CN109055392B

CN109055392B - Orchis orchid organ development regulation gene and its coded protein and application

Info

Publication number: CN109055392B
Application number: CN201810866392.8A
Authority: CN
Inventors: 杨凤玺; 朱根发; 魏永路; 陆楚桥; 彭玲愿
Original assignee: Environmental Horticulture Institute of Guangdong Academy of Agricultural Sciences
Current assignee: Environmental Horticulture Institute of Guangdong Academy of Agricultural Sciences
Priority date: 2018-08-01
Filing date: 2018-08-01
Publication date: 2021-09-10
Anticipated expiration: 2038-08-01
Also published as: CN109055392A

Abstract

The invention discloses a Chinese orchid organ development regulation gene, and a coding protein and application thereof. The Cymbidium sinense organ development regulating gene is separated from the floral organ cDNA of Cymbidium sinense 'dammo' (Cymbidium sinense) of Cymbidium sinense, and the nucleotide sequence is shown as SEQ ID NO. 1; the amino acid sequence of the Chinese orchid organ development regulation protein is shown in SEQ ID NO. 2. According to the invention, through the discovery of a gene engineering technology, the cymbidium organ development regulation gene is overexpressed in arabidopsis thaliana and orchid, the flower type of the plant can be changed, the petals are curled, the petals of the orchid are changed to the lipflaps, and the lipflap character is strengthened, so that the gene and the protein coded by the gene can be used for researching the development regulation way of the orchid organ and improving the petal type of the plant flowering character.

Description

Orchis orchid organ development regulation gene and its coded protein and application

Technical Field

The invention relates to the technical field of plant genetic engineering, in particular to a Chinese orchid organ development regulation gene and a coding protein and application thereof.

Background

The orchids have highly specialized flower organs and rich biodiversity and are precious gardening ornamental flowers. 801 has been found to belong to more than 3 ten thousand species worldwide, and can be divided into three categories of Gesheng orchid, Qisheng orchid and Husheng orchid according to ecological habits. The orchid is one of ten kinds of flowers in China, mainly comprises 8 kinds of cymbidium, cymbidium bicolor, cymbidium kanran, and spring sword, and has high economic value. Plant molecular biology researches show that the expansion of the B-type MADS-box gene expression region to expand the 1 st round flower organ is the molecular basis for the development of the 1 st and 2 nd round flower organs of most monocotyledons into a perianth-like structure. However, unlike some other monocotyledons such as lily (Lilium brownni), tulip (Tulipa gesneana), Agapanthus (Agapanthus praecox), etc., the outermost three calyces are usually divided into one dorsal (dorsal) and two lateral (lateral) calyces, which are similar in shape, while the inner three petals are divided into two lateral petals and another specialized curled lip (lip or labellum). Mondragon-Palomino et al (2011) proposed an orchid code for floral organ development through researches on phalaenopsis, vanilla and paphiopedilum americanum, and think that AP3 type genes in B type MADS-box genes are copied in two rounds at an early stage to form 4 subfamilies, so that the separation of calyx and petals and the separation of side petals and lip petals are respectively promoted, and the morphogenesis of different floral organs is specifically regulated and controlled. However, researches show that the number of B-type MADS-box gene family members of different species of Orchidaceae plants is different, and the expression patterns and functions of different subfamilies are greatly different.

The petal variation types of the national orchid are far more abundant than tropical aerial orchids such as butterfly orchid, oncidium orchid and the like, in the process of artificial domestication and breeding, a plurality of sepals and petal form variations such as plum petals, lotus petals, narcissus petals, butterfly petals and the like, and a plurality of variation types such as little petals or no petals, multi-petals, tree-shaped flowers and the like are bred, so that the ornamental value and the economic value of the wild aerial orchids are obviously improved, but the national orchid varieties are domesticated and bred mainly by wild resources at present, the wild aerial orchids are suitable for large-scale and industrialized varieties, the cross breeding period is long, the difficulty is high, the offspring characters are difficult to expect, and the modern molecular biotechnology breeding means is seriously lagged. How to improve ornamental characters by means of molecular biotechnology, shorten breeding cycle and cultivate new species with high efficiency becomes a scientific problem to be solved urgently at present.

Disclosure of Invention

The invention aims to: the invention solves the problems of long period, difficult character expectation and the like of the traditional Chinese orchid crossbreeding, and realizes the character improvement of the flower petal of the plant by digging gene resources which can be applied to the improvement of the flower type of the plant by using the latest molecular biology means.

In order to realize the aim, the invention provides a Cymbidium floribundum floral organ development regulating gene which is separated from a floral organ cDNA of Cymbidium floribundum variety Dharma' of Cymbidium floribundum, and the nucleotide sequence of the gene consists of 669 basic groups and is shown as SEQ ID NO. 1.

The second purpose of the invention is to provide the protein coded by the cymbidium organ development regulating gene, which consists of 222 amino acid residues and is shown as SEQ ID NO. 2.

In order to realize the aim, the invention also provides an expression vector, a transgenic cell line, a host bacterium and a transgenic material containing the Chinese orchid organ development regulation gene.

According to the invention, through the discovery of a gene engineering technology, the cymbidium organ development regulation gene is overexpressed in arabidopsis thaliana and orchid, the flower type of the plant can be changed, the petals are curled, the petals of the orchid are changed to the lipflaps, and the lipflap character is strengthened, so that the gene and the protein coded by the gene can be used for researching the development regulation way of the orchid organ and improving the petal type of the plant flowering character.

Compared with the prior art, the invention has the following beneficial effects:

the invention separates the floral organ development regulating gene of orchid from the floral organ cDNA of Cymbidium sinense 'Dharma', after the expression quantity is increased, the arabidopsis four-wheel floral organ can be changed from radiation symmetry to bilateral symmetry, and the petals can be curled upwards to be similar to the structure of lip petal; after the orchid organ development regulation gene is highly expressed in the cymbidium, petals are changed to lip petals, and the lip petals are increased. The orchid floral organ development regulating gene and the regulating protein coded by the same can be used for researching the molecular mechanism of orchid floral organ development and improving the flowering character petal type of plants.

Drawings

FIG. 1 shows the evolutionary tree analysis and multiple sequence comparisons of CsAP3 with AP3 from other species in example 1 of the present invention.

FIG. 2 is an analysis chart of the expression pattern of CsAP3 in May blue in example 2 of the present invention.

FIG. 3 shows the expression level analysis of CsAP3 in the transgenic Arabidopsis plants in example 3, wherein OE1-6 represents the transgenic Arabidopsis plants respectively.

FIG. 4 is a phenotypic analysis of transgenic Arabidopsis thaliana in example 3 of the present invention: petal curls, wherein WT represents wild type, CsAP3-OE1, CsAP3-OE2, CsAP3-OE3 represent transgenic plants.

FIG. 5 shows the transient overexpression and phenotype analysis of CsAP3 gene in cymbidium, CK represents the Agrobacterium solution-injected plant containing empty vector, and CsAP3-OE represents the Agrobacterium solution-injected plant containing pCAM1301-CsAP3 plasmid in example 4 of the present invention.

Detailed Description

In order to make the objects, technical solutions and advantageous technical effects of the present invention clearer, the present invention is further described in detail with reference to the following embodiments. It should be understood that the embodiments described in this specification are only for the purpose of illustrating the invention and are not to be construed as limiting the invention, and the parameters, proportions and the like of the embodiments may be suitably selected without materially affecting the results.

Example 1 cloning and sequence analysis of CsAP3 Gene

Extraction of RNA

Taking 2g of Moore flower organ tissue of the cymbidium goeringii cultivar, extracting its total RNA with plant Trizol (Invitrogen) reagent, and reverse-transcribing into cDNA (thermo Scientific reverse Aid First Strand cDNA Synthesis kit).

2. Obtaining of target Gene CsAP3

CsAP 3-F1: ATGGGGAGAGGGAAGATAGAGAT (SEQ ID NO:3) and CsAP 3-R1: TCAAGCGAGACGCAGATCAT (SEQ ID NO:4) as a primer, and using the cDNA obtained in the above step 1 as a template, PCR was performed using Ex-Taq enzyme (TaKaRa Biotechnology Co.) under the following conditions: 94 ℃ for 4min, then 34cycles (94 ℃ for 40s, 59.5 ℃ for 40s, 72 ℃ for 1.5min, 72 ℃ for 10 min). The PCR product was recovered from the agarose gel and then ligated into the pMD19-T vector (TaKaRa Biotechnology Co.) and sent to the Huada institute for sequencing. The analysis of the sequencing result shows that the amplified fragment contains the complete CDs sequence of the target gene CsAP3, consists of 669 basic groups, the nucleotide sequence is shown as SEQ ID NO:1, and is named as the cymbidium sinense organ development regulatory gene (CsAP3 gene), the amino acid sequence of the coded protein consists of 222 amino acid residues, and is shown as SEQ ID NO:2, and is named as the cymbidium sinense organ development regulatory protein (CsAP3 protein). The obtained CsAP3-pMD 19-T-containing Escherichia coli is currently stored in environmental gardening institute of academy of agricultural sciences of Guangdong province.

CsAP3 gene sequence analysis

Selecting AP3 genes in orchidaceae plants, such as oncidium, phalaenopsis amabilis, pigeon dendrobium and the like, and carrying out homologous comparison with AP3 obtained from cymbidium sinense, wherein GenBank accession numbers corresponding to amino acid sequences of each protein are respectively as follows: OMADS5(HM140840), OMADS3(AY196350), OMADS9(HM140841), PeMADS2(AY378149), PeMADS3(AY378150), PeMADS4(AY378147), PeMADS5(AY378151), DOAP 3A (DQ119838) and DOAP 3B (DQ119839), and homology comparison results show that the homology of CsAP3 with OMADS3, OMADS5, OMADS9, PeMADS2, PeMADS3, PeMADS4, PeMADS5, DcAP 3A and OAP3B are 51%, 64%, 95%, 62%, 93%, 77%, 56%, 62% and 92%, mainly 5 'end conserved regions and 3' end regions with low conserved-box genes and conserved structural motifs of OADS 3, and typical PADS 3-class gene domains.

The software MEGA is used for comparing the CsAP3 gene of the cymbidium with the amino acid coded by the B-type MADS-box gene in arabidopsis thaliana, rice, corn, oncidium, phalaenopsis, pigeon dendrobium and constructing an evolutionary tree (figure 1). The results show that the monocotyledons and dicotyledons are clustered into subbranches respectively, the difference of the amino acid sequences coded by the genes of the AP3 class of different species is relatively large, the sequences are dispersed in 4 small subbranches clade1/2/3/4, and CsAP3 belongs to clade3 subbranches.

Example 2 expression Pattern of CsAP3 in orchid

Extraction of RNA

Taking 2g of four-wheel flower organs of dammo tender leaves, old leaves, roots, pseudobulbs, different tissues of the cymbidium cultivar and different petal type variants of the cymbidium, petals, labial flaps and synanthotamus, extracting total RNA of the four-wheel flower organs by using Trizol (Invitrogen) reagent, and carrying out reverse transcription on 2 ul of the total RNA by using a reverse transcription Kit Thermo Scientific revertTaid First Strand cDNAsynthesis Kit to obtain cDNA.

2. Quantitative PCR

The primer CsAP3QRT-F is used: AAGGCAAGCGAGCTGACTGT (SEQ ID NO:5) and CsAP3QR T-R: CCATCCTCTGCCTGATCTCC (SEQ ID NO:6), and real-time quantitative PCR detection is carried out on CsAP3 gene expression in different tissues of orchid. Using Ubiquitin QRT-F: CAAAGAAGGCATTCCACCAGAT (SEQ ID NO:7) and Ubiquitin QRT-R: CCGAGTCCCCAACTTTGTAGAA (SEQ ID NO:8) as primers and Ubiquitin was amplified as an internal control. The following procedure was followed: pre-denaturation at 95 ℃ for 30s, followed by 40 cycles (95 ℃ 10s, 59.5 ℃ 10s, 72 ℃ 30s) of extension at 72 ℃ for 10 min. Amplification was performed using the iCycler IQreal-time PCR Detection System (Bio-Rad, USA) according to the instructions of the Hiscript II QRT SuperMix for qPCR (+ gDNA wiper) (Vazyme Biotech Co., Ltd.).

3. Expression analysis

PCR results were analyzed using an ICYCLER REALITY DETECTION SYSTEM SOFTWARE (version 5.0). The CsAP3 gene was found to be expressed in the roots at the lowest level, in young leaves and pseudobulbs at a relatively low level, and in flowers at the highest level. Further dividing the development process of the Chinese orchid from the stem tip meristem to the flower meristem to the complete flowering into 5 stages, namely a flower meristem stage, a flower organ primordium initial stage, a flower organ primordium final stage, a bud stage and a flowering stage, detecting the expression quantity of the CsAP3 gene in different development stages of the flower bud through real-time fluorescent quantitative PCR, and finding that the difference of the expression quantity of the CsAP3 gene in each stage from the flower bud development to the complete flowering is 0.5-1 time, and the difference of the expression quantity is relatively small and unobvious.

Expression analysis in different petal variants showed (FIG. 2) that CsAP3 is strongly and predominantly expressed in the common petal-type lip, followed by petals and synanthus, and hardly expressed in sepals; in the 'samsung butterfly' with petals transformed to the lips, CsAP3 is strongly and dominantly expressed in the petals and the lips at the same time, the overall expression level reaches more than two thousand times in the sepals, and the expression level of the lips is about 1.5 times of the expression level in the petals, namely when the samsung butterfly petals are transformed to the lips, the expression level of CsAP3 in the petals is relatively increased, and in the lotus flower type, namely the variety 'pink load' with degenerated lips, CsAP3 shows that the expression level in the petals is the highest, and then the lips are the petals, but the overall expression level is obviously reduced compared with the butterflies; the lipped of the petaloid variety 'Changlemei' with petaloid pistils also lacks expression advantages, and the expression is shown as high expression in the petaloid, so that CsAP3 has high expression advantages in the lipaloid and is possibly related to the specific differentiation of the lipaloid.

Example 3 analysis of function of CsAP3 Gene in Arabidopsis thaliana

1. Construction of high expression vector for transforming Arabidopsis thaliana

Using primers CsAP 3-F1: ATGGGGAGAGGGAAGATAGAGAT and CsAP 3-R1: TCAAGCGAG ACGCAGATCAT the CDs sequence of CsAP3 gene (namely CsAP3 gene, the nucleotide sequence is shown in SEQ ID NO: 1) is amplified and cloned to pMD19-Tvector (Takara), sent to Huada gene for sequencing. After sequencing, the desired fragment was recovered by double digestion with EcoRI and SacI (Thermo Fisher Scientific) and ligated into the purified pBI121 vector, which had been digested with the same two enzymes, designated pBI-AP 3.

2. Transformation of Arabidopsis plants

2.1 transformation of Agrobacterium GV3101

1) Thawing competent cells stored at-80 deg.C on ice, adding about 1 μ g plasmid (pBI-AP3) after the cells are completely lysed, gently mixing, and standing on ice for 30 min.

2) Quickly freezing with liquid nitrogen for 1min, thawing at 37 deg.C for 5min, repeating the steps, adding 1mL LB, and shaking at 28 deg.C for 4-6 hr at 200 rpm.

3) After shaking the bacterial liquid to concentrate, centrifuging at 4000rpm for 5min at room temperature, discarding the supernatant, and resuspending the Agrobacterium pellet with 100. mu.L of LB culture medium.

4) All the mixtures were plated on LB plates containing 50. mu.g/mL kanamycin and 25. mu.g/mL gentamicin, incubated at 28 ℃ for 48-72 hours in an incubator, and after colonies were grown out, the colonies were selected and restreaked to ensure monoclonality, thereby obtaining Agrobacterium transformed with pBI-CsAP 3.

2.2 transformation of Arabidopsis thaliana by inflorescence infection.

Soaking an arabidopsis thaliana inflorescence for 2-3 s by using agrobacterium liquid transformed with pBI-CsAP3 with OD (equal to 0.3-0.5), taking out, sealing for 16h in a dark place, and transferring to a growth chamber for continuous growth. After about 3-4 weeks, the seeds were collected and stored at 4 ℃ in the dark.

2.3 Arabidopsis transformants selection

1) A 0.1% mercuric chloride solution was prepared.

2) The collected seeds were placed in a 1.5mL Eppendorf Tube, shaken with 1mL of 75% ethanol, spun on a Blood Tube Rotator for 5min, and sterilized with 0.1% mercuric chloride for 5 min.

3) Centrifuging at 6000rpm for 2min, removing supernatant, adding 1mL sterile water, mixing, and rotating on Blood Tube rotor for 2min for 3 times.

4) The supernatant was removed, and the seeds were suspended in 1mL of sterile water, spread on the surface of 1/2MS medium containing 50. mu.g/mL kanamycin, sealed on a plate, vernalized in the dark at 4 ℃ for 3 days, and then transferred to a tissue culture chamber to be exposed to light (16h L/8h D) and grown at 23 ℃.

5) And observing and counting the number of green cotyledon seedlings after the seedlings grow out of green cotyledon, removing the culture medium adhered to the roots, and transferring the seedlings to a matrix for culture.

6) Obtaining the first generation seed T of the transgenic arabidopsis thaliana through a life cycle of about 60d₁Harvesting the second generation homozygous seed T₂(transgenic plants) were used for subsequent experiments.

3. Analysis of expression level of CsAP3 in transgenic Arabidopsis

To determine the biological function of the CsAP3 gene in Arabidopsis thaliana, the Arabidopsis thaliana wild type and the transformant obtained in step 2 (T) were used respectively₂Transgenic plant after homozygous seed growth) cDNA as a template, and adopting a primer CsAP3 QRT-F: AAGGCAAGCGAGCTGACTGT and CsAP3 QRT-R: CCATCCTCTGCCTGATCTCC the expression level of CsAP3 gene in transgenic Arabidopsis thaliana was detected according to the following procedures: 95 deg.CPre-denaturation for 30s, followed by 40 cycles (95 ℃ 10s, 59.5 ℃ 10s, 72 ℃ 30s), 72 ℃ extension for 10 min. Amplification was performed using the iCycler IQreal-time PCR Detection System (Bio-Rad, USA) according to the instructions of the Hiscript II QRT SuperMix for qPCR (+ gDNA wiper) (Vazyme Biotech Co., Ltd.). As a result, the expression level of CsAP3 was increased in the obtained transgenic plants, and three lines were selected for subsequent phenotypic analysis (FIG. 3).

4. Phenotypic analysis of transgenic Arabidopsis

Harvested T₃The seeds of the generation homozygous transgenic plants are surface sterilized, spread on an MS culture medium containing 50 mu g/ml kanamycin, cultured in the dark at 4 ℃ for 2 days, transferred to (16h L/8h D) for illumination, and cultured at 23 ℃. In the flowering period of arabidopsis thaliana, the morphological structure of the flower organ of the transgenic plant is found to be abnormal, the flower organ is shown to have one petal curling, the wild-type stigma grows upwards straightly, the stigma in the flower of the transgenic plant grows in a bending way and bends more and more obviously along with the elongation of the stigma, the bending degrees of finally formed pods are different, the pods are cut, the development degrees of two ventricles of the pods are different, the bent outer sides of the pods develop completely and fully, and the bent inner sides develop less and have relatively smaller sizes (fig. 4).

Example 4 functional analysis of CsAP3 Gene in orchid

1. High expression vector construction

Using primers CsAP 3-F1: ATGGGGAGAGGGAAGATAGAGAT and CsAP 3-R1: TCAAGCGAG ACGCAGATCAT CDs sequence of CsAP3 in Maolan was amplified and cloned into pMD19-Tvector (Takara) and sequenced without errors. The purified target fragment was recovered by double digestion with EcoRI and SacI and ligated to the pCAM1301 vector purified by the same two enzymes to obtain pCAM1301-CsAP 3.

2. Transformed orchid leaf

2.1 transformation of Agrobacterium GV3101

1) Thawing competent cells stored at-80 deg.C on ice, adding about 1 μ g plasmid (pCAM1301-CsAP3) after the cells are completely lysed, gently mixing, and standing on ice for 30 min.

2) Quickly freezing for 1min by using liquid nitrogen, thawing for 5min, repeating the thawing once, adding 1mL of LB at the constant temperature of 28 ℃, and carrying out shaking culture for 4-6 h at 200 rpm.

4) And (3) coating all the mixtures on LB plates containing 50 mu g/mL kanamycin and 32 mu g/mL gentamicin, placing the plates in an incubator at 28 ℃ for culturing for 48-72 h, and selecting and re-streaking the bacteria after colonies grow out to ensure that the bacteria are monoclonal, so as to obtain the agrobacterium containing the pCAM1301-CsAP3 plasmid.

2.2 Agrobacterium direct injection method for transformation of Chinese orchid bud

Young leaf buds and flower buds of the cymbidium strain "silver needle" were directly injected with agrobacterium fluid containing plasmids pCAM1301-CsAP3 with OD of 0.3-0.5, and the pCAM1301 empty vector was used as a control. Once weekly for three weeks, the cells were placed in a culture chamber for further growth. And collecting the inoculated flower organs for gene expression amount detection after about 8-12 weeks.

3. Analysis of orchid CsAP3 gene expression after inoculation of agrobacterium

In order to determine the biological function of the CsAP3 gene in the national orchid, the cDNA of the wild type, the empty vector and the inoculated leaf blade which are not inoculated in the national orchid variety 'silver needle' are respectively used as templates, and a primer CsAP3QRT-F is adopted: AAGGCAAGCGAGCTG ACTGT and CsAP3 QRT-R: CCATCCTCTGCCTGATCTCC, detecting the expression level of CsAP3 gene in orchid after injecting agrobacterium, according to the following program: pre-denaturation at 95 ℃ for 30s, followed by 40 cycles (95 ℃ 10s, 57 ℃ 10s, 72 ℃ 26 s). Using the same cDNA as template, Ubiquitin QRT-F: CAAAGAAGGCATTCCAC CAGAT and Ubiquitin QRT-R: CCGAGTCCCCAACTTTGTAGAA, amplification of Ubiquitin as internal control, following the following procedure: pre-denaturation at 95 ℃ for 30s, followed by 40 cycles (95 ℃ 10s, 59.5 ℃ 10s, 72 ℃ 30s) of extension at 72 ℃ for 10 min. Amplification was performed using the iCycler IQreal-time PCR Detection System (Bio-Rad, USA) according to the instructions of the Hiscript II QRT SuperMix for qPCR (+ gDNA wiper) (Vazyme Biotech Co., Ltd.). The results show that the expression level of CsAP3 gene is increased in the agrobacterium liquid injection plant containing pCAM1301-CsAP3 plasmid.

4. Orchid phenotype analysis with high expression CsAP3

After 3 weeks of flower bud growth, the flower opened, and compared with the uninoculated wild type or empty vector, the flower petal of the agrobacterium liquid injection plant containing pCAM1301-CsAP3 transformed to the lip, and the lip character strengthened, and more lip structure was generated (FIG. 5).

The above is only a preferred embodiment of the present invention, and it should be noted that the above preferred embodiment should not be considered as limiting the present invention, and the protection scope of the present invention should be subject to the scope defined by the claims. It will be apparent to those skilled in the art that various modifications and adaptations can be made without departing from the spirit and scope of the invention, and these modifications and adaptations should be considered within the scope of the invention.

Sequence listing

<110> environmental gardening institute of academy of agricultural sciences of Guangdong province

<120> cymbidium organ development regulation gene and its coding protein and application

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 669

<212> DNA

<213> Mole Maoland (Cymbidium sinense 'Dhara')

<400> 1

atggggagag ggaagataga gataaagaag atagagaacc ctactaacag gcaagtcact 60

tactctaaga ggagagctgg gatcatgaag aaggcaagcg agctgactgt tctctgcgac 120

gctcagctct ctcttgtaac gttctcgagc actggcaagt tctctgagta ttgtagtcca 180

accactgaca ccaagagcat atatgatcgt taccagcagg tgtccggcat aaatctatgg 240

agctcgcagt acgagaagat gcagaatacg ttgaatcatt taaaggagat aaaccaaacc 300

ctgagaaggg agatcaggca gaggatgggg gaggaccttg atgggctgga aatcaaggaa 360

ctgcgtggtc ttgagcaaaa tatggatgag tccctgaagc ttgtaaggaa tcggaagtat 420

catgtcatca gtacccagac agatacctac aaaaagaagc tgaagaactc tcaagaaacc 480

cacaggaact tactgcggga gctggaagcg gagcacgcag tctattatgt ggatgatgat 540

ccgaacagct atgatggtgc acttgcacta ggaaatgggc cttcctacct gtactcattc 600

cgtagccaac caagccagcc aaaccttcaa ggaatgggat atggccctca tgatctgcgt 660

ctcgcttga 669

<210> 2

<211> 222

<212> PRT

<213> Mole Maoland (Cymbidium sinense 'Dhara')

<400> 2

Met Gly Arg Gly Lys Ile Glu Ile Lys Lys Ile Glu Asn Pro Thr Asn

1 5 10 15

Arg Gln Val Thr Tyr Ser Lys Arg Arg Ala Gly Ile Met Lys Lys Ala

20 25 30

Ser Glu Leu Thr Val Leu Cys Asp Ala Gln Leu Ser Leu Val Thr Phe

35 40 45

Ser Ser Thr Gly Lys Phe Ser Glu Tyr Cys Ser Pro Thr Thr Asp Thr

50 55 60

Lys Ser Ile Tyr Asp Arg Tyr Gln Gln Val Ser Gly Ile Asn Leu Trp

65 70 75 80

Ser Ser Gln Tyr Glu Lys Met Gln Asn Thr Leu Asn His Leu Lys Glu

85 90 95

Ile Asn Gln Thr Leu Arg Arg Glu Ile Arg Gln Arg Met Gly Glu Asp

100 105 110

Leu Asp Gly Leu Glu Ile Lys Glu Leu Arg Gly Leu Glu Gln Asn Met

115 120 125

Asp Glu Ser Leu Lys Leu Val Arg Asn Arg Lys Tyr His Val Ile Ser

130 135 140

Thr Gln Thr Asp Thr Tyr Lys Lys Lys Leu Lys Asn Ser Gln Glu Thr

145 150 155 160

His Arg Asn Leu Leu Arg Glu Leu Glu Ala Glu His Ala Val Tyr Tyr

165 170 175

Val Asp Asp Asp Pro Asn Ser Tyr Asp Gly Ala Leu Ala Leu Gly Asn

180 185 190

Gly Pro Ser Tyr Leu Tyr Ser Phe Arg Ser Gln Pro Ser Gln Pro Asn

195 200 205

Leu Gln Gly Met Gly Tyr Gly Pro His Asp Leu Arg Leu Ala

210 215 220

<210> 3

<211> 23

<212> DNA

<213> Artificial sequence CsAP3-F1(Artificial sequence CsAP3-F1)

<400> 3

atggggagag ggaagataga gat 23

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence CsAP3-R1(Artificial sequence CsAP3-R1)

<400> 4

tcaagcgaga cgcagatcat 20

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence CsAP3QRT-F (Artificial sequence CsAP3QRT-F)

<400> 5

aaggcaagcg agctgactgt 20

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence CsAP3QRT-R (Artificial sequence CsAP3QRT-R)

<400> 6

ccatcctctg cctgatctcc 20

<210> 7

<211> 22

<212> DNA

<213> Artificial sequence ubiquitin Actin QRT-F (Artificial sequence ubiquitin Actin QRT-F)

<400> 7

caaagaaggc attccaccag at 22

<210> 8

<211> 22

<212> DNA

<213> Artificial sequence ubiquitin Actin QRT-R (Artificial sequence ubiquitin Actin QRT-R)

<400> 8

ccgagtcccc aactttgtag aa 22

Claims

1. The application of the cymbidium organ development regulating gene in the improvement of the petal type of the cymbidium flowering character is characterized in that the petal type improvement is the improvement of changing petals to lipflaps and increasing the lipflaps, and the nucleotide sequence of the cymbidium organ development regulating gene is shown as SEQ ID NO. 1.

2. The application of the Chinese orchid organ development regulating protein in the improvement of a Chinese orchid flowering character petal type is characterized in that petals are changed to lip petals, and the lip petals are increased, and the amino acid sequence of the Chinese orchid organ development regulating protein is shown as SEQ ID NO. 2.