcgccgc cgtgttcgcc atgcaggggt tcgggatcct cttcggcgcc 540 atcgtcgcgc tcgcggtgtc ggcggggttc cggcacgcgt acccggcgcc gtcctactcc 600 gacaaccacg ccgcgtcgct cgtcccgcag gccgactacg tgtggcgcat catcctcatg 660 ttcggcaccg tcccggcggc gctcacctac tactggcgga tgaagatgcc cgagacggcg 720 cggtacacgg cgctcatcgc ccgcaacgcg aagcaggcgg cggccgacat gtccaaggtg 780 ctgcacaccc agattgagga gagcgcggac cgcgccgaga cggtggccgt cggcggcgag 840 agctggggcc tcttctcgcg ccagttcctg cgccgccacg gcctccacct cctcgccacc 900 accagcacgt ggttcctcct cgacatcgcc ttctacagcc agaacctgtt ccagaaggac 960 atcttcagca aggtcgggtg gatcccgccg gcgaagacca tgaacgcgct cgaggagctc 1020 taccgcatcg cccgcgccca ggcgctcatc gcgctctgcg gcaccatccc gggctactgg 1080 ttcaccgtcg cattcatcga gatcatgggc aggttctgga tccagatcat gggcttcgcc 1140 atgatgacgg cgttcatgct cggcctcgcc atcccgtacc accactggac gacgccgggg 1200 caccacaccg gcttcatcgt catgtacgga ttcaccttct tcttcgcgaa cttcgggcca 1260 aacagcacca ccttcatcgt gccggcggag atatacccgg cgcggctccg gtcgacgtgc 1320 cacggcatct ccgccgccgc cgggaaggcc ggcgccatca tcggagcgtt cgggttcctg 1380 tacgcggcgc aggaccagca caagcccgag cctgggtacc ccagggggat cggcatcaag 1440 aacgcgctct tcgtgctcgc cggcacaaac ttcctcggga cgatcatgac gctgctcgtg 1500 ccggagtcca agggcacgtc gctcgaggtt atctcgcagg aggtcgccga cggcgacgac 1560 gaggaggcgg cctacccgaa gtaatttgac cgcgcgcgtg atcacgcagg gagtggttgc 1620 cgctaaccat tggtgtcatt ttttttcccc actgtaacaa ctctagtcgt cgcttccgga 1680 cgagtgggag tttttttttt tttttggata agttgtagaa atttcaatta gtgactagtt 1740 tgtaggaaat gtgagtgaaa tgtgggtata tgttctttaa aaattggtga acttttccct 1800 ggatttgaaa aaaccgtgta gttttaaaaa aaaatgccat ggatactagt agttcaggaa 1860 aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa a 1901 <110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Antibiotic marker-free transgenic rice with over-expressed high          affinity phosphate transporter OsPT4 gene from Oryza sativa <130> KPA141083KR <160> 5 <170> Kopatentin 2.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> OsPT4 Vector reverse primer <400> 1 cctcttctcg cgccagttcc tg 22 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> OsPT4 Vector reverse primer <400> 2 gaaaccggcg gtaaggatc 19 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> HPT forward primer <400> 3 cccattcgga ccgcaagga 19 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> HPT reverse primer <400> 4 cgcttctgcg ggcgattt 18 <210> 5 <211> 1901 <212> DNA <213> Oryza sativa (japonica cultivar-group) phosphate transporter 4 mRNA, complete cds <400> 5 atggcgggag ggcagctcaa cgtgctgagc acgcgcgacc aggcgaagac gcaatggtac 60 cacttcatgg cgatcgtcat cgccggcatg ggcttcttca ccgacgccta cgacctcttc 120 tgcatttccc tcgtcaccaa gctgctcggc cgcatctact acaccgacga ttccaaggac 180 cccgccgtc acgctcgccg gccagctttt cttcggatgg ctcggcgaca agctcggacg caagagcgtg 300 tatggtttca cgctgattct gatggtcgtg tgctcggtcg cgtccgggct ctcgttcggg 360 gt; atcggcggcg actacccgct cagcgccacc atcatgtcgg agtacgcgaa caagaggacg 480 cgcggggcct tcatcgccgc cgtgttcgcc atgcaggggt tcgggatcct cttcggcgcc 540 atcgtcgcgc tcgcggtgtc ggcggggttc cggcacgcgt acccggcgcc gtcctactcc 600 gacaaccacg ccgcgtcgct cgtcccgcag gccgactacg tgtggcgcat catcctcatg 660 ttcggcaccg tcccggcggc gctcacctac tactggcgga tgaagatgcc cgagacggcg 720 cggtacacgg cgctcatcgc ccgcaacgcg aagcaggcgg cggccgacat gtccaaggtg 780 ctgcacaccc agattgagga gagcgcggac cgcgccgaga cggtggccgt cggcggcgag 840 agctggggcc tcttctcgcg ccagttcctg cgccgccacg gcctccacct cctcgccacc 900 accagcacgt ggttcctcct cgacatcgcc ttctacagcc agaacctgtt ccagaaggac 960 atcttcagca aggtcgggtg gatcccgccg gcgaagacca tgaacgcgct cgaggagctc 1020 taccgcatcg cccgcgccca ggcgctcatc gcgctctgcg gcaccatccc gggctactgg 1080 ttcaccgtcg cattcatcga gatcatgggc aggttctgga tccagatcat gggcttcgcc 1140 atgatgacgg cgttcatgct cggcctcgcc atcccgtacc accactggac gacgccgggg 1200 caccacaccg gcttcatcgt catgtacgga ttcaccttct tcttcgcgaa cttcgggcca 1260 aacagcacca ccttcatcgt gccggcggag atatacccgg cgcggctccg gtcgacgtgc 1320 cacggcatct ccgccgccgc cgggaaggcc ggcgccatca tcggagcgtt cgggttcctg 1380 tacgcggcgc aggaccagca caagcccgag cctgggtacc ccagggggat cggcatcaag 1440 aacgcgctct tcgtgctcgc cggcacaaac ttcctcggga cgatcatgac gctgctcgtg 1500 ccggagtcca agggcacgtc gctcgaggtt atctcgcagg aggtcgccga cggcgacgac 1560 gaggaggcgg cctacccgaa gtaatttgac cgcgcgcgtg atcacgcagg gagtggttgc 1620 cgctaaccat tggtgtcatt ttttttcccc actgtaacaa ctctagtcgt cgcttccgga 1680 cgagtgggag tttttttttt tttttggata agttgtagaa atttcaatta gtgactagtt 1740 tgtaggaaat gtgagtgaaa tgtgggtata tgttctttaa aaattggtga acttttccct 1800 ggatttgaaa aaaccgtgta gttttaaaaa aaaatgccat ggatactagt agttcaggaa 1860 aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa a 1901

Claims (11)

삭제delete 삭제delete 삭제delete 삭제delete 서열번호 5의 염기서열로 구성된 OsPT4(Oryza sativa putative phosphate transporter) 유전자가 도입되고 항생제 선발 마커가 제거된, 기탁번호 KACC98042P로 기탁된 형질전환 벼.
Transgenic rice deposited with Accession No. KACC98042P, in which OsPT4 (Oryza sativa putative phosphate transporter) gene consisting of the nucleotide sequence of SEQ ID NO: 5 was introduced and the antibiotic selection marker was removed.
삭제delete 제5항에 있어서,
상기 형질전환 벼는 (a) 인산을 포함하는 MS(Murashige-Skoog) 배지에 현미를 치상하여 30 내지 35℃에서 배양하여 캘러스를 유도하는 단계; (b) 서열번호 5의 염기서열로 구성된 OsPT4 유전자를 포함하는 마커프리 벡터가 도입된 아그로박테리움 및 항생제 저항성 유전자를 포함하는 벡터가 도입된 아그로박테리움을 2.5:1 내지 3.5:1의 비율로 캘러스에 접종시켜 배양하는 단계; (c) 상기 (b) 단계의 배양된 캘러스로부터 재분화 벼 식물체를 유도하는 단계; 및 (d) 상기 유도된 재분화 식물체로부터 OsPT4 유전자가 도입되고, 항생제 저항성 유전자를 포함하지 않는 형질전환 벼를 선별하는 단계를 포함하는 방법으로 제조된 것인 형질전환 벼.
6. The method of claim 5,
(A) inducing callus by culturing in a medium of MS (Murashige-Skoog) containing phosphoric acid at 30 to 35 占 폚 against brown rice; (b) Agrobacterium into which a marker-free vector containing OsPT4 gene consisting of the nucleotide sequence of SEQ ID NO: 5 is introduced and Agrobacterium containing a vector containing an antibiotic resistance gene in a ratio of 2.5: 1 to 3.5: 1 Culturing in a callus; (c) deriving regenerated rice plants from the cultured callus of step (b); And (d) selecting transgenic rice plants to which the OsPT4 gene is introduced from the derived regenerated plant and which does not contain an antibiotic resistance gene.
(a) 인산을 포함하는 MS(Murashige-Skoog) 배지에 현미를 치상하여 30 내지 35℃에서 배양하여 캘러스를 유도하는 단계;
(b) 서열번호 5의 염기서열로 구성된 OsPT4 유전자를 포함하는 마커프리 벡터가 도입된 아그로박테리움 및 항생제 저항성 유전자를 포함하는 벡터가 도입된 아그로박테리움을 2.5:1 내지 3.5:1의 비율로 캘러스에 접종시켜 배양하는 단계;
(c) 상기 (b) 단계의 배양된 캘러스로부터 재분화 벼 식물체를 유도하는 단계; 및
(d) 상기 유도된 재분화 식물체로부터 서열번호 5의 염기서열로 구성된 OsPT4 유전자가 도입되고, 항생제 저항성 유전자를 포함하지 않는 형질전환 벼를 선별하는 단계를 포함하는,
제5항의 형질전환 벼의 제조 방법.
(a) inducing calli by culturing at 30 to 35 占 폚 against brown rice in a MS (Murashige-Skoog) medium containing phosphoric acid;
(b) Agrobacterium into which a marker-free vector containing OsPT4 gene consisting of the nucleotide sequence of SEQ ID NO: 5 is introduced and Agrobacterium containing a vector containing an antibiotic resistance gene in a ratio of 2.5: 1 to 3.5: 1 Culturing in a callus;
(c) deriving regenerated rice plants from the cultured callus of step (b); And
(d) selecting OsPT4 gene consisting of the nucleotide sequence of SEQ ID NO: 5 from the induced regenerated plant and transgenic rice not containing an antibiotic resistance gene.
The method for producing transgenic rice of claim 5.
제8항에 있어서,
상기 현미는 동진벼 품종인 것인 방법.
9. The method of claim 8,
Wherein the brown rice is a Dongjinbee variety.
제8항에 있어서,
상기 (a) 단계의 MS 배지에 포함된 인산은 3.0 내지 4.0 %(w/v) 농도인 것인 방법.
9. The method of claim 8,
Wherein the phosphoric acid contained in the MS medium of step (a) is in a concentration of 3.0 to 4.0% (w / v).
제8항에 있어서,
상기 (b) 단계에 사용된 캘러스는 배양한 지 2 내지 3주의 것인 방법.


9. The method of claim 8,
Wherein the callus used in step (b) is 2 to 3 weeks old.


KR1020140160405A 2014-11-17 2014-11-17 Antibiotic marker-free transgenic rice with over-expressed high affinity phosphate transporter OsPT4 gene from Oryza sativa KR101677482B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020140160405A KR101677482B1 (en) 2014-11-17 2014-11-17 Antibiotic marker-free transgenic rice with over-expressed high affinity phosphate transporter OsPT4 gene from Oryza sativa

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020140160405A KR101677482B1 (en) 2014-11-17 2014-11-17 Antibiotic marker-free transgenic rice with over-expressed high affinity phosphate transporter OsPT4 gene from Oryza sativa

Publications (2)

Publication Number Publication Date
KR20160059103A KR20160059103A (en) 2016-05-26
KR101677482B1 true KR101677482B1 (en) 2016-11-21

Family

ID=56104536

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020140160405A KR101677482B1 (en) 2014-11-17 2014-11-17 Antibiotic marker-free transgenic rice with over-expressed high affinity phosphate transporter OsPT4 gene from Oryza sativa

Country Status (1)

Country Link
KR (1) KR101677482B1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115976042A (en) * 2022-09-28 2023-04-18 上海市农业科学院 Phosphorus efficient gene applied to rice and germplasm cultivation of rice

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100742192B1 (en) * 2004-09-10 2007-07-25 재단법인서울대학교산학협력재단 Method for plastid transformation in plants
KR20100053456A (en) * 2008-11-11 2010-05-20 동국대학교 산학협력단 A method for producing transformed rice plant removed selection marker

Also Published As

Publication number Publication date
KR20160059103A (en) 2016-05-26

Similar Documents

Publication Publication Date Title
CN107435047B (en) Low-phosphorus-resistant key gene GmPHR25 in plant phosphorus signal network and application thereof
CN116004657B (en) Musa paradisiaca maturation-related gene MbGRF1 and application thereof
CN110734482A (en) Lilium regale WRKY transcription factor gene LrWRKY4 and application thereof
CN110872598A (en) Cotton drought-resistant related gene GhDT1 and application thereof
CN116042698A (en) Method for establishing rapid and efficient alfalfa hairy root transformation system
KR101677482B1 (en) Antibiotic marker-free transgenic rice with over-expressed high affinity phosphate transporter OsPT4 gene from Oryza sativa
CN116083445A (en) CrBZR1 gene and application thereof
KR101602883B1 (en) Antibiotic marker-free transgenic rice with over-expressed high affinity phosphate transporter OsPT7 gene from Oryza sativa
KR101677483B1 (en) Antibiotic marker-free transgenic rice with over-expressed of OsNAS3 gene from Oryza sativa enhancing content of seed inorganic compounds
CN109897865B (en) Method for increasing iron content in plant tissue
CN115197951A (en) Tea tree flavonol synthesis candidate gene CsNAC086 and application thereof
KR101161276B1 (en) Vascular tissue-specific promoter and expression vector comprising the same
CN104805100A (en) Application of paddy rice gene OsS[mu]BP-2 in delaying plant leaf senescence
CN114149993B (en) lncRNA for regulating and controlling content of soluble sugar in plants and application thereof
KR101198648B1 (en) Method for transforming Cucumis sativus line through direct shoot induction and Cucumis sativus line transformant produced by the same
KR101965971B1 (en) Phosphate starvation inducible promoter and use thereof
CN110499326B (en) Application of RGGA in regulation of agronomic traits of crops
CN111454987B (en) Application of GhNAC091 gene in improving plant photosynthesis efficiency and strong light tolerance
KR102081963B1 (en) Promoter specific for plant seed embryo and uses thereof
KR100496028B1 (en) A Method for Producing Herbicide-Resistant Chili Pepper Plant
JPWO2004058975A1 (en) Methods to increase environmental stress tolerance of plants
CN116179574A (en) Application of CmEAF7 gene in improving cold resistance and/or fruit quality of muskmelon
CN111549164A (en) Molecular marker of tomato environmental phosphorus deficiency related gene and application thereof
KR100965422B1 (en) Stress-Resistant Plants Transformed with AP2 Apetala 2 Domain-Containing Genes
CN117625683A (en) Application of FvJAZ8 gene in regulation and control of strawberry stolons

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant