CN109055392A

CN109055392A - State's orchid allelotaxis controlling gene and its coding albumen and application

Info

Publication number: CN109055392A
Application number: CN201810866392.8A
Authority: CN
Inventors: 杨凤玺; 朱根发; 魏永路; 陆楚桥; 彭玲愿
Original assignee: Environmental Horticulture Institute of Guangdong Academy of Agricultural Sciences
Current assignee: Environmental Horticulture Institute of Guangdong Academy of Agricultural Sciences
Priority date: 2018-08-01
Filing date: 2018-08-01
Publication date: 2018-12-21
Anticipated expiration: 2038-08-01
Also published as: CN109055392B

Abstract

The invention discloses a kind of state orchid allelotaxis controlling gene and its coding albumen and applications.State's orchid allelotaxis's controlling gene be it is isolated from the floral organ cDNA of the Cymbidium sinense Cultivars " Bodhidharma " (Cymbidium sinense) of Chinese cymbidium, nucleotide sequence is as shown in SEQ ID NO:1；The amino acid sequence of state's orchid allelotaxis's modulin is as shown in SEQ ID NO:2.The present invention is had found by technique for gene engineering, state orchid allelotaxis controlling gene overexpression in arabidopsis and orchid, plant flower pattern can be changed, petal is caused to crimp, orchid petal changes to lip, and lip character is reinforced, therefore, the albumen of the gene and its coding can be used for the research of orchid development of floral organs regulatory pathway and the improvement of flowering of plant character flower valve type.

Description

State's orchid allelotaxis controlling gene and its coding albumen and application

Technical field

The present invention relates to field of plant genetic project technology, and in particular to state's orchid allelotaxis controlling gene and its coding Albumen and application.

Background technique

Orchid possess eggcase floral organ and bio-diversity abundant, be precious gardening ornamental flower. The whole world has found more than 801 categories 30,000, can be divided into Terrestrial orchid, aerial orchid, saprophytic blue three categories by ecological habit.Wherein Cymbidium Ground non-hibernating eggs is mostly originating in China, therefore also known as state is blue, is listed in one of the 10 famous flowers of China, mainly includes sword-leaved cymbidium, Chinese cymbidium, spring The 8 big types such as orchid, orchid, Cymbidium lianpan, bean cotyledon orchid, cold orchid and spring sword, have very high economic value.Molecular biology of plants research It was found that the 1st wheel floral organ of B class MADS-box gene expression zone broadening exhibition, is that most monocotyledons the 1st, 2 is caused to take turns floral organ Official develops into the molecular basis of similar perianth chip architecture.However orchid and some other monocotyledon such as lily (Lilium Brownii), the differences such as tulip (Tulipa gesneriana), Afriocan agapanthus (Agapanthus praecox), outermost layer three A calyx is commonly divided into raw (lateral) calyx of a back side (dorsal) and two sides, and shape is close, and three flowers of internal layer Valve is divided into the lip (lip or labellum) of the raw petal in two sides and the curling of another specialization.Mondragon-Palomino Deng (2011) by coming into leaves the research of pocket orchid to iris, vanilla and America, development of floral organs " orchid password is proposed (orchid code) ", it is believed that the AP3 genoid in B class MADS-box gene is replicated in early stage by two-wheeled, forms 4 Asias Race respectively facilitates the separation of calyx and petal, the separation of side lobe and lip, so that specific regulatory control difference flower organ morphology is built At.It is different however some researches show that the B class MADS-box gene family number of members of, orchid not sibling species is different The expression pattern and function of subtribe member also has larger difference.

The petal variation type of state orchid is abundant more than the tropical aerial orchid such as iris, oncidiumLuridum, in domestication's breeding Cheng Zhong, has cultivated a variety of sepals such as plum valve, lotus valve, narcissus valve, butterfly valve and petal morphological variation, and few valve or without valve Change, more valves, it is tree-like a variety of variation types such as spend, significantly improve its ornamental values and the economic values, but state orchid species master at present Wild resource domestication breeding is relied on, proper scale, the kind of industrialization are few, and crossbreeding period length, difficulty are big and sub It is difficult to be expected for character, Modern Molecular Biotechnology breeding technique seriously lags.How to be carried out by molecular biotechnology means Fancy points improvement, shortens breeding cycle, and high effect culture new varieties become problem in science urgently to be resolved at present.

Summary of the invention

It is an object of the invention to: overcoming traditional cross breeding of cymbidium there are the period, long, character is difficult to the problems such as expected, this Invention excavates the genetic resources that can operate with the improvement of plant flower pattern, realizes plant by using newest molecular biology method The character improvement of flower valve type.

In order to achieve the above-mentioned object of the invention, the present invention provides a kind of state orchid allelotaxis's controlling gene, it is therefrom Isolated, core in the floral organ cDNA of the Cymbidium sinense Cultivars " Bodhidharma " (Cymbidium sinense ' Dharma ') of state orchid Nucleotide sequence is by 669 base compositions, as shown in SEQ ID NO:1.

A second object of the present invention is to provide the albumen encoded by above-mentioned state orchid allelotaxis's controlling gene, the albumen It is made of 222 amino acid residues, as shown in SEQ ID NO:2.

In order to achieve the above-mentioned object of the invention, the present invention also provides the tables comprising state orchid allelotaxis's controlling gene Up to carrier, transgenic cell line, host strain and transgenic line.

The present invention has found that state orchid allelotaxis's controlling gene is in arabidopsis and orchid by technique for gene engineering Overexpression can change plant flower pattern, petal is caused to crimp, and orchid petal changes to lip, and lip character is reinforced, therefore, can The albumen of the gene and its coding is used for research and the flowering of plant character flower of orchid development of floral organs regulatory pathway The improvement of piece valve type.

Compared with prior art, the invention has the following advantages:

Floral organ of the present invention from the Cymbidium sinense Cultivars " Bodhidharma " (Cymbidium sinense ' Dharma ') of Chinese cymbidium The development of floral organs controlling gene of isolated orchid in cDNA, by the way that arabidopsis four-wheel floral organ can be caused after improving its expression quantity It is symmetrical that official by radiation symmetric becomes two sides, and petal upsweeps similar lip structure；It is high in state orchid to express above-mentioned orchid floral organ After official's developmental regulation gene, change petal to lip, lip increases.Orchid development of floral organs controlling gene provided by the invention And its modulin of coding can be used for research and the flowering of plant character flower of orchid development of floral organs molecular mechanism The improvement of valve type.

Detailed description of the invention

Fig. 1 is the AP3 phylogenetic analysis and multiple sequence ratio of CsAP3 and other source of species in the embodiment of the present invention 1 Compared with.

Fig. 2 is expression pattern analysis figure of the CsAP3 in Chinese cymbidium in the embodiment of the present invention 2.

Fig. 3 is in the embodiment of the present invention 3, and transgenic Arabidopsis plants CsAP3 expression analysis, wherein OE1-6 distinguishes table Show transgenic Arabidopsis plants.

Fig. 4 is transgenic arabidopsis phenotypic analysis in the embodiment of the present invention 3: petal curling, wherein WT indicates wild type, CsAP3-OE1, CsAP3-OE2, CsAP3-OE3 indicate transgenic plant.

Fig. 5 is in the embodiment of the present invention 4, and the instantaneous high expression of the blue CsAP3 gene in vivo of state and phenotypic analysis, CK expression contain The agrobacterium liquid of empty carrier injects plant, and CsAP3-OE indicates that the agrobacterium liquid containing pCAM1301-CsAP3 plasmid is injected and plants Strain.

Specific embodiment

In order to be more clear the purpose of the present invention, technical solution and advantageous effects, with reference to embodiments, to this Invention is further elaborated.It should be understood that embodiment described in this specification is just for the sake of this hair of explanation It is bright, be not intended to limit the present invention, parameter, ratio of embodiment etc. can adaptation to local conditions make a choice and substance had no to result It influences.

The clone of embodiment 1CsAP3 gene and sequence analysis

The extraction of 1.RNA

Chinese cymbidium cultivar Bodhidharma floral organ is taken to organize 2g, it is total to extract it using plant Trizol (Invitrogen) reagent RNA, and reverse transcription is at cDNA (Thermo Scientific Revert Aid First Strand cDNA Synthesis Kit)。

2. the acquisition of target gene CsAP3

With CsAP3-F1:ATGGGGAGAGGGAAGATAGAGAT (SEQ ID NO:3) and CsAP3-R1: TCAAGCGAGACGCAGATCAT (SEQ ID NO:4) utilizes Ex-Taq using 1 gained cDNA of above-mentioned steps as template for primer Enzyme (TaKaRa Biotechnology Co.) carries out PCR, according to following condition: 94 DEG C of 4min, then (94 DEG C of 34cycles 40s, 59.5 DEG C of 40s, 72 DEG C of 1.5min, 72 DEG C of 10min).PCR product is recycled from Ago-Gel, then connects pMD19-T Carrier (TaKaRa Biotechnology Co.) simultaneously send Hua Da gene studies institute to be sequenced.Sequencing result analysis finds to expand Segment contains the complete CDs sequence of target gene CsAP3, by 669 base compositions, nucleotide sequence such as SEQ ID NO:1 institute Show, be named as Chinese cymbidium development of floral organs controlling gene (CsAP3 gene), the amino acid sequence of the albumen of coding is by 222 ammonia Base acid residue composition, as shown in SEQ ID NO:2, is named as Chinese cymbidium development of floral organs modulin (CsAP3 albumen).It obtains Escherichia coli containing CsAP3-pMD19-T are stored in Guangdong Academy of Agricultural Sciences's environment Horticultural Research Institute at present.

3.CsAP3 gene sequencing

Choose orchid oncidiumLuridum, Ji's iris obtains AP3 in the AP3 genoid and Chinese cymbidium in the species such as dove dendrobium nobile Carry out homologous comparison, the corresponding GenBank accession number of each protein amino acid sequence be respectively as follows: OMADS5 (HM140840), OMADS3(AY196350)、OMADS9(HM140841)、PeMADS2(AY378149)、PeMADS3(AY378150)、PeMADS4 (AY378147), PeMADS5 (AY378151), DcOAP3A (DQ119838) and DcOAP3B (DQ119839), through homologous comparison As the result is shown CsAP3 and OMADS3, OMADS5, OMADS9, PeMADS2, PeMADS3, PeMADS4, PeMADS5, DcOAP3A and The homology of DcOAP3B is respectively 51%, 64%, 95%, 62%, 93%, 77%, 56%, 62% and 92%, predominantly 5 ' ends It is conservative, and 3 ' end conservatives are relatively low, and all have the conservative MADS structural domain of MADS-box gene and K structure domain and AP3 Genoid typical case's Paleo-AP3 motif.

With software MEGA by Chinese cymbidium CsAP3 gene and arabidopsis, rice, corn, oncidiumLuridum, iris, Ji's iris, dove B class MADS-box gene coding amino acid in dendrobium nobile is compared and constructs chadogram (Fig. 1).The results show that unifacial leaf is planted Object and dicotyledon are clustered into sub- branch again respectively, and different plant species class AP3 genoid encoding amino acid sequence difference is relatively large, It is dispersed in sub- branch clade1/2/3/4 4 small, CsAP3 belongs to the Asia clade3 branch.

Expression pattern of the embodiment 2CsAP3 in orchid

The extraction of 1.RNA

Take Chinese cymbidium cultivar Bodhidharma young leaflet tablet, old leaf, root, pseudobulb, flower different tissues and different flower valve types Sepal, petal, lip and each 2g of gynostemium four-wheel floral organ of mutational variety, utilize plant Trizol (Invitrogen) reagent Extract its total serum IgE, take wherein 2 μ l use reverse transcription reagent box Thermo Scientific RevertAid First Strand CDNASynthesis Kit reverse transcription is at cDNA.

2. quantitative PCR

Utilize primer CsAP3QRT-F:AAGGCAAGCGAGCTGACTGT (SEQ ID NO:5) and CsAP3QR T-R: CCATCCTCTGCCTGATCTCC (SEQ ID NO:6) carries out real-time quantitative to CsAP3 gene expression amount in orchid different tissues PCR detection.Using Ubiquitin QRT-F:CAAAGAAGGCATTCCACCAGAT (SEQ ID NO:7) and Ubiquitin QRT-R:CCGAGTCCCCAACTTTGTAGAA (SEQ ID NO:8) is used as primer, expands Ubiquitin as internal reference.According to Following procedure: 95 DEG C of initial denaturation 30s, then through 40 circulations (95 DEG C of 10s, 59.5 DEG C of 10s, 72 DEG C of 30s), 72 DEG C of extensions 10min.It is expanded, is operated using iCycler IQ Real-time PCR Detection System (Bio-Rad, USA) According to Hiscript II QRT SuperMix for qPCR (+gDNA wiper) (Vazyme Biotech Co., Ltd) reagent Box specification carries out.

3. expression analysis

With icycler realtime detection system software (version 5.0) to PCR result into Row analysis.It was found that CsAP3 gene expression quantity in root is minimum, the expression quantity in tender leaf and pseudobulb is relatively low, and in flower In expression quantity highest.Further by state's orchid growth course since shoot apical meristem is changed into floral meristem to complete It blooms and is divided into floral meristem period, floral organ former base initial stage, floral organ former base latter stage, 5 stages of bud stage and florescence, lead to Real-time fluorescence quantitative PCR detection CsAP3 gene is crossed in the expression quantity of bud different developmental phases, it is found that it germinates in bud Into five stages bloomed completely, for each stage expression difference between 0.5-1 times, expression difference is relatively small, unobvious.

Expression analysis in different valve form variation bodies shows (Fig. 2), CsAP3 strong advantage table in common flower pattern lip It reaches, followed by petal and gynostemium, is hardly expressed in sepal；In petal into " the Samsung butterfly " that lip converts, CsAP3 is same When in petal and lip strong predominant expression, whole expression quantity reach in sepal 2,000 times or more, and the expression quantity of lip 1.5 times of expression quantity about in petal, i.e., when Samsung butterfly petal is converted to lip, expression quantity is also therewith in petal by CsAP3 It is opposite to increase, and in lotus hemp nettle type, i.e., in the kind " powder lotus " that lip is degenerated, CsAP3 shows as expression quantity highest in petal, Secondary is lip, but whole expression quantity is significantly reduced compared with butterfly hemp nettle；In plum valve type kind " Chang Lemei " lip of petal stamen column Also the same loss of expression advantage, it is higher to show as expression quantity in petal, it is seen then that CsAP3 Advantage height in lip is expressed, Ke Nengyu Lip cancer cell is related.

The functional analysis of CsAP3 gene in 3 arabidopsis of embodiment

1. arabidopsis thaliana transformation high-expression vector constructs

Utilize primer CsAP3-F1:ATGGGGAGAGGGAAGATAGAGAT and CsAP3-R1:TCAAGCGAG ACGCAGATCAT amplifies CDs sequence (i.e. CsAP3 gene, the nucleotide sequence such as SEQ ID NO:1 institute of Chinese cymbidium CsAP3 gene Show), and it is cloned into pMD19-Tvector (Takara), send Hua Da gene sequencing.Be sequenced it is errorless after, use EcoRI and SacI Double digestion (Thermo Fisher Scientific), recovery purifying purpose segment, and it is connected to the enzyme by same two enzymes It cuts, is named as pBI-AP3 on the pBI121 carrier of purifying.

2. arabidopsis thaliana transformation plant

The conversion of 2.1 Agrobacterium GV3101

1) after cell is completely dissolved, about 1 μ g plasmid is added in thawing on ice in the competent cell of -80 DEG C of preservations (pBI-AP3), soft to mix, 30min is placed on ice.

2) 37 DEG C after liquid nitrogen flash freezer 1min, 5min thaws, and is repeated once, and 1mL LB is added in 28 DEG C of constant-temperature shaking cultures 4 ~6hr, 200rpm.

3) bacterium solution shake it is dense after, 4000rpm is centrifuged 5min at room temperature, abandons supernatant, and Agrobacterium is resuspended with the LB culture solution of 100 μ L Precipitating.

4) on all mixture coated plates to the LB plate containing 50 μ g/mL kanamycins and 25 μ g/mL gentamicins, 28 are placed in 48~72h is cultivated in DEG C constant incubator, choosing bacterium again after growing group and being crossed again to ensure is monoclonal, is thus turned Change the Agrobacterium for having pBI-CsAP3.

2.2 inflorescence infestation method arabidopsis thaliana transformations.

It takes out, keeps away after impregnating 2~3s of arabidopsis floral with the agrobacterium liquid that the conversion of OD=0.3~0.5 has pBI-CsAP3 After light seals 16h, continued growth in growth room is moved to.After about 3~4 weeks, the storage of seeds is collected in 4 DEG C, dark condition.

The screening of 2.3 transformation of Arabidopsis thaliana

1) 0.1% mercuric chloride solution is prepared.

2) seed of collection is put into the Eppendorf pipe of 1.5mL, adds 75% alcohol of 1mL to shake up, in Blood 5min is rotated on Tube Rotator, sterilizes 5min with 0.1% mercury chloride.

3) it is centrifuged, 6000rpm, 2min, abandons supernatant, the aqua sterilisa of 1mL is added, mix, in Blood Tube 2min is rotated on Rotator, is repeated 3 times.

4) supernatant is removed, with the sterile aqueous suspension seed of 1mL, is laid in the 1/2MS culture medium containing 50 μ g/ml kanamycins Surface, sealing plate move into tissue culture room after dark vernalization 3 days in 4 DEG C and educate under conditions of (16h L/8h D) illumination, 23 DEG C Seedling.

5) the observation statistics green cotyledon seedling number after seedling grows green cotyledon, and remove the culture being adhered on root Base is moved in matrix and is cultivated.

6) through the life cycle of 60d or so, transgenic arabidopsis first generation seed T is obtained₁, harvest second generation homozyous seed T₂(transgenic plant) is used for follow-up test.

3. transgenic arabidopsis CsAP3 expression analysis

In order to determine biological function of the CsAP3 gene in arabidopsis, respectively with arabidopsis wild type and above-mentioned steps 2 Gained transformant (T₂Homozyous seed growth after transgenic plant) cDNA be template, using primer CsAP3QRT-F: CsAP3 in AAGGCAAGCGAGCTGACTGT and CsAP3QRT-R:CCATCCTCTGCCTGATCTCC detection transgenic arabidopsis The expression quantity of gene, according to following procedure: 95 DEG C of initial denaturation 30s, then through 40 circulations (95 DEG C of 10s, 59.5 DEG C of 10s, 72 DEG C 30s), 72 DEG C of extension 10min.Using iCycler IQ Real-time PCR Detection System (Bio-Rad, USA) It is expanded, is operated according to Hiscript II QRT SuperMix for qPCR (+gDNA wiper) (Vazyme Biotech Co., Ltd) kit specification progress.As a result, it has been found that the expression quantity of CsAP3 improves in the transgenic plant of acquisition, choose Wherein three strains are used for subsequent phenotypic analysis (Fig. 3).

4. transgenic arabidopsis phenotypic analysis

The T of harvest₃The culture of the MS containing 50 μ g/ml kanamycins is layered on after surface sterilizing for homozygous transgenic plant seed On base, 4 DEG C dark culturing 2 days, be transferred to (16h L/8h D) illumination, cultivated under the conditions of 23 DEG C.In arabidopsis florescence, discovery Transgenic plant flower organ morphology textural anomaly, showing as every flower has a petal curling, and wild type column cap is upward straight Growth, and the internal column cap bending of spending of transgenic plant is grown, and as column cap elongation bending is more and more obvious, is eventually formed Fruit pod bending degree is each different, fruit pod is carried out cutting, discovery two ventricle development degree of fruit pod is different, fruit pod curved outside Develop more complete full, and curved interior then develops that quantity is few and size is also relatively small (Fig. 4).

The functional analysis of CsAP3 gene in 4 orchid of embodiment

1. high-expression vector constructs

Utilize primer CsAP3-F1:ATGGGGAGAGGGAAGATAGAGAT and CsAP3-R1:TCAAGCGAG ACGCAGATCAT amplifies the CDs sequence of Chinese cymbidium CsAP3, and is cloned into pMD19-Tvector (Takara), be sequenced it is errorless it Afterwards.Using EcoRI and SacI double digestion, recovery purifying purpose segment, and it is connected to the digestion by same two enzymes, purifying On pCAM1301 carrier, pCAM1301-CsAP3 is obtained.

2. converting orchid blade

The conversion of 2.1 Agrobacterium GV3101

1) after cell is completely dissolved, about 1 μ g plasmid is added in thawing on ice in the competent cell of -80 DEG C of preservations (pCAM1301-CsAP3), soft to mix, 30min is placed on ice.

2) 37 DEG C after liquid nitrogen flash freezer 1min, 5min thaws, and is repeated once, and 1mL LB is added in 28 DEG C of constant-temperature shaking cultures 4 ~6h, 200rpm.

4) on all mixture coated plates to the LB plate containing 50 μ g/mL kanamycins and 32 μ g/mL gentamicins, 28 are placed in 48~72h is cultivated in DEG C constant incubator, choosing bacterium again after growing group and being crossed again to ensure is monoclonal, is contained The Agrobacterium of pCAM1301-CsAP3 plasmid.

2.2 Agrobacterium direct injections convert state orchid bud

With OD=0.3~0.5, the agrobacterium liquid direct injection state orchid species " acupuncture needle " containing pCAM1301-CsAP3 plasmid Young tender leaf bud and bud, using pCAM1301 empty carrier as control.Injection is primary weekly, continuous three weeks, is placed in culturing room's relaying Continuous growth.After about 8~12 weeks, floral organ carries out gene expression amount detection after collecting inoculation.

3. being inoculated with orchid CsAP3 gene expression amount after Agrobacterium to analyze

In order to determine biological function of the CsAP3 gene in state orchid, respectively with state's orchid species " acupuncture needle " nonvaccinated open country The cDNA of raw type, empty carrier and inoculation rear blade is template, using primer CsAP3QRT-F:AAGGCAAGCGAGCTG ACTGT And CsAP3QRT-R:CCATCCTCTGCCTGATCTCC, the expression quantity of CsAP3 gene in orchid after injecting Agrobacterium is detected, is pressed According to following procedure: 95 DEG C of initial denaturation 30s, then through 40 circulations (95 DEG C of 10s, 57 DEG C of 10s, 72 DEG C of 26s).With same cDNA As template, Ubiquitin QRT-F:CAAAGAAGGCATTCCAC CAGAT and Ubiquitin QRT-R are used: CCGAGTCCCCAACTTTGTAGAA expands Ubiquitin as internal reference, according to following procedure: 95 DEG C of initial denaturation 30s, then Through 40 circulations (95 DEG C of 10s, 59.5 DEG C of 10s, 72 DEG C of 30s), 72 DEG C of extension 10min.Using iCycler IQ Real-time PCR Detection System (Bio-Rad, USA) is expanded, and is operated according to II QRT SuperMix for of Hiscript QPCR (+gDNA wiper) (Vazyme Biotech Co., Ltd) kit specification carries out.The result shows that containing The expression quantity of CsAP3 gene improves in the agrobacterium liquid injection plant of pCAM1301-CsAP3 plasmid.

4. height expression CsAP3 orchid phenotypic analysis

After being inoculated with growth of flower bud 3 weeks of the agrobacterium liquid injection plant containing pCAM1301-CsAP3 plasmid, flowering, It is compared with nonvaccinated wild type or empty carrier, the agrobacterium liquid containing pCAM1301-CsAP3 plasmid injects plant petal labiad Valve transformation, lip character are reinforced, and more lip structures (Fig. 5) are generated.

The above is only the preferred embodiment of the present invention, it is noted that above-mentioned preferred embodiment is not construed as pair Limitation of the invention, protection scope of the present invention should be defined by the scope defined by the claims..For the art For those of ordinary skill, without departing from the spirit and scope of the present invention, several improvements and modifications can also be made, these change It also should be regarded as protection scope of the present invention into retouching.

Sequence table

<110>Guangdong Academy of Agricultural Sciences's environment Horticultural Research Institute

<120>state orchid allelotaxis controlling gene and its coding albumen and application

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 669

<212> DNA

<213>Chinese cymbidium Bodhidharma (Cymbidium sinense ' Dharma ')

<400> 1

atggggagag ggaagataga gataaagaag atagagaacc ctactaacag gcaagtcact 60

tactctaaga ggagagctgg gatcatgaag aaggcaagcg agctgactgt tctctgcgac 120

gctcagctct ctcttgtaac gttctcgagc actggcaagt tctctgagta ttgtagtcca 180

accactgaca ccaagagcat atatgatcgt taccagcagg tgtccggcat aaatctatgg 240

agctcgcagt acgagaagat gcagaatacg ttgaatcatt taaaggagat aaaccaaacc 300

ctgagaaggg agatcaggca gaggatgggg gaggaccttg atgggctgga aatcaaggaa 360

ctgcgtggtc ttgagcaaaa tatggatgag tccctgaagc ttgtaaggaa tcggaagtat 420

catgtcatca gtacccagac agatacctac aaaaagaagc tgaagaactc tcaagaaacc 480

cacaggaact tactgcggga gctggaagcg gagcacgcag tctattatgt ggatgatgat 540

ccgaacagct atgatggtgc acttgcacta ggaaatgggc cttcctacct gtactcattc 600

cgtagccaac caagccagcc aaaccttcaa ggaatgggat atggccctca tgatctgcgt 660

ctcgcttga 669

<210> 2

<211> 222

<212> PRT

<213>Chinese cymbidium Bodhidharma (Cymbidium sinense ' Dharma ')

<400> 2

Met Gly Arg Gly Lys Ile Glu Ile Lys Lys Ile Glu Asn Pro Thr Asn

1 5 10 15

Arg Gln Val Thr Tyr Ser Lys Arg Arg Ala Gly Ile Met Lys Lys Ala

20 25 30

Ser Glu Leu Thr Val Leu Cys Asp Ala Gln Leu Ser Leu Val Thr Phe

35 40 45

Ser Ser Thr Gly Lys Phe Ser Glu Tyr Cys Ser Pro Thr Thr Asp Thr

50 55 60

Lys Ser Ile Tyr Asp Arg Tyr Gln Gln Val Ser Gly Ile Asn Leu Trp

65 70 75 80

Ser Ser Gln Tyr Glu Lys Met Gln Asn Thr Leu Asn His Leu Lys Glu

85 90 95

Ile Asn Gln Thr Leu Arg Arg Glu Ile Arg Gln Arg Met Gly Glu Asp

100 105 110

Leu Asp Gly Leu Glu Ile Lys Glu Leu Arg Gly Leu Glu Gln Asn Met

115 120 125

Asp Glu Ser Leu Lys Leu Val Arg Asn Arg Lys Tyr His Val Ile Ser

130 135 140

Thr Gln Thr Asp Thr Tyr Lys Lys Lys Leu Lys Asn Ser Gln Glu Thr

145 150 155 160

His Arg Asn Leu Leu Arg Glu Leu Glu Ala Glu His Ala Val Tyr Tyr

165 170 175

Val Asp Asp Asp Pro Asn Ser Tyr Asp Gly Ala Leu Ala Leu Gly Asn

180 185 190

Gly Pro Ser Tyr Leu Tyr Ser Phe Arg Ser Gln Pro Ser Gln Pro Asn

195 200 205

Leu Gln Gly Met Gly Tyr Gly Pro His Asp Leu Arg Leu Ala

210 215 220

<210> 3

<211> 23

<212> DNA

<213>artificial sequence CsAP3-F1 (Artificial sequence CsAP3-F1)

<400> 3

atggggagag ggaagataga gat 23

<210> 4

<211> 20

<212> DNA

<213>artificial sequence CsAP3-R1 (Artificial sequence CsAP3-R1)

<400> 4

tcaagcgaga cgcagatcat 20

<210> 5

<211> 20

<212> DNA

<213>artificial sequence CsAP3QRT-F (Artificial sequence CsAP3QRT-F)

<400> 5

aaggcaagcg agctgactgt 20

<210> 6

<211> 20

<212> DNA

<213>artificial sequence CsAP3QRT-R (Artificial sequence CsAP3QRT-R)

<400> 6

ccatcctctg cctgatctcc 20

<210> 7

<211> 22

<212> DNA

<213>artificial sequence UbiquitinActin QRT-F (Artificial sequence UbiquitinActin QRT-F)

<400> 7

caaagaaggc attccaccag at 22

<210> 8

<211> 22

<212> DNA

<213>artificial sequence UbiquitinActin QRT-R (Artificial sequence UbiquitinActin QRT-R)

<400> 8

ccgagtcccc aactttgtag aa 22

Claims

1. a kind of state orchid allelotaxis's controlling gene, which is characterized in that the core of state's orchid allelotaxis's controlling gene Nucleotide sequence is as shown in SEQ ID NO:1.

2. a kind of state orchid allelotaxis's modulin, which is characterized in that the amino of state orchid allelotaxis's modulin Acid sequence is as shown in SEQ ID NO:2.

3. state orchid allelotaxis's modulin according to claim 2, which is characterized in that the state orchid allelotaxis Modulin is encoded by state orchid allelotaxis's controlling gene described in claim 1.

4. a kind of expression vector, which is characterized in that include state orchid allelotaxis's controlling gene described in claim 1.

5. a kind of transgenic cell line, which is characterized in that include state orchid allelotaxis's controlling gene described in claim 1.

6. a kind of host strain, which is characterized in that include state orchid allelotaxis's controlling gene described in claim 1.

7. a kind of transgenic line, which is characterized in that include state orchid allelotaxis's controlling gene described in claim 1.

8. state orchid allelotaxis controlling gene described in claim 1 answering in the improvement of flowering of plant character flower valve type With.

9. application according to claim 8, which is characterized in that the flower valve type improvement is to turn petal to lip Become, the improvement that lip increases.

10. state orchid allelotaxis modulin described in claim 2 or 3 is in the improvement of flowering of plant character flower valve type Using.